Starting /dee2/code/volunteer_pipeline.sh SRR7170503 current disk space = 3052000997376 free memory = 1572350636 SRR7170503 SRAfilesize d090ffcb966916dda50857d063474a6b SRR7170503.sra SRR7170503.sra file validated SRR7170503 is paired end SRR7170503 is conventional basespace SRR7170503 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170503_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.534 30.0 18.0 33.0 18.0 33.0 2 27.46425 29.0 25.0 31.0 18.0 33.0 3 31.13075 33.0 30.0 33.0 27.0 33.0 4 31.76525 33.0 31.0 33.0 29.0 33.0 5 32.40875 33.0 33.0 33.0 31.0 34.0 6 36.614 38.0 37.0 38.0 34.0 38.0 7 37.302 38.0 38.0 38.0 36.0 38.0 8 37.46 38.0 38.0 38.0 37.0 38.0 9 37.55375 38.0 38.0 38.0 38.0 38.0 10-14 36.8153 38.0 37.4 38.0 34.4 38.0 15-19 37.588350000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.58275 38.0 38.0 38.0 38.0 38.0 25-29 36.513400000000004 38.0 37.0 38.0 32.0 38.0 30-34 37.195350000000005 38.0 38.0 38.0 35.8 38.0 35-39 37.37474999999999 38.0 38.0 38.0 37.2 38.0 40-44 37.51245 38.0 38.0 38.0 37.6 38.0 45-49 37.45295 38.0 38.0 38.0 37.0 38.0 50-54 37.3997 38.0 38.0 38.0 37.0 38.0 55-59 37.3864 38.0 38.0 38.0 37.0 38.0 60-64 37.330600000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.26955 38.0 38.0 38.0 36.8 38.0 70-74 36.6875 38.0 37.8 38.0 34.4 38.0 75-79 37.06925 38.0 38.0 38.0 36.0 38.0 80-84 37.07455 38.0 38.0 38.0 36.0 38.0 85-89 36.93955 38.0 38.0 38.0 35.6 38.0 90-94 36.87945 38.0 38.0 38.0 35.4 38.0 95-99 36.85545 38.0 38.0 38.0 35.0 38.0 100-104 36.8497 38.0 38.0 38.0 35.0 38.0 105-109 36.78305 38.0 38.0 38.0 35.0 38.0 110-114 36.584799999999994 38.0 38.0 38.0 34.4 38.0 115-119 36.204 38.0 37.4 38.0 33.4 38.0 120-124 36.24685 38.0 37.2 38.0 34.0 38.0 125-129 35.9289 38.0 36.8 38.0 32.2 38.0 130-134 35.74085 38.0 36.2 38.0 31.6 38.0 135-139 35.26735000000001 38.0 35.4 38.0 29.6 38.0 140-144 35.33685 38.0 35.8 38.0 30.6 38.0 145-149 34.778099999999995 38.0 35.4 38.0 29.4 38.0 150-151 30.9105 35.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 3.0 20 1.0 21 2.0 22 1.0 23 1.0 24 7.0 25 6.0 26 5.0 27 19.0 28 14.0 29 29.0 30 24.0 31 50.0 32 62.0 33 115.0 34 167.0 35 278.0 36 824.0 37 2385.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.24318658280922 11.975890985324948 9.040880503144653 36.740041928721176 2 23.66183091545773 15.182591295647823 33.04152076038019 28.114057028514257 3 20.075000000000003 21.025 25.924999999999997 32.975 4 22.225 28.925 22.225 26.625 5 22.0 32.925 24.075 21.0 6 19.575 34.975 24.875 20.575 7 13.900000000000002 25.8 42.775 17.525 8 17.925 25.1 31.95 25.025 9 17.325 24.975 33.324999999999996 24.375 10-14 19.759999999999998 29.849999999999998 26.82 23.57 15-19 19.465 29.005 27.88 23.65 20-24 19.74 28.845 27.744999999999997 23.669999999999998 25-29 20.085 29.23 26.93 23.755000000000003 30-34 19.5 28.849999999999998 28.03 23.62 35-39 19.935 28.405 27.72 23.94 40-44 19.869999999999997 29.020000000000003 27.765 23.345 45-49 20.330000000000002 28.67 27.700000000000003 23.3 50-54 20.424999999999997 28.585 27.47 23.52 55-59 20.185 29.275000000000002 27.01 23.53 60-64 20.46 28.799999999999997 27.11 23.630000000000003 65-69 20.195 28.585 27.339999999999996 23.880000000000003 70-74 20.244999999999997 28.645 27.889999999999997 23.22 75-79 20.495 28.255000000000003 26.93 24.32 80-84 20.474999999999998 28.275 27.250000000000004 24.0 85-89 20.57 27.47 27.74 24.22 90-94 20.055 27.815 27.855 24.275 95-99 21.025 28.265 26.855 23.855 100-104 20.685000000000002 28.694999999999997 26.919999999999998 23.7 105-109 20.985 27.955000000000002 27.115000000000002 23.945 110-114 20.87 27.650000000000002 27.615000000000002 23.865 115-119 20.62 28.29 27.445000000000004 23.645 120-124 21.285 27.87 27.255000000000003 23.59 125-129 21.185000000000002 28.294999999999998 26.495 24.025 130-134 20.305 28.43 27.474999999999998 23.79 135-139 20.919999999999998 27.755000000000003 27.27 24.055 140-144 20.645 27.26 27.32 24.775 145-149 21.15 28.03 27.084999999999997 23.735 150-151 20.200000000000003 28.4375 27.425 23.9375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 1.5 23 4.5 24 4.5 25 1.0 26 3.0 27 8.0 28 12.0 29 12.0 30 17.5 31 26.5 32 33.0 33 42.0 34 67.0 35 89.0 36 97.5 37 114.0 38 132.5 39 155.0 40 186.5 41 204.5 42 207.5 43 210.5 44 239.5 45 269.0 46 256.0 47 244.5 48 235.0 49 216.5 50 192.5 51 152.5 52 120.0 53 108.5 54 93.5 55 67.5 56 46.0 57 31.0 58 21.0 59 22.0 60 20.0 61 8.5 62 6.5 63 6.5 64 2.5 65 1.0 66 1.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.6 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.175 0.0 0.0 0.0 0.0 96-97 1.3624999999999998 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.8 0.0 0.0 0.0 0.0 102-103 2.05 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.6500000000000004 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.0125 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.5625 0.0 0.0 0.0 0.0 118-119 3.925 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 4.699999999999999 0.0 0.0 0.0 0.0 126-127 4.95 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.525 0.0 0.0 0.0 0.0 132-133 5.9125 0.0 0.0 0.0 0.0 134-135 6.3125 0.0 0.0 0.0 0.0 136-137 6.7125 0.0 0.0 0.0 0.0 138-139 7.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACAGA 10 0.0063298983 148.6923 1 >>END_MODULE SRR7170503 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170503_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.911 33.0 33.0 34.0 32.0 34.0 2 32.961 34.0 33.0 34.0 32.0 34.0 3 32.93175 34.0 33.0 34.0 32.0 34.0 4 32.82925 34.0 33.0 34.0 32.0 34.0 5 32.89575 34.0 33.0 34.0 32.0 34.0 6 37.04125 38.0 38.0 38.0 37.0 38.0 7 37.046 38.0 38.0 38.0 37.0 38.0 8 37.08775 38.0 38.0 38.0 37.0 38.0 9 37.0375 38.0 38.0 38.0 37.0 38.0 10-14 36.9142 38.0 38.0 38.0 36.0 38.0 15-19 36.86335 38.0 38.0 38.0 36.0 38.0 20-24 36.78845 38.0 38.0 38.0 36.0 38.0 25-29 36.797549999999994 38.0 38.0 38.0 35.8 38.0 30-34 36.8566 38.0 38.0 38.0 36.0 38.0 35-39 36.84740000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.80030000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.628249999999994 38.0 38.0 38.0 35.4 38.0 50-54 36.43335 38.0 38.0 38.0 33.8 38.0 55-59 36.5581 38.0 38.0 38.0 35.0 38.0 60-64 36.01265 38.0 37.4 38.0 30.0 38.0 65-69 36.433350000000004 38.0 38.0 38.0 34.4 38.0 70-74 36.1473 38.0 38.0 38.0 33.6 38.0 75-79 36.28225 38.0 38.0 38.0 34.0 38.0 80-84 35.560249999999996 38.0 36.8 38.0 29.4 38.0 85-89 34.73965 38.0 35.4 38.0 26.6 38.0 90-94 35.99605 38.0 37.4 38.0 33.0 38.0 95-99 35.84475 38.0 37.0 38.0 32.2 38.0 100-104 35.516299999999994 38.0 37.0 38.0 29.6 38.0 105-109 35.047399999999996 38.0 35.8 38.0 27.0 38.0 110-114 35.06995 38.0 36.0 38.0 26.8 38.0 115-119 35.306799999999996 38.0 36.0 38.0 29.8 38.0 120-124 35.117200000000004 38.0 36.0 38.0 29.0 38.0 125-129 34.61855 38.0 35.4 38.0 26.0 38.0 130-134 33.887699999999995 38.0 33.6 38.0 22.4 38.0 135-139 33.80035 38.0 33.0 38.0 22.6 38.0 140-144 32.6492 38.0 32.6 38.0 15.0 38.0 145-149 31.688299999999998 38.0 32.4 38.0 8.4 38.0 150-151 26.359125 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 10.0 4 3.0 5 1.0 6 3.0 7 3.0 8 1.0 9 3.0 10 3.0 11 5.0 12 0.0 13 2.0 14 2.0 15 3.0 16 1.0 17 6.0 18 2.0 19 1.0 20 7.0 21 4.0 22 14.0 23 12.0 24 18.0 25 19.0 26 29.0 27 34.0 28 32.0 29 47.0 30 72.0 31 78.0 32 123.0 33 147.0 34 223.0 35 333.0 36 846.0 37 1906.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.375 20.599999999999998 14.7 28.325 2 26.6 24.975 31.324999999999996 17.1 3 20.5 29.049999999999997 30.925000000000004 19.525000000000002 4 23.95 33.25 23.549999999999997 19.25 5 25.224999999999998 35.825 21.325 17.625 6 20.325 39.0 23.175 17.5 7 19.85 21.175 38.9 20.075000000000003 8 20.925 25.525 27.625 25.924999999999997 9 21.4 25.75 29.525000000000002 23.325000000000003 10-14 23.525 29.455 25.865 21.154999999999998 15-19 23.39 28.025 27.785 20.8 20-24 23.305 28.49 26.96 21.245 25-29 23.485 28.335 27.250000000000004 20.93 30-34 22.99 28.265 27.675 21.07 35-39 23.3 27.61 27.36 21.73 40-44 23.82 27.98 27.255000000000003 20.945 45-49 23.189999999999998 27.884999999999998 27.575 21.349999999999998 50-54 23.84 27.92 27.439999999999998 20.8 55-59 24.115000000000002 26.945000000000004 27.860000000000003 21.08 60-64 23.89 28.055000000000003 27.355 20.7 65-69 23.630000000000003 28.37 27.205000000000002 20.794999999999998 70-74 23.62 27.63 27.365000000000002 21.385 75-79 23.799999999999997 27.495000000000005 27.845 20.86 80-84 23.59 27.685 27.415 21.310000000000002 85-89 23.580000000000002 27.82 27.029999999999998 21.57 90-94 24.349999999999998 27.065 27.589999999999996 20.995 95-99 23.25 28.01 27.700000000000003 21.04 100-104 24.21 27.839999999999996 26.935 21.015 105-109 24.495 27.22 27.584999999999997 20.7 110-114 24.505 27.355 27.365000000000002 20.775 115-119 24.575 27.845 27.245 20.335 120-124 24.115000000000002 27.93 27.295 20.66 125-129 24.6 28.165000000000003 26.795 20.44 130-134 24.805 27.42 27.3 20.474999999999998 135-139 24.8 27.095000000000002 27.334999999999997 20.77 140-144 25.040000000000003 27.6 27.27 20.09 145-149 25.09 27.334999999999997 27.405 20.169999999999998 150-151 25.937500000000004 27.487499999999997 26.25 20.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.5 18 1.5 19 0.5 20 0.0 21 1.5 22 2.0 23 1.0 24 1.0 25 1.0 26 2.0 27 4.0 28 5.5 29 6.5 30 9.0 31 17.5 32 21.5 33 20.0 34 38.0 35 58.5 36 72.0 37 102.0 38 127.0 39 156.0 40 186.0 41 214.0 42 258.0 43 275.5 44 262.5 45 263.0 46 266.0 47 248.5 48 225.5 49 215.0 50 194.5 51 152.0 52 122.0 53 108.0 54 94.0 55 72.5 56 51.5 57 39.5 58 31.0 59 21.0 60 16.0 61 13.5 62 9.0 63 3.5 64 1.0 65 1.0 66 0.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19191919191918 98.2 2 0.6818181818181818 1.35 3 0.07575757575757576 0.22499999999999998 4 0.025252525252525252 0.1 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.2750000000000004 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.675 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.1500000000000004 0.0 0.0 0.0 0.0 116-117 3.4124999999999996 0.0 0.0 0.0 0.0 118-119 3.8 0.0 0.0 0.0 0.0 120-121 4.137499999999999 0.0 0.0 0.0 0.0 122-123 4.3375 0.0 0.0 0.0 0.0 124-125 4.574999999999999 0.0 0.0 0.0 0.0 126-127 4.875 0.0 0.0 0.0 0.0 128-129 5.0875 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 5.8625 0.0 0.0 0.0 0.0 134-135 6.25 0.0 0.0 0.0 0.0 136-137 6.6125 0.0 0.0 0.0 0.0 138-139 6.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTGGT 10 0.006830828 145.0 5 >>END_MODULE Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744693 spots for SRR7170503.sra Written 744693 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra Read 744690 spots for SRR7170503.sra Written 744690 spots for SRR7170503.sra SRR ids: ['SRR7170503.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6c3hyefu SRR7170503.sra spots: 14893803 blocks: [[1, 744690], [744691, 1489380], [1489381, 2234070], [2234071, 2978760], [2978761, 3723450], [3723451, 4468140], [4468141, 5212830], [5212831, 5957520], [5957521, 6702210], [6702211, 7446900], [7446901, 8191590], [8191591, 8936280], [8936281, 9680970], [9680971, 10425660], [10425661, 11170350], [11170351, 11915040], [11915041, 12659730], [12659731, 13404420], [13404421, 14149110], [14149111, 14893803]] SRR7170503 file size 5025320 SRR7170503 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170503 SRR7170503_1.fastq SRR7170503_2.fastq Input file: SRR7170503_1.fastq Paired file: SRR7170503_2.fastq trimmed: SRR7170503-trimmed-pair1.fastq, SRR7170503-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:47:47 2025 >> started Thu Feb 13 05:05:35 2025 >> done (1068.039s) 14893803 read pairs processed; of these: 15483 ( 0.10%) short read pairs filtered out after trimming by size control 18664 ( 0.13%) empty read pairs filtered out after trimming by size control 14859656 (99.77%) read pairs available; of these: 8079893 (54.37%) trimmed read pairs available after processing 6779763 (45.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 5 0.00% 23 2 0.00% 24 5 0.00% 25 2 0.00% 26 3 0.00% 27 6 0.00% 28 4 0.00% 29 7 0.00% 30 6 0.00% 31 5 0.00% 32 12 0.00% 33 13 0.00% 34 15 0.00% 35 12 0.00% 36 22 0.00% 37 25 0.00% 38 29 0.00% 39 26 0.00% 40 32 0.00% 41 44 0.00% 42 52 0.00% 43 44 0.00% 44 47 0.00% 45 59 0.00% 46 73 0.00% 47 91 0.00% 48 107 0.00% 49 137 0.00% 50 179 0.00% 51 180 0.00% 52 203 0.00% 53 226 0.00% 54 248 0.00% 55 279 0.00% 56 254 0.00% 57 326 0.00% 58 446 0.00% 59 435 0.00% 60 547 0.00% 61 635 0.00% 62 730 0.00% 63 837 0.01% 64 890 0.01% 65 923 0.01% 66 1054 0.01% 67 1094 0.01% 68 1321 0.01% 69 1446 0.01% 70 1646 0.01% 71 1919 0.01% 72 2222 0.01% 73 2552 0.02% 74 2790 0.02% 75 3060 0.02% 76 3250 0.02% 77 3658 0.02% 78 3608 0.02% 79 3973 0.03% 80 4472 0.03% 81 5015 0.03% 82 5823 0.04% 83 6300 0.04% 84 7573 0.05% 85 8394 0.06% 86 8727 0.06% 87 8791 0.06% 88 9583 0.06% 89 9932 0.07% 90 10352 0.07% 91 11272 0.08% 92 12032 0.08% 93 12806 0.09% 94 13530 0.09% 95 14606 0.10% 96 14913 0.10% 97 15152 0.10% 98 15191 0.10% 99 15736 0.11% 100 16387 0.11% 101 16949 0.11% 102 18001 0.12% 103 18900 0.13% 104 19634 0.13% 105 20656 0.14% 106 21106 0.14% 107 21159 0.14% 108 21549 0.15% 109 21722 0.15% 110 22144 0.15% 111 22735 0.15% 112 23675 0.16% 113 24366 0.16% 114 25373 0.17% 115 26470 0.18% 116 27311 0.18% 117 27518 0.19% 118 27958 0.19% 119 28042 0.19% 120 28797 0.19% 121 29211 0.20% 122 30363 0.20% 123 31935 0.21% 124 33454 0.23% 125 34487 0.23% 126 36241 0.24% 127 36920 0.25% 128 38642 0.26% 129 39849 0.27% 130 41649 0.28% 131 43492 0.29% 132 45739 0.31% 133 48125 0.32% 134 51774 0.35% 135 55518 0.37% 136 59928 0.40% 137 64718 0.44% 138 69656 0.47% 139 77298 0.52% 140 82643 0.56% 141 93033 0.63% 142 105551 0.71% 143 121795 0.82% 144 144779 0.97% 145 186947 1.26% 146 223553 1.50% 147 311438 2.10% 148 469573 3.16% 149 899803 6.06% 150 3839300 25.84% 151 6779763 45.63% 14859656 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=24 prefix-density=0.75 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=34.48 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.4 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=25 prefix-density=0.68 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=30.25 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.5 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170503 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:58:35 Started mapping on | Feb 13 05:58:36 Finished on | Feb 13 06:04:47 Mapping speed, Million of reads per hour | 144.19 Number of input reads | 14859656 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13921804 Uniquely mapped reads % | 93.69% Average mapped length | 292.22 Number of splices: Total | 13131977 Number of splices: Annotated (sjdb) | 12865000 Number of splices: GT/AG | 12867312 Number of splices: GC/AG | 220570 Number of splices: AT/AC | 8622 Number of splices: Non-canonical | 35473 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 426124 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 46744 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.04% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 525383 525383 525383 N_multimapping 426124 426124 426124 N_noFeature 382637 13692532 447039 N_ambiguous 276014 772 110804 UnstrandedReadsAssigned:13263153 PositiveStrandReadsAssigned:228500 NegativeStrandReadsAssigned:13363961 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170503 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170503-trimmed-pair1.fastq SRR7170503-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,859,656 reads, 13,378,197 reads pseudoaligned [quant] estimated average fragment length: 262.465 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR7170503.ke.tsv 34699 SRR7170503.se.tsv 87100 total ==> SRR7170503.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.54 581 21.6804 Potri.005G024800.1.v4.1 1035 773.535 245 20.7603 Potri.004G059700.1.v4.1 961 699.551 18 1.68656 Potri.007G009000.2.v4.1 1416 1154.54 0 0 Potri.003G141000.2.v4.1 2943 2681.54 509.287 12.4488 Potri.016G087400.1.v4.1 270 81.4273 964 775.987 Potri.015G069301.1.v4.1 564 307.37 0 0 Potri.010G195200.1.v4.1 1773 1511.54 33 1.43101 Potri.012G127500.1.v4.1 977 715.54 131 12.0001 ==> SRR7170503.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 276 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 283 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170503 completed mapping pipeline successfully