Starting /dee2/code/volunteer_pipeline.sh SRR7170504 current disk space = 3052242518016 free memory = 1583361848 SRR7170504 SRAfilesize fcc5dc33cbd0b17bfd4e63f1cdf3d1f9 SRR7170504.sra SRR7170504.sra file validated SRR7170504 is paired end SRR7170504 is conventional basespace SRR7170504 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170504_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.972 30.0 18.0 33.0 18.0 33.0 2 27.022 28.0 25.0 31.0 18.0 33.0 3 29.759 31.0 29.0 33.0 25.0 33.0 4 31.4885 33.0 31.0 33.0 29.0 33.0 5 32.4685 33.0 33.0 33.0 32.0 33.0 6 36.78325 38.0 37.0 38.0 35.0 38.0 7 37.3165 38.0 38.0 38.0 36.0 38.0 8 37.532 38.0 38.0 38.0 37.0 38.0 9 37.63725 38.0 38.0 38.0 38.0 38.0 10-14 37.66460000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.6765 38.0 38.0 38.0 38.0 38.0 20-24 37.68405 38.0 38.0 38.0 38.0 38.0 25-29 37.65475 38.0 38.0 38.0 38.0 38.0 30-34 37.6515 38.0 38.0 38.0 38.0 38.0 35-39 37.6555 38.0 38.0 38.0 38.0 38.0 40-44 37.6066 38.0 38.0 38.0 38.0 38.0 45-49 37.592349999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.4726 38.0 38.0 38.0 37.4 38.0 55-59 37.3783 38.0 38.0 38.0 37.0 38.0 60-64 37.3457 38.0 38.0 38.0 37.0 38.0 65-69 37.30915 38.0 38.0 38.0 36.8 38.0 70-74 37.27225 38.0 38.0 38.0 36.6 38.0 75-79 37.220549999999996 38.0 38.0 38.0 36.2 38.0 80-84 37.13175 38.0 38.0 38.0 36.0 38.0 85-89 37.0788 38.0 38.0 38.0 36.0 38.0 90-94 37.023649999999996 38.0 38.0 38.0 35.8 38.0 95-99 36.88915 38.0 38.0 38.0 35.4 38.0 100-104 36.661950000000004 38.0 38.0 38.0 34.2 38.0 105-109 36.55735 38.0 38.0 38.0 34.0 38.0 110-114 36.47475000000001 38.0 37.6 38.0 34.0 38.0 115-119 36.2436 38.0 37.4 38.0 33.8 38.0 120-124 36.0515 38.0 37.0 38.0 33.0 38.0 125-129 35.81205 38.0 36.0 38.0 31.2 38.0 130-134 35.47045 38.0 36.0 38.0 31.0 38.0 135-139 35.13405 38.0 35.4 38.0 30.0 38.0 140-144 34.42375 38.0 33.6 38.0 27.0 38.0 145-149 33.45255 38.0 33.0 38.0 21.4 38.0 150-151 27.88475 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 2.0 18 1.0 19 1.0 20 1.0 21 4.0 22 1.0 23 1.0 24 4.0 25 8.0 26 10.0 27 13.0 28 26.0 29 18.0 30 33.0 31 40.0 32 59.0 33 94.0 34 147.0 35 294.0 36 1037.0 37 2203.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.30366492146597 9.947643979057592 8.56020942408377 34.188481675392666 2 24.975 12.425 33.975 28.625 3 21.349999999999998 19.45 25.624999999999996 33.575 4 22.55 27.725 23.400000000000002 26.325 5 22.0 32.975 24.349999999999998 20.674999999999997 6 19.8 35.475 24.75 19.975 7 13.925 26.075 42.4 17.599999999999998 8 17.424999999999997 26.575 31.95 24.05 9 17.025000000000002 23.425 34.775 24.775 10-14 19.46 30.055 27.315 23.169999999999998 15-19 19.650000000000002 29.485 27.310000000000002 23.555 20-24 19.830000000000002 28.875 27.715 23.580000000000002 25-29 20.535 28.53 27.384999999999998 23.549999999999997 30-34 19.545977298864944 29.376468823441172 27.30636531826591 23.771188559427973 35-39 20.276013800690034 28.621431071553577 27.721386069303467 23.381169058452922 40-44 20.085 28.754999999999995 27.955000000000002 23.205000000000002 45-49 20.06 29.020000000000003 27.395000000000003 23.525 50-54 20.345 28.835 27.529999999999998 23.29 55-59 20.145 28.62 27.63 23.605 60-64 20.76 28.18 27.405 23.655 65-69 20.54 28.285 27.565 23.61 70-74 20.48 29.23 26.755000000000003 23.535 75-79 19.855 28.315 27.855 23.974999999999998 80-84 20.031001550077505 28.7914395719786 27.411370568528426 23.76618830941547 85-89 20.57 28.305000000000003 28.105000000000004 23.02 90-94 20.244999999999997 27.68 27.894999999999996 24.18 95-99 20.599999999999998 28.315 27.415 23.669999999999998 100-104 20.455000000000002 28.26 27.474999999999998 23.810000000000002 105-109 21.029999999999998 28.050000000000004 27.655 23.265 110-114 21.029999999999998 28.470000000000002 27.21 23.29 115-119 21.39 28.16 26.995 23.455000000000002 120-124 20.71 28.505000000000003 26.724999999999998 24.060000000000002 125-129 20.78 28.51 26.63 24.08 130-134 21.065 28.285 26.545 24.104999999999997 135-139 21.625 27.705000000000002 26.795 23.875 140-144 20.724999999999998 28.410000000000004 26.605 24.26 145-149 21.765 27.66 26.740000000000002 23.835 150-151 20.7 28.5875 27.125 23.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 2.0 25 3.0 26 4.5 27 5.5 28 6.5 29 12.0 30 26.5 31 32.0 32 30.5 33 39.0 34 54.5 35 78.0 36 92.0 37 105.0 38 143.5 39 168.0 40 191.5 41 215.5 42 220.5 43 246.5 44 261.5 45 266.0 46 255.0 47 234.0 48 226.5 49 219.0 50 178.0 51 145.5 52 128.0 53 98.0 54 79.0 55 57.0 56 44.5 57 38.5 58 31.0 59 20.0 60 11.0 61 7.5 62 5.5 63 3.5 64 3.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3250000000000002 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.0250000000000004 0.0 0.0 0.0 0.0 110-111 2.325 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 3.925 0.0 0.0 0.0 0.0 122-123 4.0875 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.85 0.0 0.0 0.0 0.0 128-129 5.3125 0.0 0.0 0.0 0.0 130-131 5.8625 0.0 0.0 0.0 0.0 132-133 6.237500000000001 0.0 0.0 0.0 0.0 134-135 6.5625 0.0 0.0 0.0 0.0 136-137 6.8625 0.0 0.0 0.0 0.0 138-139 7.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGCAAC 10 0.0068378756 144.95 6 >>END_MODULE SRR7170504 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170504_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72775 33.0 33.0 34.0 32.0 34.0 2 32.92975 33.0 33.0 34.0 32.0 34.0 3 32.94 34.0 33.0 34.0 32.0 34.0 4 32.81875 34.0 33.0 34.0 32.0 34.0 5 32.93375 34.0 33.0 34.0 32.0 34.0 6 37.099 38.0 38.0 38.0 36.0 38.0 7 37.12925 38.0 38.0 38.0 37.0 38.0 8 37.1725 38.0 38.0 38.0 37.0 38.0 9 37.147 38.0 38.0 38.0 37.0 38.0 10-14 37.071999999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.08775000000001 38.0 38.0 38.0 36.8 38.0 20-24 37.0872 38.0 38.0 38.0 37.0 38.0 25-29 37.04825 38.0 38.0 38.0 37.0 38.0 30-34 36.92445 38.0 38.0 38.0 36.0 38.0 35-39 36.92810000000001 38.0 38.0 38.0 36.2 38.0 40-44 36.96145 38.0 38.0 38.0 36.6 38.0 45-49 36.98125 38.0 38.0 38.0 36.2 38.0 50-54 36.9217 38.0 38.0 38.0 36.0 38.0 55-59 36.869299999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.825900000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.747 38.0 38.0 38.0 36.0 38.0 70-74 36.7162 38.0 38.0 38.0 35.6 38.0 75-79 36.623200000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.53595 38.0 38.0 38.0 35.0 38.0 85-89 36.4846 38.0 38.0 38.0 34.4 38.0 90-94 36.25445 38.0 38.0 38.0 34.0 38.0 95-99 36.2855 38.0 38.0 38.0 34.0 38.0 100-104 36.046 38.0 37.6 38.0 33.4 38.0 105-109 35.982 38.0 37.6 38.0 33.4 38.0 110-114 35.68429999999999 38.0 37.0 38.0 32.0 38.0 115-119 35.534000000000006 38.0 37.0 38.0 30.6 38.0 120-124 35.1936 38.0 36.2 38.0 30.0 38.0 125-129 34.76465 38.0 35.8 38.0 28.0 38.0 130-134 34.1003 38.0 34.0 38.0 23.4 38.0 135-139 33.363800000000005 38.0 33.0 38.0 20.4 38.0 140-144 32.462399999999995 38.0 33.0 38.0 13.2 38.0 145-149 31.333999999999996 38.0 31.8 38.0 8.0 38.0 150-151 25.487125 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 3.0 5 0.0 6 2.0 7 2.0 8 0.0 9 0.0 10 4.0 11 2.0 12 2.0 13 3.0 14 6.0 15 2.0 16 5.0 17 6.0 18 5.0 19 3.0 20 6.0 21 10.0 22 14.0 23 13.0 24 13.0 25 20.0 26 21.0 27 28.0 28 39.0 29 32.0 30 50.0 31 65.0 32 85.0 33 116.0 34 154.0 35 294.0 36 713.0 37 2271.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.78978978978979 20.22022022022022 13.68868868868869 26.3013013013013 2 27.25225225225225 24.674674674674673 30.53053053053053 17.54254254254254 3 20.37037037037037 28.32832832832833 31.78178178178178 19.51951951951952 4 23.44844844844845 33.433433433433436 23.973973973973976 19.144144144144143 5 23.74874874874875 36.08608608608609 23.123123123123122 17.04204204204204 6 20.580145036259065 37.634408602150536 24.981245311327832 16.804201050262566 7 19.609804902451224 20.135067533766886 40.895447723861935 19.35967983991996 8 22.380595148787197 24.85621405351338 27.906976744186046 24.85621405351338 9 23.20580145036259 24.60615153788447 29.707426856714182 22.48062015503876 10-14 23.895973993498373 29.037259314828706 25.881470367591895 21.185296324081023 15-19 23.14119883918743 28.5349744821375 27.509256479535676 20.8145701991394 20-24 23.0980980980981 28.45845845845846 27.642642642642645 20.8008008008008 25-29 23.28828828828829 27.66766766766767 28.11811811811812 20.925925925925924 30-34 22.62262262262262 27.732732732732735 28.558558558558563 21.086086086086087 35-39 23.45845845845846 27.557557557557555 28.088088088088085 20.895895895895897 40-44 23.223223223223226 27.642642642642645 27.75275275275275 21.38138138138138 45-49 23.183183183183186 28.20820820820821 27.6976976976977 20.91091091091091 50-54 22.98798798798799 27.692692692692695 28.18818818818819 21.13113113113113 55-59 23.32832832832833 27.992992992992992 27.75275275275275 20.925925925925924 60-64 23.473473473473476 27.51751751751752 27.772772772772775 21.236236236236238 65-69 23.6986986986987 27.43743743743744 27.797797797797795 21.066066066066067 70-74 23.692246082995442 27.92711618361115 27.126195124393053 21.25444260900035 75-79 22.94253103724469 27.20264317180617 28.609331197436926 21.245494593512216 80-84 22.796215647995194 28.077288882214546 27.7168744055664 21.409621064223856 85-89 23.40808970764918 27.638165798958752 28.19883860632759 20.754905887064478 90-94 23.799989989488964 26.918264177386252 28.449872365984284 20.831873467140497 95-99 23.64864864864865 27.85785785785786 27.78778778778779 20.705705705705707 100-104 23.88888888888889 27.68768768768769 27.32232232232232 21.1011011011011 105-109 24.43943943943944 27.602602602602605 27.87787787787788 20.08008008008008 110-114 24.06906906906907 28.388388388388385 27.177177177177175 20.365365365365363 115-119 24.16916916916917 28.01801801801802 27.45245245245245 20.36036036036036 120-124 24.491839391208572 27.961349754681088 27.46570541704215 20.08110543706819 125-129 24.157612777249287 28.042857858108444 27.502127872628044 20.29740149201422 130-134 24.750888788743676 27.5148966000701 27.20945370787642 20.5247609033098 135-139 24.849789705587824 28.239535349489287 26.922691768475865 19.987983176447024 140-144 25.101397025687245 27.730208802764007 27.49987481848681 19.66851935306194 145-149 25.64462023732038 27.211735843388574 27.296850748510487 19.846793170780554 150-151 25.190839694656486 27.330747090476788 27.118007758728567 20.360405456138157 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 2.0 25 3.0 26 3.0 27 6.5 28 9.5 29 10.0 30 11.0 31 14.0 32 21.0 33 35.0 34 51.5 35 63.5 36 81.5 37 104.0 38 129.0 39 153.5 40 188.5 41 222.5 42 233.0 43 250.0 44 276.0 45 292.0 46 282.5 47 270.0 48 238.0 49 197.5 50 172.0 51 141.0 52 127.0 53 104.0 54 79.0 55 62.5 56 39.5 57 31.5 58 28.5 59 18.5 60 9.5 61 8.0 62 8.0 63 6.5 64 4.5 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.1 6 0.025 7 0.05 8 0.025 9 0.025 10-14 0.025 15-19 0.06999999999999999 20-24 0.1 25-29 0.1 30-34 0.1 35-39 0.1 40-44 0.1 45-49 0.1 50-54 0.1 55-59 0.1 60-64 0.1 65-69 0.1 70-74 0.11499999999999999 75-79 0.12 80-84 0.11499999999999999 85-89 0.12 90-94 0.105 95-99 0.1 100-104 0.1 105-109 0.1 110-114 0.1 115-119 0.1 120-124 0.13 125-129 0.135 130-134 0.145 135-139 0.13999999999999999 140-144 0.145 145-149 0.135 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.8875000000000002 0.0 0.0 0.0 0.0 108-109 2.0999999999999996 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 3.0374999999999996 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 4.0125 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.55 0.0 0.0 0.0 0.0 126-127 4.949999999999999 0.0 0.0 0.0 0.0 128-129 5.4125 0.0 0.0 0.0 0.0 130-131 5.949999999999999 0.0 0.0 0.0 0.0 132-133 6.2875 0.0 0.0 0.0 0.0 134-135 6.6375 0.0 0.0 0.0 0.0 136-137 6.9375 0.0 0.0 0.0 0.0 138-139 7.387499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816771 spots for SRR7170504.sra Written 816771 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra Read 816753 spots for SRR7170504.sra Written 816753 spots for SRR7170504.sra SRR ids: ['SRR7170504.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yawn087o SRR7170504.sra spots: 16335078 blocks: [[1, 816753], [816754, 1633506], [1633507, 2450259], [2450260, 3267012], [3267013, 4083765], [4083766, 4900518], [4900519, 5717271], [5717272, 6534024], [6534025, 7350777], [7350778, 8167530], [8167531, 8984283], [8984284, 9801036], [9801037, 10617789], [10617790, 11434542], [11434543, 12251295], [12251296, 13068048], [13068049, 13884801], [13884802, 14701554], [14701555, 15518307], [15518308, 16335078]] SRR7170504 file size 5513721 SRR7170504 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170504 SRR7170504_1.fastq SRR7170504_2.fastq Input file: SRR7170504_1.fastq Paired file: SRR7170504_2.fastq trimmed: SRR7170504-trimmed-pair1.fastq, SRR7170504-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 03:53:34 2025 >> started Thu Feb 13 03:57:47 2025 >> done (253.749s) 16335078 read pairs processed; of these: 25924 ( 0.16%) short read pairs filtered out after trimming by size control 35087 ( 0.21%) empty read pairs filtered out after trimming by size control 16274067 (99.63%) read pairs available; of these: 10071388 (61.89%) trimmed read pairs available after processing 6202679 (38.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 4 0.00% 23 4 0.00% 24 2 0.00% 25 7 0.00% 26 5 0.00% 27 11 0.00% 28 10 0.00% 29 5 0.00% 30 9 0.00% 31 9 0.00% 32 7 0.00% 33 11 0.00% 34 15 0.00% 35 20 0.00% 36 31 0.00% 37 31 0.00% 38 31 0.00% 39 38 0.00% 40 47 0.00% 41 58 0.00% 42 51 0.00% 43 73 0.00% 44 61 0.00% 45 100 0.00% 46 116 0.00% 47 102 0.00% 48 136 0.00% 49 174 0.00% 50 183 0.00% 51 171 0.00% 52 222 0.00% 53 273 0.00% 54 257 0.00% 55 273 0.00% 56 289 0.00% 57 382 0.00% 58 422 0.00% 59 485 0.00% 60 557 0.00% 61 693 0.00% 62 760 0.00% 63 813 0.00% 64 885 0.01% 65 985 0.01% 66 1124 0.01% 67 1243 0.01% 68 1338 0.01% 69 1497 0.01% 70 1702 0.01% 71 1915 0.01% 72 2261 0.01% 73 2482 0.02% 74 2828 0.02% 75 3164 0.02% 76 3320 0.02% 77 3739 0.02% 78 3905 0.02% 79 4289 0.03% 80 4872 0.03% 81 5613 0.03% 82 6244 0.04% 83 7289 0.04% 84 9070 0.06% 85 9380 0.06% 86 9684 0.06% 87 10031 0.06% 88 10289 0.06% 89 10856 0.07% 90 11674 0.07% 91 12383 0.08% 92 13504 0.08% 93 14349 0.09% 94 15322 0.09% 95 16330 0.10% 96 17213 0.11% 97 17405 0.11% 98 18243 0.11% 99 19113 0.12% 100 19902 0.12% 101 20393 0.13% 102 21530 0.13% 103 22493 0.14% 104 23765 0.15% 105 25015 0.15% 106 26028 0.16% 107 26732 0.16% 108 27097 0.17% 109 27827 0.17% 110 27825 0.17% 111 27987 0.17% 112 29527 0.18% 113 30620 0.19% 114 31347 0.19% 115 32992 0.20% 116 33925 0.21% 117 34661 0.21% 118 35555 0.22% 119 35933 0.22% 120 37265 0.23% 121 37996 0.23% 122 39347 0.24% 123 40746 0.25% 124 43279 0.27% 125 44451 0.27% 126 46348 0.28% 127 48649 0.30% 128 50225 0.31% 129 52765 0.32% 130 55211 0.34% 131 58422 0.36% 132 62030 0.38% 133 65965 0.41% 134 69947 0.43% 135 74837 0.46% 136 79924 0.49% 137 86015 0.53% 138 92613 0.57% 139 100067 0.61% 140 109110 0.67% 141 122429 0.75% 142 136481 0.84% 143 156769 0.96% 144 185465 1.14% 145 225203 1.38% 146 293070 1.80% 147 412391 2.53% 148 638465 3.92% 149 1253467 7.70% 150 4508779 27.71% 151 6202679 38.11% 16274067 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=33 prefix-density=0.62 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=91.92 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.7 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=5.65 fanout-score-rank=11 prefix-density=0.58 prefix-fanout=3.8 sequence=AAGAAAGCTTACCCTAACTCCTTTATCCGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=60.67 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170504 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 04:33:37 Started mapping on | Feb 13 04:33:41 Finished on | Feb 13 05:55:12 Mapping speed, Million of reads per hour | 11.98 Number of input reads | 16274067 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15200703 Uniquely mapped reads % | 93.40% Average mapped length | 290.90 Number of splices: Total | 14249858 Number of splices: Annotated (sjdb) | 13945898 Number of splices: GT/AG | 13963196 Number of splices: GC/AG | 241356 Number of splices: AT/AC | 9085 Number of splices: Non-canonical | 36221 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463928 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 37954 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 624962 624962 624962 N_multimapping 463928 463928 463928 N_noFeature 427354 14994622 490309 N_ambiguous 264612 832 121058 UnstrandedReadsAssigned:14508737 PositiveStrandReadsAssigned:205249 NegativeStrandReadsAssigned:14589336 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170504 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170504-trimmed-pair1.fastq SRR7170504-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,274,067 reads, 14,615,429 reads pseudoaligned [quant] estimated average fragment length: 255.088 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR7170504.ke.tsv 34699 SRR7170504.se.tsv 87100 total ==> SRR7170504.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.91 498 18.7329 Potri.005G024800.1.v4.1 1035 780.912 226 19.2025 Potri.004G059700.1.v4.1 961 706.922 13 1.22018 Potri.007G009000.2.v4.1 1416 1161.91 0 0 Potri.003G141000.2.v4.1 2943 2688.91 551.248 13.6026 Potri.016G087400.1.v4.1 270 83.4491 878 698.111 Potri.015G069301.1.v4.1 564 313.495 0 0 Potri.010G195200.1.v4.1 1773 1518.91 22 0.961041 Potri.012G127500.1.v4.1 977 722.917 352 32.3077 ==> SRR7170504.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 104 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 151 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170504 completed mapping pipeline successfully