Starting /dee2/code/volunteer_pipeline.sh SRR7170505 current disk space = 3051603271680 free memory = 1408426792 SRR7170505 SRAfilesize 43a77354feae755f6bbf0592bc4c2302 SRR7170505.sra SRR7170505.sra file validated SRR7170505 is paired end SRR7170505 is conventional basespace SRR7170505 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170505_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.9715 18.0 18.0 30.0 18.0 32.0 2 30.63575 31.0 29.0 33.0 27.0 33.0 3 31.8615 33.0 31.0 33.0 29.0 33.0 4 32.3435 33.0 33.0 33.0 31.0 34.0 5 32.9425 33.0 33.0 34.0 32.0 34.0 6 36.7085 38.0 37.0 38.0 34.0 38.0 7 37.18375 38.0 38.0 38.0 36.0 38.0 8 37.354 38.0 38.0 38.0 36.0 38.0 9 37.46625 38.0 38.0 38.0 37.0 38.0 10-14 37.4768 38.0 38.0 38.0 37.0 38.0 15-19 37.457750000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.43465 38.0 38.0 38.0 37.0 38.0 25-29 37.4612 38.0 38.0 38.0 37.0 38.0 30-34 37.4927 38.0 38.0 38.0 37.0 38.0 35-39 37.433949999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.346849999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.32135 38.0 38.0 38.0 36.8 38.0 50-54 37.26035 38.0 38.0 38.0 36.2 38.0 55-59 37.13365 38.0 38.0 38.0 36.0 38.0 60-64 37.036 38.0 38.0 38.0 36.0 38.0 65-69 37.00595 38.0 38.0 38.0 35.8 38.0 70-74 36.9216 38.0 38.0 38.0 35.4 38.0 75-79 36.7043 38.0 38.0 38.0 34.8 38.0 80-84 36.62015 38.0 38.0 38.0 34.2 38.0 85-89 36.416 38.0 37.6 38.0 34.0 38.0 90-94 36.3228 38.0 37.0 38.0 34.0 38.0 95-99 36.1475 38.0 37.0 38.0 33.6 38.0 100-104 36.204249999999995 38.0 37.0 38.0 33.6 38.0 105-109 35.920849999999994 38.0 37.0 38.0 32.4 38.0 110-114 35.6531 38.0 36.2 38.0 31.2 38.0 115-119 35.239999999999995 38.0 36.0 38.0 28.8 38.0 120-124 35.219899999999996 38.0 35.8 38.0 28.8 38.0 125-129 34.80885 38.0 35.0 38.0 27.6 38.0 130-134 31.106450000000002 34.6 27.6 37.8 18.6 38.0 135-139 33.3597 37.8 32.8 38.0 21.8 38.0 140-144 29.63885 33.4 25.0 37.6 14.0 38.0 145-149 31.3502 36.0 31.0 38.0 11.0 38.0 150-151 26.917875000000002 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 2.0 15 0.0 16 1.0 17 1.0 18 2.0 19 8.0 20 1.0 21 5.0 22 4.0 23 5.0 24 15.0 25 10.0 26 18.0 27 25.0 28 23.0 29 44.0 30 47.0 31 75.0 32 108.0 33 165.0 34 317.0 35 574.0 36 1394.0 37 1152.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.640321326768593 11.142783104431201 14.667012179321068 42.549883389479135 2 22.061030515257627 15.607803901950975 34.76738369184592 27.56378189094547 3 19.225 21.75 24.9 34.125 4 20.65 30.875000000000004 23.025000000000002 25.45 5 21.875 33.675 24.5 19.950000000000003 6 18.725 37.325 25.85 18.099999999999998 7 14.799999999999999 24.325 43.675000000000004 17.2 8 18.325 25.5 29.875 26.3 9 16.2 25.8 33.425 24.575 10-14 19.064999999999998 29.79 27.42 23.724999999999998 15-19 19.63 28.88 27.96 23.53 20-24 19.8 28.965000000000003 28.08 23.155 25-29 19.905 28.79 27.395000000000003 23.91 30-34 19.46 29.645 27.63 23.265 35-39 19.715 28.449999999999996 27.905 23.93 40-44 19.57 28.835 27.615000000000002 23.98 45-49 19.615 28.815 27.794999999999998 23.775 50-54 19.509999999999998 29.044999999999998 27.515 23.93 55-59 19.56 28.705000000000002 27.66 24.075 60-64 20.01 28.565 27.88 23.544999999999998 65-69 20.57 28.249999999999996 27.589999999999996 23.59 70-74 19.85 28.65 27.950000000000003 23.549999999999997 75-79 19.96 28.335 28.249999999999996 23.455000000000002 80-84 20.24 29.005 27.295 23.46 85-89 20.49 28.595 27.389999999999997 23.525 90-94 20.285 28.93 26.865 23.919999999999998 95-99 19.869999999999997 28.76 28.065 23.305 100-104 20.04 28.494999999999997 27.575 23.89 105-109 20.49 28.660000000000004 27.51 23.34 110-114 20.215 28.610000000000003 27.565 23.61 115-119 20.294999999999998 28.754999999999995 27.115000000000002 23.835 120-124 20.555 28.494999999999997 26.985 23.965 125-129 20.549999999999997 28.439999999999998 27.72 23.29 130-134 20.225 28.705000000000002 27.339999999999996 23.73 135-139 20.135 28.43 27.37 24.065 140-144 19.89 28.415000000000003 27.715 23.98 145-149 20.455000000000002 28.32 27.425 23.799999999999997 150-151 19.975 28.275 28.212500000000002 23.5375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 3.0 26 5.5 27 8.0 28 12.5 29 17.0 30 22.0 31 28.5 32 36.5 33 51.0 34 61.5 35 71.5 36 95.5 37 125.5 38 152.0 39 172.0 40 201.5 41 221.0 42 228.0 43 250.0 44 257.0 45 250.0 46 253.0 47 262.0 48 241.5 49 205.5 50 175.0 51 142.5 52 118.5 53 81.5 54 56.5 55 48.5 56 37.5 57 28.0 58 22.5 59 18.0 60 11.0 61 9.0 62 6.5 63 3.0 64 1.0 65 1.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5249999999999995 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.5874999999999999 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 0.9874999999999999 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.45 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 1.7625 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.025 0.0 108-109 2.3125 0.0 0.0 0.025 0.0 110-111 2.4125 0.0 0.0 0.025 0.0 112-113 2.6500000000000004 0.0 0.0 0.025 0.0 114-115 3.0 0.0 0.0 0.025 0.0 116-117 3.3 0.0 0.0 0.025 0.0 118-119 3.5999999999999996 0.0 0.0 0.025 0.0 120-121 3.7625 0.0 0.0 0.025 0.0 122-123 3.95 0.0 0.0 0.025 0.0 124-125 4.0625 0.0 0.0 0.025 0.0 126-127 4.2 0.0 0.0 0.025 0.0 128-129 4.375 0.0 0.0 0.025 0.0 130-131 4.5375 0.0 0.0 0.025 0.0 132-133 4.675000000000001 0.0 0.0 0.025 0.0 134-135 4.85 0.0 0.0 0.025 0.0 136-137 5.125 0.0 0.0 0.025 0.0 138-139 5.4375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCTGA 35 0.0033146844 62.13214 145 AAAAAAA 40 0.0076626483 18.121876 55-59 >>END_MODULE SRR7170505 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170505_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1 33.0 33.0 34.0 32.0 34.0 2 33.1815 34.0 33.0 34.0 33.0 34.0 3 33.26625 34.0 33.0 34.0 33.0 34.0 4 33.30825 34.0 33.0 34.0 33.0 34.0 5 33.25275 34.0 33.0 34.0 33.0 34.0 6 37.43925 38.0 38.0 38.0 38.0 38.0 7 37.41975 38.0 38.0 38.0 38.0 38.0 8 37.48575 38.0 38.0 38.0 38.0 38.0 9 37.4865 38.0 38.0 38.0 38.0 38.0 10-14 37.4154 38.0 38.0 38.0 37.6 38.0 15-19 36.5221 38.0 37.2 38.0 32.0 38.0 20-24 37.27685 38.0 38.0 38.0 37.0 38.0 25-29 37.17285 38.0 38.0 38.0 37.0 38.0 30-34 37.28699999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.3123 38.0 38.0 38.0 37.0 38.0 40-44 37.2747 38.0 38.0 38.0 37.0 38.0 45-49 37.24495 38.0 38.0 38.0 37.0 38.0 50-54 37.26455 38.0 38.0 38.0 37.0 38.0 55-59 37.22745 38.0 38.0 38.0 37.0 38.0 60-64 37.161699999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.158500000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.01610000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.9886 38.0 38.0 38.0 36.0 38.0 80-84 36.87495 38.0 38.0 38.0 36.0 38.0 85-89 36.45295 38.0 37.8 38.0 34.2 38.0 90-94 34.56535 37.8 34.4 38.0 24.8 38.0 95-99 36.4601 38.0 37.8 38.0 34.2 38.0 100-104 36.384049999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.2804 38.0 38.0 38.0 34.0 38.0 110-114 36.09765 38.0 37.2 38.0 34.0 38.0 115-119 35.984249999999996 38.0 37.2 38.0 33.2 38.0 120-124 35.38155 38.0 36.4 38.0 30.2 38.0 125-129 35.096349999999994 38.0 36.0 38.0 30.0 38.0 130-134 34.8194 38.0 35.2 38.0 29.2 38.0 135-139 34.18585 38.0 34.0 38.0 25.8 38.0 140-144 33.372550000000004 38.0 33.0 38.0 20.6 38.0 145-149 32.08755000000001 38.0 33.0 38.0 10.8 38.0 150-151 26.15925 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 3.0 5 0.0 6 1.0 7 0.0 8 0.0 9 2.0 10 1.0 11 3.0 12 0.0 13 2.0 14 2.0 15 2.0 16 3.0 17 1.0 18 7.0 19 2.0 20 7.0 21 10.0 22 5.0 23 5.0 24 13.0 25 13.0 26 12.0 27 9.0 28 23.0 29 25.0 30 34.0 31 45.0 32 83.0 33 125.0 34 196.0 35 379.0 36 852.0 37 2129.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.25 20.175 21.15 28.425 2 28.325 24.9 30.25 16.525000000000002 3 21.3 27.700000000000003 31.724999999999998 19.275000000000002 4 22.525000000000002 35.375 23.9 18.2 5 24.125 35.9 22.925 17.05 6 21.025 37.325 23.150000000000002 18.5 7 18.5 21.349999999999998 40.475 19.675 8 22.125 25.6 27.925 24.349999999999998 9 21.975 24.275 30.475 23.275000000000002 10-14 22.98 28.875 27.224999999999998 20.919999999999998 15-19 22.345000000000002 28.67 27.750000000000004 21.235 20-24 23.105 28.595 27.655 20.645 25-29 23.119999999999997 28.285 27.735 20.86 30-34 22.61 28.43 27.955000000000002 21.005 35-39 22.79 28.37 27.985 20.855 40-44 22.435 28.799999999999997 27.665 21.099999999999998 45-49 22.6 28.07 28.139999999999997 21.19 50-54 22.57 27.85 28.610000000000003 20.97 55-59 23.45 28.105000000000004 27.900000000000002 20.544999999999998 60-64 22.96 27.825 28.389999999999997 20.825 65-69 23.175 27.47 28.315 21.04 70-74 23.34 27.775 28.22 20.665 75-79 23.615 27.97 27.915 20.5 80-84 23.244999999999997 28.21 27.54 21.005 85-89 23.68 28.125 27.685 20.51 90-94 23.455000000000002 27.944999999999997 27.939999999999998 20.66 95-99 23.3 28.17 27.265 21.265 100-104 23.465 28.365000000000002 27.334999999999997 20.835 105-109 23.244999999999997 28.205000000000002 27.955000000000002 20.595 110-114 23.915 28.139999999999997 27.88 20.064999999999998 115-119 24.169999999999998 27.79 27.54 20.5 120-124 24.099999999999998 28.46 27.505000000000003 19.935 125-129 23.64 28.425 27.625 20.31 130-134 24.22 28.26 27.875 19.645000000000003 135-139 24.245 27.839999999999996 27.74 20.175 140-144 24.240000000000002 28.12 27.389999999999997 20.25 145-149 24.195 28.68 27.284999999999997 19.84 150-151 25.0 28.037499999999998 26.974999999999998 19.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 1.5 23 2.0 24 3.0 25 3.5 26 4.5 27 4.0 28 8.5 29 14.5 30 14.5 31 19.0 32 29.0 33 43.5 34 51.0 35 56.0 36 84.0 37 119.0 38 143.0 39 176.5 40 209.5 41 240.5 42 258.0 43 262.5 44 282.0 45 288.5 46 264.0 47 235.0 48 211.5 49 175.0 50 158.0 51 147.0 52 116.0 53 83.0 54 71.0 55 70.0 56 51.5 57 34.5 58 21.5 59 10.0 60 7.0 61 6.5 62 5.5 63 4.0 64 2.5 65 1.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36932391523713 98.475 2 0.4036326942482341 0.8 3 0.17658930373360243 0.525 4 0.050454086781029264 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.5375000000000001 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 90-91 0.9 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.1124999999999998 0.0 0.0 0.0 0.0 96-97 1.275 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.6125 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.5999999999999996 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 3.7249999999999996 0.0 0.0 0.0 0.0 122-123 3.9625 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.3 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 4.7375 0.0 0.0 0.0 0.0 132-133 5.0 0.0 0.0 0.0 0.0 134-135 5.2625 0.0 0.0 0.0 0.0 136-137 5.6375 0.0 0.0 0.0 0.0 138-139 6.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAGTA 10 0.006830828 145.0 4 GTGTAGG 40 0.005621335 54.375 145 >>END_MODULE Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634565 spots for SRR7170505.sra Written 634565 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra Read 634554 spots for SRR7170505.sra Written 634554 spots for SRR7170505.sra SRR ids: ['SRR7170505.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3y73fhk7 SRR7170505.sra spots: 12691091 blocks: [[1, 634554], [634555, 1269108], [1269109, 1903662], [1903663, 2538216], [2538217, 3172770], [3172771, 3807324], [3807325, 4441878], [4441879, 5076432], [5076433, 5710986], [5710987, 6345540], [6345541, 6980094], [6980095, 7614648], [7614649, 8249202], [8249203, 8883756], [8883757, 9518310], [9518311, 10152864], [10152865, 10787418], [10787419, 11421972], [11421973, 12056526], [12056527, 12691091]] SRR7170505 file size 4278893 SRR7170505 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170505 SRR7170505_1.fastq SRR7170505_2.fastq Input file: SRR7170505_1.fastq Paired file: SRR7170505_2.fastq trimmed: SRR7170505-trimmed-pair1.fastq, SRR7170505-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 05:59:15 2025 >> started Thu Feb 13 06:01:41 2025 >> done (146.680s) 12691091 read pairs processed; of these: 6914 ( 0.05%) short read pairs filtered out after trimming by size control 22527 ( 0.18%) empty read pairs filtered out after trimming by size control 12661650 (99.77%) read pairs available; of these: 7700152 (60.81%) trimmed read pairs available after processing 4961498 (39.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 4 0.00% 21 2 0.00% 22 9 0.00% 23 4 0.00% 24 5 0.00% 25 3 0.00% 26 3 0.00% 27 5 0.00% 28 8 0.00% 29 10 0.00% 30 13 0.00% 31 8 0.00% 32 9 0.00% 33 17 0.00% 34 25 0.00% 35 15 0.00% 36 32 0.00% 37 33 0.00% 38 32 0.00% 39 47 0.00% 40 53 0.00% 41 76 0.00% 42 51 0.00% 43 83 0.00% 44 87 0.00% 45 92 0.00% 46 106 0.00% 47 144 0.00% 48 155 0.00% 49 204 0.00% 50 223 0.00% 51 282 0.00% 52 262 0.00% 53 293 0.00% 54 317 0.00% 55 349 0.00% 56 356 0.00% 57 385 0.00% 58 493 0.00% 59 569 0.00% 60 694 0.01% 61 758 0.01% 62 893 0.01% 63 914 0.01% 64 984 0.01% 65 1045 0.01% 66 1121 0.01% 67 1223 0.01% 68 1350 0.01% 69 1523 0.01% 70 1829 0.01% 71 2010 0.02% 72 2283 0.02% 73 2520 0.02% 74 2807 0.02% 75 2979 0.02% 76 3543 0.03% 77 3884 0.03% 78 3623 0.03% 79 3894 0.03% 80 4294 0.03% 81 4704 0.04% 82 5266 0.04% 83 5718 0.05% 84 6441 0.05% 85 6808 0.05% 86 7214 0.06% 87 7352 0.06% 88 7625 0.06% 89 7879 0.06% 90 8518 0.07% 91 9071 0.07% 92 9615 0.08% 93 10071 0.08% 94 10925 0.09% 95 11277 0.09% 96 11345 0.09% 97 11445 0.09% 98 11673 0.09% 99 11821 0.09% 100 12321 0.10% 101 12846 0.10% 102 13319 0.11% 103 13771 0.11% 104 14543 0.11% 105 14916 0.12% 106 15062 0.12% 107 15512 0.12% 108 15365 0.12% 109 15727 0.12% 110 16077 0.13% 111 16276 0.13% 112 16560 0.13% 113 17146 0.14% 114 17920 0.14% 115 18596 0.15% 116 18783 0.15% 117 19271 0.15% 118 19660 0.16% 119 20014 0.16% 120 20439 0.16% 121 21038 0.17% 122 21679 0.17% 123 22774 0.18% 124 23923 0.19% 125 25025 0.20% 126 26194 0.21% 127 27237 0.22% 128 28164 0.22% 129 29459 0.23% 130 30950 0.24% 131 33042 0.26% 132 35016 0.28% 133 37957 0.30% 134 40852 0.32% 135 44808 0.35% 136 49176 0.39% 137 54290 0.43% 138 60112 0.47% 139 67346 0.53% 140 76377 0.60% 141 87407 0.69% 142 101549 0.80% 143 121939 0.96% 144 148586 1.17% 145 188219 1.49% 146 244542 1.93% 147 346762 2.74% 148 538078 4.25% 149 1037748 8.20% 150 3571965 28.21% 151 4961498 39.19% 12661650 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=17 prefix-density=0.59 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=20 fanout-score=50.75 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=20 prefix-density=0.61 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=19.37 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=4.9 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR7170505 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:05:21 Started mapping on | Feb 13 06:05:22 Finished on | Feb 13 06:08:12 Mapping speed, Million of reads per hour | 268.13 Number of input reads | 12661650 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12019059 Uniquely mapped reads % | 94.92% Average mapped length | 292.59 Number of splices: Total | 11774191 Number of splices: Annotated (sjdb) | 11509723 Number of splices: GT/AG | 11552076 Number of splices: GC/AG | 182932 Number of splices: AT/AC | 7254 Number of splices: Non-canonical | 31929 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327110 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 22039 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.27% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 323180 323180 323180 N_multimapping 327110 327110 327110 N_noFeature 434848 11810785 502810 N_ambiguous 231594 710 90920 UnstrandedReadsAssigned:11352617 PositiveStrandReadsAssigned:207564 NegativeStrandReadsAssigned:11425329 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170505 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170505-trimmed-pair1.fastq SRR7170505-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,661,650 reads, 11,374,816 reads pseudoaligned [quant] estimated average fragment length: 280.991 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR7170505.ke.tsv 34699 SRR7170505.se.tsv 87100 total ==> SRR7170505.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.01 568 27.2653 Potri.005G024800.1.v4.1 1035 755.009 113 12.4865 Potri.004G059700.1.v4.1 961 681.062 10 1.22498 Potri.007G009000.2.v4.1 1416 1136.01 0 0 Potri.003G141000.2.v4.1 2943 2663.01 523.604 16.4038 Potri.016G087400.1.v4.1 270 79.9662 730 761.606 Potri.015G069301.1.v4.1 564 291.893 0 0 Potri.010G195200.1.v4.1 1773 1493.01 32 1.78814 Potri.012G127500.1.v4.1 977 697.036 136 16.2779 ==> SRR7170505.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 680 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 197 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 114 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7170505 completed mapping pipeline successfully