Starting /dee2/code/volunteer_pipeline.sh SRR7170502 current disk space = 3052012167168 free memory = 1571164756 SRR7170502 SRAfilesize c0d77633a79cbef38943d877e0490b8f SRR7170502.sra SRR7170502.sra file validated SRR7170502 is paired end SRR7170502 is conventional basespace SRR7170502 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170502_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.397 30.0 18.0 33.0 18.0 33.0 2 29.54525 31.0 27.0 33.0 25.0 33.0 3 30.238 31.0 29.0 33.0 27.0 33.0 4 29.6855 31.0 29.0 33.0 25.0 33.0 5 31.77975 33.0 31.0 33.0 29.0 33.0 6 36.18825 38.0 36.0 38.0 33.0 38.0 7 36.90125 38.0 37.0 38.0 34.0 38.0 8 37.40025 38.0 38.0 38.0 37.0 38.0 9 37.514 38.0 38.0 38.0 37.0 38.0 10-14 36.825450000000004 38.0 37.8 38.0 34.4 38.0 15-19 37.50075 38.0 38.0 38.0 37.0 38.0 20-24 37.513 38.0 38.0 38.0 37.4 38.0 25-29 36.52645 38.0 37.2 38.0 32.0 38.0 30-34 37.0572 38.0 37.8 38.0 35.2 38.0 35-39 37.27335000000001 38.0 38.0 38.0 36.8 38.0 40-44 37.4254 38.0 38.0 38.0 37.0 38.0 45-49 37.4079 38.0 38.0 38.0 37.0 38.0 50-54 37.37935 38.0 38.0 38.0 36.8 38.0 55-59 37.3004 38.0 38.0 38.0 36.4 38.0 60-64 37.231449999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.1921 38.0 38.0 38.0 36.0 38.0 70-74 36.753499999999995 38.0 38.0 38.0 34.8 38.0 75-79 36.97945 38.0 38.0 38.0 35.8 38.0 80-84 36.939049999999995 38.0 38.0 38.0 35.4 38.0 85-89 36.786199999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.69095 38.0 38.0 38.0 34.6 38.0 95-99 36.6648 38.0 38.0 38.0 34.6 38.0 100-104 36.65305 38.0 38.0 38.0 34.2 38.0 105-109 36.5824 38.0 38.0 38.0 34.0 38.0 110-114 36.3378 38.0 37.4 38.0 33.8 38.0 115-119 35.9967 38.0 37.0 38.0 32.8 38.0 120-124 36.0162 38.0 37.0 38.0 32.6 38.0 125-129 35.726749999999996 38.0 36.4 38.0 31.8 38.0 130-134 35.394 38.0 36.0 38.0 29.4 38.0 135-139 34.99015 38.0 35.2 38.0 27.4 38.0 140-144 34.9351 38.0 35.0 38.0 28.0 38.0 145-149 34.30305 38.0 34.2 38.0 27.2 38.0 150-151 30.466125 35.5 28.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 3.0 19 1.0 20 1.0 21 3.0 22 2.0 23 3.0 24 4.0 25 9.0 26 6.0 27 17.0 28 24.0 29 28.0 30 36.0 31 58.0 32 85.0 33 120.0 34 180.0 35 373.0 36 922.0 37 2122.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.89486292254458 10.700026616981633 9.928134149587436 44.47697631088634 2 21.27659574468085 16.245306633291616 35.018773466833544 27.459324155193993 3 20.549999999999997 20.25 26.1 33.1 4 23.549999999999997 27.650000000000002 23.3 25.5 5 21.825 34.1 24.425 19.650000000000002 6 18.7 35.4 25.724999999999998 20.175 7 13.8 25.35 42.475 18.375 8 16.0 24.6 32.125 27.275 9 16.950000000000003 24.825 33.375 24.85 10-14 20.215 30.009999999999998 26.71 23.064999999999998 15-19 19.195 29.115000000000002 28.205000000000002 23.485 20-24 19.875 28.549999999999997 28.07 23.505000000000003 25-29 19.56 28.48 28.494999999999997 23.465 30-34 19.86 28.105000000000004 28.01 24.025 35-39 19.845 27.889999999999997 28.494999999999997 23.77 40-44 19.59 28.525 27.810000000000002 24.075 45-49 18.975 29.060000000000002 27.61 24.355 50-54 20.01 28.465 27.425 24.099999999999998 55-59 20.555 28.46 27.435 23.549999999999997 60-64 20.115 28.854999999999997 27.85 23.18 65-69 20.150000000000002 28.360000000000003 28.065 23.425 70-74 20.46 28.92 27.62 23.0 75-79 20.055 28.910000000000004 27.200000000000003 23.835 80-84 20.095 27.694999999999997 28.51 23.7 85-89 19.77 28.939999999999998 27.839999999999996 23.45 90-94 20.235 28.235 27.445000000000004 24.085 95-99 21.01 27.415 28.105000000000004 23.47 100-104 20.505000000000003 28.754999999999995 27.060000000000002 23.68 105-109 20.355 28.575 27.36 23.71 110-114 20.265 28.7 27.85 23.185 115-119 20.465 28.615000000000002 27.265 23.655 120-124 20.29 28.000000000000004 27.650000000000002 24.060000000000002 125-129 20.805 28.854999999999997 26.815 23.525 130-134 20.495 28.26 27.46 23.785 135-139 20.865000000000002 28.225 27.450000000000003 23.46 140-144 20.294999999999998 28.26 27.62 23.825 145-149 20.715 27.855 27.43 24.0 150-151 19.6125 28.0875 27.9375 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.5 22 1.5 23 1.5 24 0.5 25 0.5 26 2.5 27 6.0 28 8.0 29 11.5 30 19.0 31 29.0 32 35.5 33 40.0 34 57.0 35 81.0 36 99.5 37 107.0 38 121.0 39 148.0 40 197.0 41 239.5 42 263.5 43 267.0 44 261.5 45 275.0 46 276.0 47 259.5 48 213.0 49 173.5 50 171.5 51 153.0 52 109.0 53 89.0 54 75.5 55 54.5 56 42.0 57 29.5 58 22.5 59 16.0 60 9.5 61 7.0 62 6.5 63 4.5 64 1.0 65 1.0 66 1.5 67 0.5 68 1.5 69 2.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.075 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.3499999999999996 0.0 0.0 0.0 0.0 118-119 2.5999999999999996 0.025 0.0 0.0 0.0 120-121 2.7375 0.025 0.0 0.0 0.0 122-123 2.8875 0.025 0.0 0.0 0.0 124-125 3.0 0.025 0.0 0.0 0.0 126-127 3.2875 0.025 0.0 0.0 0.0 128-129 3.575 0.025 0.0 0.0 0.0 130-131 3.8 0.025 0.0 0.0 0.0 132-133 4.0125 0.025 0.0 0.0 0.0 134-135 4.362500000000001 0.025 0.0 0.0 0.0 136-137 4.725 0.025 0.0 0.0 0.0 138-139 4.975 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAGAA 10 0.006836113 144.9625 9 >>END_MODULE SRR7170502 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170502_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95525 33.0 33.0 34.0 32.0 34.0 2 33.02525 34.0 33.0 34.0 32.0 34.0 3 33.0495 34.0 33.0 34.0 32.0 34.0 4 33.08325 34.0 33.0 34.0 32.0 34.0 5 33.0805 34.0 33.0 34.0 32.0 34.0 6 37.17875 38.0 38.0 38.0 37.0 38.0 7 37.221 38.0 38.0 38.0 37.0 38.0 8 37.26125 38.0 38.0 38.0 37.0 38.0 9 37.18925 38.0 38.0 38.0 37.0 38.0 10-14 37.08705 38.0 38.0 38.0 36.8 38.0 15-19 37.044799999999995 38.0 38.0 38.0 36.0 38.0 20-24 36.9984 38.0 38.0 38.0 36.2 38.0 25-29 36.976350000000004 38.0 38.0 38.0 36.2 38.0 30-34 37.0914 38.0 38.0 38.0 37.0 38.0 35-39 37.0519 38.0 38.0 38.0 36.2 38.0 40-44 37.0159 38.0 38.0 38.0 36.0 38.0 45-49 36.8656 38.0 38.0 38.0 36.0 38.0 50-54 36.5459 38.0 38.0 38.0 34.2 38.0 55-59 36.7217 38.0 38.0 38.0 35.4 38.0 60-64 36.0349 38.0 36.8 38.0 30.4 38.0 65-69 36.65955 38.0 38.0 38.0 35.2 38.0 70-74 36.522099999999995 38.0 38.0 38.0 34.4 38.0 75-79 36.51025 38.0 38.0 38.0 34.2 38.0 80-84 35.77465 38.0 36.8 38.0 29.4 38.0 85-89 34.594300000000004 38.0 33.8 38.0 25.2 38.0 90-94 36.1847 38.0 37.4 38.0 33.2 38.0 95-99 36.0586 38.0 37.6 38.0 33.0 38.0 100-104 35.7916 38.0 37.0 38.0 30.0 38.0 105-109 35.17915000000001 38.0 35.8 38.0 27.8 38.0 110-114 35.488350000000004 38.0 36.4 38.0 30.0 38.0 115-119 35.601350000000004 38.0 36.8 38.0 30.2 38.0 120-124 35.329699999999995 38.0 36.0 38.0 29.6 38.0 125-129 34.7947 38.0 35.6 38.0 26.4 38.0 130-134 34.116 38.0 33.6 38.0 23.0 38.0 135-139 33.992149999999995 38.0 33.0 38.0 23.4 38.0 140-144 33.0497 38.0 33.0 38.0 18.4 38.0 145-149 32.27955 38.0 33.0 38.0 10.8 38.0 150-151 26.613625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 2.0 5 0.0 6 2.0 7 1.0 8 2.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 2.0 16 0.0 17 4.0 18 3.0 19 8.0 20 6.0 21 5.0 22 8.0 23 13.0 24 14.0 25 20.0 26 26.0 27 30.0 28 48.0 29 57.0 30 67.0 31 84.0 32 109.0 33 154.0 34 194.0 35 344.0 36 877.0 37 1914.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.025000000000006 19.825 14.899999999999999 28.249999999999996 2 27.150000000000002 24.349999999999998 32.75 15.75 3 20.175 26.825 31.874999999999996 21.125 4 21.85 37.4 22.875 17.875 5 24.65 36.075 22.6 16.675 6 19.175 40.150000000000006 22.325 18.35 7 19.75 21.125 39.675 19.45 8 21.325 24.925 29.849999999999998 23.9 9 22.225 25.8 28.999999999999996 22.975 10-14 22.68 29.299999999999997 27.07 20.95 15-19 22.79 28.08 28.58 20.549999999999997 20-24 23.1 28.525 27.815 20.560000000000002 25-29 22.936146807340364 28.7864393219661 27.57637881894095 20.701035051752587 30-34 22.571128556427823 27.85639281964098 28.781439071953596 20.7910395519776 35-39 22.42336350452568 27.809171375706356 28.579286893033956 21.18817822673401 40-44 23.096154807740387 28.30141507075354 27.976398819940997 20.626031301565078 45-49 22.656132806640333 27.996399819990998 28.39641982099105 20.95104755237762 50-54 23.16 27.82 28.139999999999997 20.880000000000003 55-59 23.285 27.58 27.815 21.32 60-64 22.836141807090353 28.091404570228512 28.201410070503524 20.87104355217761 65-69 22.95 27.97 28.475 20.605 70-74 23.50852627894184 27.874181127169074 27.44911736760514 21.168175226283942 75-79 23.140785196299074 28.067016754188543 27.686921730432605 21.10527631907977 80-84 23.747124137241173 28.13844153245974 27.28818645593678 20.82624787436231 85-89 23.465 28.415000000000003 27.685 20.435 90-94 23.14615730786539 28.376418820941048 27.91639581979099 20.56102805140257 95-99 23.815 28.355000000000004 27.52 20.31 100-104 23.662366236623665 28.20782078207821 28.052805280528055 20.07700770077008 105-109 22.96 28.249999999999996 27.944999999999997 20.845 110-114 24.196209810490522 28.23141157057853 27.536376818840942 20.036001800090006 115-119 23.6997399479896 28.14062812562512 27.860572114422883 20.29905981196239 120-124 23.693554033104967 28.04420663099465 27.849177376606495 20.413061959293895 125-129 23.65709712913874 27.98839651895569 27.6332899869961 20.721216364909473 130-134 24.31486297259452 28.245649129825967 27.345469093818764 20.09401880376075 135-139 23.497349734973497 27.807780778077806 28.50785078507851 20.187018701870187 140-144 23.926196309815488 28.221411070553525 27.85639281964098 19.99599979999 145-149 24.813722058308745 27.714157123568533 27.574136120418064 19.897984697704658 150-151 25.056264066016503 27.419354838709676 27.419354838709676 20.10502625656414 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.5 25 4.0 26 5.5 27 6.0 28 10.0 29 11.5 30 13.5 31 18.5 32 31.5 33 47.0 34 57.5 35 70.0 36 84.5 37 107.5 38 133.5 39 159.5 40 192.5 41 233.0 42 265.0 43 279.5 44 291.0 45 283.0 46 269.0 47 265.0 48 226.5 49 196.5 50 164.0 51 116.5 52 99.5 53 81.0 54 63.5 55 52.0 56 38.5 57 29.0 58 23.5 59 19.5 60 17.5 61 9.5 62 4.0 63 4.0 64 4.0 65 2.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.015 40-44 0.005 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.015 75-79 0.025 80-84 0.03 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.005 115-119 0.02 120-124 0.015 125-129 0.03 130-134 0.02 135-139 0.01 140-144 0.005 145-149 0.015 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.4027183488547697 0.8 3 0.10067958721369243 0.3 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9750000000000001 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.7625000000000002 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.6624999999999996 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.225 0.0 0.0 0.0 0.0 128-129 3.525 0.0 0.0 0.0 0.0 130-131 3.7375 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.275 0.0 0.0 0.0 0.0 136-137 4.637499999999999 0.0 0.0 0.0 0.0 138-139 4.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939585 spots for SRR7170502.sra Written 939585 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra Read 939572 spots for SRR7170502.sra Written 939572 spots for SRR7170502.sra SRR ids: ['SRR7170502.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_al8ehw2t SRR7170502.sra spots: 18791453 blocks: [[1, 939572], [939573, 1879144], [1879145, 2818716], [2818717, 3758288], [3758289, 4697860], [4697861, 5637432], [5637433, 6577004], [6577005, 7516576], [7516577, 8456148], [8456149, 9395720], [9395721, 10335292], [10335293, 11274864], [11274865, 12214436], [12214437, 13154008], [13154009, 14093580], [14093581, 15033152], [15033153, 15972724], [15972725, 16912296], [16912297, 17851868], [17851869, 18791453]] SRR7170502 file size 6346106 SRR7170502 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170502 SRR7170502_1.fastq SRR7170502_2.fastq Input file: SRR7170502_1.fastq Paired file: SRR7170502_2.fastq trimmed: SRR7170502-trimmed-pair1.fastq, SRR7170502-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 05:05:18 2025 >> started Thu Feb 13 05:10:25 2025 >> done (306.603s) 18791453 read pairs processed; of these: 10366 ( 0.06%) short read pairs filtered out after trimming by size control 9142 ( 0.05%) empty read pairs filtered out after trimming by size control 18771945 (99.90%) read pairs available; of these: 10432359 (55.57%) trimmed read pairs available after processing 8339586 (44.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 3 0.00% 22 6 0.00% 23 4 0.00% 24 4 0.00% 25 3 0.00% 26 4 0.00% 27 1 0.00% 28 3 0.00% 29 4 0.00% 30 9 0.00% 31 7 0.00% 32 7 0.00% 33 11 0.00% 34 6 0.00% 35 11 0.00% 36 13 0.00% 37 13 0.00% 38 21 0.00% 39 22 0.00% 40 25 0.00% 41 30 0.00% 42 32 0.00% 43 31 0.00% 44 35 0.00% 45 35 0.00% 46 48 0.00% 47 59 0.00% 48 85 0.00% 49 94 0.00% 50 119 0.00% 51 113 0.00% 52 132 0.00% 53 151 0.00% 54 175 0.00% 55 197 0.00% 56 191 0.00% 57 231 0.00% 58 262 0.00% 59 334 0.00% 60 364 0.00% 61 440 0.00% 62 495 0.00% 63 585 0.00% 64 616 0.00% 65 693 0.00% 66 761 0.00% 67 796 0.00% 68 834 0.00% 69 1011 0.01% 70 1162 0.01% 71 1359 0.01% 72 1572 0.01% 73 1809 0.01% 74 2012 0.01% 75 2225 0.01% 76 2476 0.01% 77 2604 0.01% 78 2881 0.02% 79 3126 0.02% 80 3413 0.02% 81 3996 0.02% 82 4475 0.02% 83 5063 0.03% 84 6041 0.03% 85 6680 0.04% 86 7028 0.04% 87 7541 0.04% 88 7832 0.04% 89 8400 0.04% 90 8956 0.05% 91 9599 0.05% 92 10339 0.06% 93 11326 0.06% 94 12007 0.06% 95 12820 0.07% 96 13300 0.07% 97 13736 0.07% 98 14227 0.08% 99 14601 0.08% 100 15418 0.08% 101 15950 0.08% 102 17057 0.09% 103 17987 0.10% 104 18813 0.10% 105 19900 0.11% 106 20282 0.11% 107 20881 0.11% 108 21363 0.11% 109 22033 0.12% 110 22296 0.12% 111 23229 0.12% 112 24131 0.13% 113 24988 0.13% 114 25754 0.14% 115 26892 0.14% 116 28135 0.15% 117 28527 0.15% 118 29452 0.16% 119 30134 0.16% 120 30720 0.16% 121 32177 0.17% 122 33188 0.18% 123 34764 0.19% 124 36212 0.19% 125 37521 0.20% 126 40221 0.21% 127 41641 0.22% 128 43579 0.23% 129 45605 0.24% 130 47689 0.25% 131 50466 0.27% 132 54001 0.29% 133 57304 0.31% 134 61946 0.33% 135 67214 0.36% 136 73156 0.39% 137 79682 0.42% 138 87101 0.46% 139 96852 0.52% 140 107575 0.57% 141 121999 0.65% 142 140670 0.75% 143 165492 0.88% 144 198321 1.06% 145 258407 1.38% 146 314718 1.68% 147 443877 2.36% 148 673020 3.59% 149 1281809 6.83% 150 5010470 26.69% 151 8339586 44.43% 18771945 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=15 prefix-density=0.48 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=384.42 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=14.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=19 prefix-density=0.48 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=22.57 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.7 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7170502 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:55:12 Started mapping on | Feb 13 05:55:13 Finished on | Feb 13 05:58:36 Mapping speed, Million of reads per hour | 332.90 Number of input reads | 18771945 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17803439 Uniquely mapped reads % | 94.84% Average mapped length | 293.52 Number of splices: Total | 17737247 Number of splices: Annotated (sjdb) | 17356369 Number of splices: GT/AG | 17419660 Number of splices: GC/AG | 258441 Number of splices: AT/AC | 10290 Number of splices: Non-canonical | 48856 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 475737 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 18397 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 504333 504333 504333 N_multimapping 475737 475737 475737 N_noFeature 627340 17539649 719570 N_ambiguous 301937 1042 129715 UnstrandedReadsAssigned:16874162 PositiveStrandReadsAssigned:262748 NegativeStrandReadsAssigned:16954154 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170502 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170502-trimmed-pair1.fastq SRR7170502-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,771,945 reads, 16,841,499 reads pseudoaligned [quant] estimated average fragment length: 282.617 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR7170502.ke.tsv 34699 SRR7170502.se.tsv 87100 total ==> SRR7170502.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.38 718 24.5599 Potri.005G024800.1.v4.1 1035 753.383 209 16.477 Potri.004G059700.1.v4.1 961 679.419 8 0.699358 Potri.007G009000.2.v4.1 1416 1134.38 0 0 Potri.003G141000.2.v4.1 2943 2661.38 1049 23.4108 Potri.016G087400.1.v4.1 270 77.7312 1042 796.195 Potri.015G069301.1.v4.1 564 289.826 0 0 Potri.010G195200.1.v4.1 1773 1491.38 125 4.97815 Potri.012G127500.1.v4.1 977 695.401 330 28.1855 ==> SRR7170502.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1183 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 246 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR7170502 completed mapping pipeline successfully