Starting /dee2/code/volunteer_pipeline.sh SRR7170501 current disk space = 3052031938560 free memory = 1582108828 SRR7170501 SRAfilesize b0f00bb03db794b24def219ea12766fd SRR7170501.sra SRR7170501.sra file validated SRR7170501 is paired end SRR7170501 is conventional basespace SRR7170501 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170501_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.108 18.0 18.0 18.0 18.0 32.0 2 26.04575 27.0 25.0 27.0 18.0 30.0 3 26.8515 27.0 25.0 30.0 18.0 33.0 4 29.85725 31.0 29.0 33.0 27.0 33.0 5 31.0105 32.0 32.0 33.0 27.0 33.0 6 35.79675 37.0 36.0 38.0 32.0 38.0 7 36.99925 38.0 37.0 38.0 35.0 38.0 8 37.07925 38.0 38.0 38.0 35.0 38.0 9 37.32775 38.0 38.0 38.0 36.0 38.0 10-14 37.4493 38.0 38.0 38.0 37.0 38.0 15-19 37.54774999999999 38.0 38.0 38.0 37.4 38.0 20-24 37.53249999999999 38.0 38.0 38.0 37.4 38.0 25-29 37.62985 38.0 38.0 38.0 38.0 38.0 30-34 37.57430000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.587599999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.573899999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.5096 38.0 38.0 38.0 37.4 38.0 50-54 37.457100000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.378 38.0 38.0 38.0 36.8 38.0 60-64 37.324600000000004 38.0 38.0 38.0 36.8 38.0 65-69 37.33495 38.0 38.0 38.0 36.8 38.0 70-74 37.193799999999996 38.0 38.0 38.0 36.0 38.0 75-79 37.026250000000005 38.0 38.0 38.0 35.8 38.0 80-84 37.13665000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.91335 38.0 38.0 38.0 35.4 38.0 90-94 36.8977 38.0 38.0 38.0 35.0 38.0 95-99 36.76135000000001 38.0 38.0 38.0 34.6 38.0 100-104 36.757600000000004 38.0 38.0 38.0 34.4 38.0 105-109 36.5488 38.0 37.4 38.0 34.0 38.0 110-114 36.43515 38.0 37.4 38.0 33.8 38.0 115-119 35.95315 38.0 36.8 38.0 32.4 38.0 120-124 36.04455 38.0 36.8 38.0 32.6 38.0 125-129 35.762100000000004 38.0 36.0 38.0 31.8 38.0 130-134 32.236399999999996 35.2 28.4 38.0 23.2 38.0 135-139 34.552049999999994 38.0 33.4 38.0 27.0 38.0 140-144 30.3829 33.8 26.2 37.8 17.2 38.0 145-149 32.798649999999995 37.4 32.8 38.0 17.0 38.0 150-151 28.677 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 3.0 20 0.0 21 0.0 22 3.0 23 1.0 24 4.0 25 5.0 26 10.0 27 17.0 28 22.0 29 32.0 30 36.0 31 66.0 32 80.0 33 126.0 34 251.0 35 577.0 36 1554.0 37 1213.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.657894736842106 28.39473684210526 8.605263157894736 37.34210526315789 2 23.775 13.750000000000002 33.025 29.45 3 21.625 20.1 25.374999999999996 32.9 4 22.475 29.599999999999998 21.725 26.200000000000003 5 22.85 32.05 25.0 20.1 6 19.5 34.875 25.074999999999996 20.549999999999997 7 13.625000000000002 25.0 43.475 17.9 8 17.675 25.6 31.574999999999996 25.15 9 16.275000000000002 23.599999999999998 36.175000000000004 23.95 10-14 19.31 30.04 27.415 23.235 15-19 19.545 28.754999999999995 27.51 24.19 20-24 19.125 28.939999999999998 28.325 23.61 25-29 19.93 28.904999999999998 27.825 23.34 30-34 19.59 29.21 27.525 23.674999999999997 35-39 19.49 28.325 27.744999999999997 24.44 40-44 19.975 28.98 27.310000000000002 23.735 45-49 20.03 28.860000000000003 27.839999999999996 23.27 50-54 19.915 28.99 27.52 23.575 55-59 20.265 29.04 27.58 23.115 60-64 20.064999999999998 28.804999999999996 27.500000000000004 23.630000000000003 65-69 20.05 28.335 27.465 24.15 70-74 19.79 28.845 27.36 24.005000000000003 75-79 19.7 28.28 28.335 23.685000000000002 80-84 19.580000000000002 28.975 27.35 24.095 85-89 20.285 28.355000000000004 27.51 23.849999999999998 90-94 20.49 27.87 27.88 23.76 95-99 19.98 28.610000000000003 27.339999999999996 24.07 100-104 20.525 27.839999999999996 27.765 23.87 105-109 20.495 27.834999999999997 28.345 23.325000000000003 110-114 20.044999999999998 28.199999999999996 27.955000000000002 23.799999999999997 115-119 20.65 28.24 27.68 23.43 120-124 20.52 28.299999999999997 27.534999999999997 23.645 125-129 20.26 27.785 27.87 24.085 130-134 20.525 27.85 27.55 24.075 135-139 20.625 27.644999999999996 27.584999999999997 24.145 140-144 20.445 27.57 27.775 24.21 145-149 20.544999999999998 28.12 27.105 24.23 150-151 20.6625 27.3625 27.737499999999997 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 4.0 25 6.5 26 6.0 27 6.5 28 12.0 29 18.5 30 24.0 31 26.0 32 35.0 33 43.5 34 63.5 35 82.5 36 95.0 37 126.0 38 143.0 39 166.5 40 194.5 41 218.0 42 237.0 43 246.0 44 260.5 45 260.5 46 246.0 47 243.5 48 242.0 49 208.5 50 163.5 51 136.5 52 116.0 53 93.5 54 66.5 55 58.0 56 50.0 57 29.0 58 19.0 59 12.0 60 8.5 61 8.0 62 7.5 63 4.0 64 1.5 65 1.5 66 1.5 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.7750000000000004 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 3.7875 0.0 0.0 0.0 0.0 134-135 3.9375 0.0 0.0 0.0 0.0 136-137 4.275 0.0 0.0 0.0 0.0 138-139 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACGAA 10 0.0068343505 144.975 4 >>END_MODULE SRR7170501 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170501_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89525 33.0 33.0 34.0 32.0 34.0 2 32.9615 34.0 33.0 34.0 32.0 34.0 3 33.04075 34.0 33.0 34.0 32.0 34.0 4 33.0705 34.0 33.0 34.0 32.0 34.0 5 32.99275 34.0 33.0 34.0 32.0 34.0 6 37.2055 38.0 38.0 38.0 37.0 38.0 7 37.21525 38.0 38.0 38.0 37.0 38.0 8 37.21075 38.0 38.0 38.0 37.0 38.0 9 37.143 38.0 38.0 38.0 37.0 38.0 10-14 37.07485 38.0 38.0 38.0 36.2 38.0 15-19 35.860600000000005 38.0 36.2 38.0 30.2 38.0 20-24 36.919349999999994 38.0 38.0 38.0 36.0 38.0 25-29 36.77385 38.0 38.0 38.0 35.6 38.0 30-34 36.99105 38.0 38.0 38.0 36.0 38.0 35-39 37.02115 38.0 38.0 38.0 36.2 38.0 40-44 36.96815 38.0 38.0 38.0 36.0 38.0 45-49 36.8837 38.0 38.0 38.0 35.8 38.0 50-54 36.82424999999999 38.0 38.0 38.0 35.4 38.0 55-59 36.92425 38.0 38.0 38.0 36.0 38.0 60-64 36.8092 38.0 38.0 38.0 35.8 38.0 65-69 36.856100000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.674400000000006 38.0 38.0 38.0 35.2 38.0 75-79 36.6511 38.0 38.0 38.0 34.8 38.0 80-84 36.547349999999994 38.0 38.0 38.0 34.2 38.0 85-89 36.1487 38.0 37.8 38.0 32.8 38.0 90-94 33.892250000000004 37.4 33.0 38.0 23.0 38.0 95-99 36.1158 38.0 37.0 38.0 33.2 38.0 100-104 36.03035 38.0 37.2 38.0 33.2 38.0 105-109 35.8923 38.0 37.0 38.0 32.6 38.0 110-114 35.69345 38.0 37.0 38.0 31.2 38.0 115-119 35.497400000000006 38.0 36.6 38.0 30.6 38.0 120-124 34.914750000000005 38.0 35.8 38.0 27.6 38.0 125-129 34.725 38.0 35.4 38.0 27.4 38.0 130-134 34.31695 38.0 34.0 38.0 25.8 38.0 135-139 33.56385 38.0 33.0 38.0 21.2 38.0 140-144 32.68814999999999 38.0 33.0 38.0 15.8 38.0 145-149 31.581649999999996 38.0 32.2 38.0 8.6 38.0 150-151 25.716124999999998 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 0.0 5 0.0 6 2.0 7 1.0 8 1.0 9 0.0 10 1.0 11 3.0 12 2.0 13 2.0 14 1.0 15 1.0 16 3.0 17 4.0 18 3.0 19 6.0 20 8.0 21 6.0 22 14.0 23 10.0 24 20.0 25 21.0 26 24.0 27 28.0 28 36.0 29 47.0 30 57.0 31 75.0 32 103.0 33 149.0 34 205.0 35 392.0 36 876.0 37 1892.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.875 21.125 15.775 27.224999999999998 2 25.775 26.275 31.424999999999997 16.525000000000002 3 21.075 27.150000000000002 32.0 19.775000000000002 4 23.625 34.675 23.150000000000002 18.55 5 23.724999999999998 37.275000000000006 21.175 17.825 6 19.900000000000002 37.95 23.400000000000002 18.75 7 20.7 21.0 38.95 19.35 8 20.974999999999998 24.725 28.1 26.200000000000003 9 22.95 23.35 30.175 23.525 10-14 23.455000000000002 28.804999999999996 26.284999999999997 21.455 15-19 22.595000000000002 28.32 28.105000000000004 20.979999999999997 20-24 23.535 27.99 27.71 20.765 25-29 23.015 29.065 27.26 20.66 30-34 23.18 28.499999999999996 27.07 21.25 35-39 22.99 28.610000000000003 27.474999999999998 20.925 40-44 23.294999999999998 27.77 27.865000000000002 21.07 45-49 22.63 28.73 28.355000000000004 20.285 50-54 23.365 27.68 27.71 21.245 55-59 23.305 27.875 27.800000000000004 21.02 60-64 23.01 27.66 28.01 21.32 65-69 23.49 28.365000000000002 27.49 20.655 70-74 23.47 27.85 27.650000000000002 21.029999999999998 75-79 23.26 27.905 27.250000000000004 21.584999999999997 80-84 24.095 27.785 27.525 20.595 85-89 23.49 28.28 27.58 20.65 90-94 23.135 28.16 27.71 20.995 95-99 23.78 28.084999999999997 27.355 20.78 100-104 24.044999999999998 28.155 26.88 20.919999999999998 105-109 23.615 28.065 27.735 20.585 110-114 23.735 28.17 27.74 20.355 115-119 24.51 27.74 27.185 20.565 120-124 24.15 28.54 26.75 20.560000000000002 125-129 23.585 28.065 27.450000000000003 20.9 130-134 24.435000000000002 27.839999999999996 27.485 20.24 135-139 24.69 27.965 26.99 20.355 140-144 24.735 27.68 27.625 19.96 145-149 24.935 27.97 27.200000000000003 19.895 150-151 25.2625 27.425 27.35 19.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.5 24 1.0 25 1.5 26 2.0 27 4.0 28 7.0 29 10.0 30 15.5 31 19.0 32 27.5 33 38.0 34 45.0 35 61.5 36 81.5 37 101.0 38 131.5 39 172.0 40 202.0 41 226.0 42 264.5 43 276.0 44 270.5 45 274.5 46 273.0 47 260.5 48 218.0 49 181.5 50 164.5 51 139.5 52 111.0 53 86.0 54 80.5 55 64.0 56 39.0 57 36.0 58 26.0 59 23.5 60 22.0 61 11.0 62 9.5 63 6.5 64 3.0 65 2.5 66 2.0 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39531368102796 98.625 2 0.5039052658100277 1.0 3 0.05039052658100278 0.15 4 0.02519526329050139 0.1 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 3.9875 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.4375 0.0 0.0 0.0 0.0 136-137 4.8375 0.0 0.0 0.0 0.0 138-139 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796664 spots for SRR7170501.sra Written 796664 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra Read 796645 spots for SRR7170501.sra Written 796645 spots for SRR7170501.sra SRR ids: ['SRR7170501.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wkhw_s5p SRR7170501.sra spots: 15932919 blocks: [[1, 796645], [796646, 1593290], [1593291, 2389935], [2389936, 3186580], [3186581, 3983225], [3983226, 4779870], [4779871, 5576515], [5576516, 6373160], [6373161, 7169805], [7169806, 7966450], [7966451, 8763095], [8763096, 9559740], [9559741, 10356385], [10356386, 11153030], [11153031, 11949675], [11949676, 12746320], [12746321, 13542965], [13542966, 14339610], [14339611, 15136255], [15136256, 15932919]] SRR7170501 file size 5377443 SRR7170501 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170501 SRR7170501_1.fastq SRR7170501_2.fastq Input file: SRR7170501_1.fastq Paired file: SRR7170501_2.fastq trimmed: SRR7170501-trimmed-pair1.fastq, SRR7170501-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:51:11 2025 >> started Thu Feb 13 04:58:10 2025 >> done (418.824s) 15932919 read pairs processed; of these: 10272 ( 0.06%) short read pairs filtered out after trimming by size control 12820 ( 0.08%) empty read pairs filtered out after trimming by size control 15909827 (99.86%) read pairs available; of these: 9301094 (58.46%) trimmed read pairs available after processing 6608733 (41.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 4 0.00% 21 7 0.00% 22 2 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 2 0.00% 27 4 0.00% 28 4 0.00% 29 7 0.00% 30 4 0.00% 31 6 0.00% 32 6 0.00% 33 7 0.00% 34 4 0.00% 35 6 0.00% 36 12 0.00% 37 8 0.00% 38 15 0.00% 39 20 0.00% 40 17 0.00% 41 25 0.00% 42 24 0.00% 43 27 0.00% 44 33 0.00% 45 53 0.00% 46 47 0.00% 47 46 0.00% 48 52 0.00% 49 69 0.00% 50 83 0.00% 51 114 0.00% 52 114 0.00% 53 112 0.00% 54 141 0.00% 55 159 0.00% 56 173 0.00% 57 182 0.00% 58 179 0.00% 59 234 0.00% 60 314 0.00% 61 357 0.00% 62 388 0.00% 63 383 0.00% 64 453 0.00% 65 564 0.00% 66 527 0.00% 67 615 0.00% 68 693 0.00% 69 809 0.01% 70 898 0.01% 71 1067 0.01% 72 1200 0.01% 73 1384 0.01% 74 1546 0.01% 75 1681 0.01% 76 1976 0.01% 77 1992 0.01% 78 2071 0.01% 79 2395 0.02% 80 2650 0.02% 81 3041 0.02% 82 3373 0.02% 83 3883 0.02% 84 4730 0.03% 85 5203 0.03% 86 5486 0.03% 87 5694 0.04% 88 6256 0.04% 89 6511 0.04% 90 6974 0.04% 91 7488 0.05% 92 7850 0.05% 93 8804 0.06% 94 9539 0.06% 95 9646 0.06% 96 10600 0.07% 97 10839 0.07% 98 10953 0.07% 99 11405 0.07% 100 12029 0.08% 101 12605 0.08% 102 13390 0.08% 103 13930 0.09% 104 14558 0.09% 105 15468 0.10% 106 15950 0.10% 107 16567 0.10% 108 16912 0.11% 109 17405 0.11% 110 17492 0.11% 111 18472 0.12% 112 19008 0.12% 113 19881 0.12% 114 20812 0.13% 115 21928 0.14% 116 22541 0.14% 117 23282 0.15% 118 24014 0.15% 119 24458 0.15% 120 25602 0.16% 121 25918 0.16% 122 27039 0.17% 123 29064 0.18% 124 30282 0.19% 125 31904 0.20% 126 33475 0.21% 127 34962 0.22% 128 37198 0.23% 129 39049 0.25% 130 41529 0.26% 131 43517 0.27% 132 47145 0.30% 133 51024 0.32% 134 55247 0.35% 135 59692 0.38% 136 66094 0.42% 137 72637 0.46% 138 81017 0.51% 139 90103 0.57% 140 101479 0.64% 141 113723 0.71% 142 130821 0.82% 143 152531 0.96% 144 182286 1.15% 145 226688 1.42% 146 288947 1.82% 147 403489 2.54% 148 615413 3.87% 149 1201598 7.55% 150 4436661 27.89% 151 6608733 41.54% 15909827 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=34 prefix-density=0.37 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=36.50 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=12 prefix-density=0.34 prefix-fanout=2.8 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=28.54 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=9.9 sequence=AAGGCCAAGATCCAGGACAAGGAGGG SRR7170501 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:55:50 Started mapping on | Feb 13 05:55:51 Finished on | Feb 13 05:58:36 Mapping speed, Million of reads per hour | 347.12 Number of input reads | 15909827 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14621101 Uniquely mapped reads % | 91.90% Average mapped length | 293.52 Number of splices: Total | 14190996 Number of splices: Annotated (sjdb) | 13858870 Number of splices: GT/AG | 13933328 Number of splices: GC/AG | 200838 Number of splices: AT/AC | 8966 Number of splices: Non-canonical | 47864 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 476121 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 89360 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.23% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 824201 824201 824201 N_multimapping 476121 476121 476121 N_noFeature 508180 14366911 580490 N_ambiguous 299201 1061 116786 UnstrandedReadsAssigned:13813720 PositiveStrandReadsAssigned:253129 NegativeStrandReadsAssigned:13923825 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170501 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170501-trimmed-pair1.fastq SRR7170501-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,909,827 reads, 13,898,010 reads pseudoaligned [quant] estimated average fragment length: 279.498 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR7170501.ke.tsv 34699 SRR7170501.se.tsv 87100 total ==> SRR7170501.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.5 909 32.4934 Potri.005G024800.1.v4.1 1035 756.502 549 45.1251 Potri.004G059700.1.v4.1 961 682.524 18 1.63987 Potri.007G009000.2.v4.1 1416 1137.5 0 0 Potri.003G141000.2.v4.1 2943 2664.5 558.562 13.035 Potri.016G087400.1.v4.1 270 74.9451 1227 1018.02 Potri.015G069301.1.v4.1 564 292.271 0 0 Potri.010G195200.1.v4.1 1773 1494.5 296 12.3155 Potri.012G127500.1.v4.1 977 698.519 190 16.9134 ==> SRR7170501.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1493 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 32 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 49 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170501 completed mapping pipeline successfully