Starting /dee2/code/volunteer_pipeline.sh SRR7170506 current disk space = 3053146796032 free memory = 1579728184 SRR7170506 SRAfilesize 522837fdbd1baebaa3796a43e08d320d SRR7170506.sra SRR7170506.sra file validated SRR7170506 is paired end SRR7170506 is conventional basespace SRR7170506 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170506_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.17175 30.0 18.0 33.0 18.0 33.0 2 30.23975 31.0 29.0 33.0 27.0 33.0 3 30.7245 31.0 29.0 33.0 27.0 33.0 4 30.167 31.0 29.0 33.0 27.0 33.0 5 32.00525 33.0 31.0 33.0 29.0 33.0 6 36.231 38.0 36.0 38.0 33.0 38.0 7 37.04525 38.0 37.0 38.0 35.0 38.0 8 37.485 38.0 38.0 38.0 37.0 38.0 9 37.59425 38.0 38.0 38.0 37.0 38.0 10-14 36.88595 38.0 37.8 38.0 34.8 38.0 15-19 37.59165 38.0 38.0 38.0 37.8 38.0 20-24 37.583200000000005 38.0 38.0 38.0 38.0 38.0 25-29 36.6927 38.0 37.2 38.0 32.2 38.0 30-34 37.11745 38.0 38.0 38.0 35.8 38.0 35-39 37.357150000000004 38.0 38.0 38.0 36.8 38.0 40-44 37.49145 38.0 38.0 38.0 37.6 38.0 45-49 37.4245 38.0 38.0 38.0 37.0 38.0 50-54 37.4307 38.0 38.0 38.0 37.0 38.0 55-59 37.38065 38.0 38.0 38.0 37.0 38.0 60-64 37.378550000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.3086 38.0 38.0 38.0 37.0 38.0 70-74 36.9372 38.0 38.0 38.0 35.6 38.0 75-79 37.148199999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.116049999999994 38.0 38.0 38.0 36.0 38.0 85-89 37.0129 38.0 38.0 38.0 36.0 38.0 90-94 36.8969 38.0 38.0 38.0 35.6 38.0 95-99 36.8555 38.0 38.0 38.0 35.2 38.0 100-104 36.86705 38.0 38.0 38.0 35.2 38.0 105-109 36.798950000000005 38.0 38.0 38.0 35.0 38.0 110-114 36.65675 38.0 38.0 38.0 34.6 38.0 115-119 36.323750000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.37220000000001 38.0 37.8 38.0 34.0 38.0 125-129 36.10455 38.0 37.0 38.0 33.0 38.0 130-134 35.85835000000001 38.0 36.6 38.0 32.6 38.0 135-139 35.5105 38.0 35.8 38.0 31.0 38.0 140-144 35.44425 38.0 35.8 38.0 31.0 38.0 145-149 34.97 38.0 35.2 38.0 31.0 38.0 150-151 31.112125 35.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 2.0 13 0.0 14 0.0 15 1.0 16 0.0 17 3.0 18 1.0 19 2.0 20 1.0 21 2.0 22 1.0 23 4.0 24 3.0 25 6.0 26 6.0 27 14.0 28 18.0 29 15.0 30 32.0 31 42.0 32 63.0 33 86.0 34 168.0 35 266.0 36 834.0 37 2427.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.68025410269984 9.820010587612494 9.555320275277925 44.944415034409744 2 20.340255191393545 15.761821366024517 33.80035026269702 30.09757317988491 3 20.125 18.8 25.7 35.375 4 22.725 27.3 21.525 28.449999999999996 5 23.35 32.45 24.675 19.525000000000002 6 19.950000000000003 36.075 23.525 20.45 7 14.499999999999998 25.324999999999996 42.225 17.95 8 17.599999999999998 24.75 32.375 25.275 9 17.05 23.75 35.675000000000004 23.525 10-14 19.36 30.330000000000002 27.474999999999998 22.835 15-19 19.685 28.999999999999996 27.615000000000002 23.7 20-24 19.88 28.215 28.1 23.805 25-29 20.080000000000002 28.915000000000003 27.175 23.830000000000002 30-34 20.105 28.935 27.055 23.905 35-39 19.17 28.835 28.060000000000002 23.935000000000002 40-44 20.150000000000002 28.63 27.52 23.7 45-49 19.755 28.444999999999997 27.944999999999997 23.855 50-54 20.560000000000002 28.134999999999998 27.950000000000003 23.355 55-59 20.369999999999997 28.044999999999998 28.055000000000003 23.53 60-64 19.475 27.994999999999997 27.900000000000002 24.63 65-69 20.02 28.255000000000003 27.855 23.87 70-74 19.985 27.605 28.04 24.37 75-79 20.265 28.315 27.939999999999998 23.48 80-84 20.200000000000003 28.349999999999998 27.544999999999998 23.905 85-89 20.615 28.58 26.83 23.974999999999998 90-94 20.155 27.805000000000003 27.939999999999998 24.099999999999998 95-99 20.36 28.449999999999996 26.995 24.195 100-104 20.31 28.194999999999997 27.575 23.919999999999998 105-109 20.785 28.155 27.575 23.485 110-114 20.544999999999998 27.575 27.705000000000002 24.175 115-119 21.035 28.505000000000003 27.05 23.41 120-124 20.48 27.83 27.339999999999996 24.349999999999998 125-129 20.485 28.34 27.05 24.125 130-134 20.515 27.565 27.779999999999998 24.14 135-139 20.830000000000002 28.03 27.485 23.655 140-144 21.005 27.785 27.295 23.915 145-149 20.919999999999998 27.38 27.450000000000003 24.25 150-151 20.825 27.0125 27.462500000000002 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.5 24 2.0 25 3.0 26 4.5 27 6.0 28 10.5 29 15.0 30 19.5 31 25.5 32 34.0 33 41.5 34 51.0 35 74.0 36 85.0 37 102.5 38 130.0 39 156.5 40 197.0 41 225.0 42 241.0 43 249.0 44 265.5 45 266.5 46 267.0 47 252.5 48 220.5 49 203.5 50 179.0 51 147.0 52 108.0 53 86.0 54 70.0 55 55.0 56 51.5 57 43.0 58 29.5 59 27.0 60 19.0 61 10.5 62 9.5 63 6.0 64 3.0 65 0.5 66 0.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.55 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.3375 0.0 0.0 0.0 0.0 126-127 3.6500000000000004 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.275 0.0 0.0 0.0 0.0 132-133 4.725 0.0 0.0 0.0 0.0 134-135 4.95 0.0 0.0 0.0 0.0 136-137 5.1875 0.0 0.0 0.0 0.0 138-139 5.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCTCC 10 0.006836113 144.9625 7 >>END_MODULE SRR7170506 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170506_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8955 33.0 33.0 34.0 32.0 34.0 2 32.95525 34.0 33.0 34.0 32.0 34.0 3 33.0095 34.0 33.0 34.0 32.0 34.0 4 32.93875 34.0 33.0 34.0 32.0 34.0 5 32.982 34.0 33.0 34.0 32.0 34.0 6 37.11825 38.0 38.0 38.0 36.0 38.0 7 37.134 38.0 38.0 38.0 37.0 38.0 8 37.21 38.0 38.0 38.0 37.0 38.0 9 37.15375 38.0 38.0 38.0 37.0 38.0 10-14 36.99125 38.0 38.0 38.0 36.4 38.0 15-19 36.939800000000005 38.0 38.0 38.0 36.0 38.0 20-24 36.8882 38.0 38.0 38.0 36.0 38.0 25-29 36.882250000000006 38.0 38.0 38.0 36.2 38.0 30-34 36.999300000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.966 38.0 38.0 38.0 36.2 38.0 40-44 36.88445 38.0 38.0 38.0 36.0 38.0 45-49 36.7973 38.0 38.0 38.0 36.0 38.0 50-54 36.50995 38.0 38.0 38.0 34.0 38.0 55-59 36.705200000000005 38.0 38.0 38.0 35.4 38.0 60-64 36.00975 38.0 37.2 38.0 30.0 38.0 65-69 36.5922 38.0 38.0 38.0 34.8 38.0 70-74 36.4379 38.0 38.0 38.0 34.4 38.0 75-79 36.438649999999996 38.0 38.0 38.0 34.0 38.0 80-84 35.769149999999996 38.0 36.8 38.0 29.6 38.0 85-89 34.52075 38.0 34.0 38.0 25.0 38.0 90-94 36.1597 38.0 37.6 38.0 33.2 38.0 95-99 36.10615 38.0 38.0 38.0 33.4 38.0 100-104 35.73315 38.0 37.4 38.0 30.0 38.0 105-109 35.2006 38.0 36.2 38.0 27.4 38.0 110-114 35.4628 38.0 36.4 38.0 29.6 38.0 115-119 35.58545 38.0 36.8 38.0 31.0 38.0 120-124 35.25985 38.0 36.0 38.0 29.4 38.0 125-129 34.808949999999996 38.0 35.8 38.0 27.2 38.0 130-134 34.096000000000004 38.0 33.8 38.0 23.4 38.0 135-139 34.1361 38.0 33.6 38.0 24.6 38.0 140-144 33.10379999999999 38.0 33.0 38.0 17.8 38.0 145-149 32.51535 38.0 33.0 38.0 13.8 38.0 150-151 26.859 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 3.0 12 3.0 13 2.0 14 2.0 15 1.0 16 2.0 17 2.0 18 2.0 19 6.0 20 11.0 21 8.0 22 8.0 23 19.0 24 18.0 25 14.0 26 27.0 27 33.0 28 35.0 29 42.0 30 62.0 31 72.0 32 94.0 33 132.0 34 228.0 35 354.0 36 790.0 37 2013.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.55 19.175 16.175 30.099999999999998 2 26.400000000000002 26.05 31.55 16.0 3 19.875 27.750000000000004 32.975 19.400000000000002 4 23.875 33.900000000000006 24.0 18.224999999999998 5 24.85 35.25 21.575 18.325 6 20.200000000000003 39.125 22.775000000000002 17.9 7 19.25 21.4 39.7 19.650000000000002 8 21.725 25.474999999999998 27.825 24.975 9 22.5 25.25 29.425 22.825 10-14 23.21 29.4 26.005 21.385 15-19 23.16 27.845 28.18 20.815 20-24 22.935 28.185 27.51 21.37 25-29 23.04 28.299999999999997 27.82 20.84 30-34 22.805 27.584999999999997 28.17 21.44 35-39 22.761138056902848 28.056402820141006 28.25141257062853 20.93104655232762 40-44 23.369999999999997 28.110000000000003 27.639999999999997 20.880000000000003 45-49 22.759999999999998 27.955000000000002 27.845 21.44 50-54 23.23 27.810000000000002 27.935 21.025 55-59 22.495 28.33 27.339999999999996 21.834999999999997 60-64 23.369999999999997 27.485 28.03 21.115000000000002 65-69 23.65 28.249999999999996 27.62 20.48 70-74 23.45 27.515 27.82 21.215 75-79 23.380000000000003 27.939999999999998 27.400000000000002 21.279999999999998 80-84 23.741187059352967 27.626381319065953 27.571378568928445 21.061053052652632 85-89 23.51 27.79 27.13 21.57 90-94 23.785 27.36 27.29 21.565 95-99 24.22 27.63 27.985 20.165 100-104 24.06120306015301 27.336366818340917 28.001400070003502 20.601030051502576 105-109 23.995 27.33 27.73 20.945 110-114 24.279999999999998 27.825 27.61 20.285 115-119 24.675 28.310000000000002 26.884999999999998 20.13 120-124 24.501225061253063 27.906395319765988 27.006350317515874 20.58602930146507 125-129 24.411220561028053 27.471373568678437 27.60138006900345 20.516025801290063 130-134 24.97 28.355000000000004 26.435 20.24 135-139 24.57 27.775 27.315 20.34 140-144 25.0 28.110000000000003 27.07 19.82 145-149 24.884999999999998 27.455000000000002 27.279999999999998 20.380000000000003 150-151 25.5375 27.762500000000003 27.500000000000004 19.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.5 21 3.0 22 2.0 23 1.5 24 1.0 25 3.0 26 5.5 27 7.5 28 6.5 29 5.0 30 11.5 31 16.5 32 24.0 33 31.5 34 39.0 35 55.5 36 81.5 37 105.0 38 126.0 39 161.5 40 206.0 41 242.5 42 262.0 43 259.5 44 260.5 45 270.5 46 261.0 47 244.0 48 221.5 49 204.5 50 185.0 51 144.0 52 121.0 53 97.5 54 71.5 55 64.5 56 49.5 57 34.0 58 27.5 59 21.0 60 15.0 61 13.0 62 10.0 63 7.5 64 5.0 65 2.5 66 1.5 67 0.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4452849218356 98.6 2 0.4034291477559254 0.8 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.05042864346949068 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.9125 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.8 0.0 0.0 0.0 0.0 130-131 4.1625 0.0 0.0 0.0 0.0 132-133 4.6 0.0 0.0 0.0 0.0 134-135 4.825 0.0 0.0 0.0 0.0 136-137 5.0625 0.0 0.0 0.0 0.0 138-139 5.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATTT 10 0.006830828 145.0 1 GCTACAC 10 0.006830828 145.0 1 >>END_MODULE Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973544 spots for SRR7170506.sra Written 973544 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra Read 973530 spots for SRR7170506.sra Written 973530 spots for SRR7170506.sra SRR ids: ['SRR7170506.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wn4hpg6c SRR7170506.sra spots: 19470614 blocks: [[1, 973530], [973531, 1947060], [1947061, 2920590], [2920591, 3894120], [3894121, 4867650], [4867651, 5841180], [5841181, 6814710], [6814711, 7788240], [7788241, 8761770], [8761771, 9735300], [9735301, 10708830], [10708831, 11682360], [11682361, 12655890], [12655891, 13629420], [13629421, 14602950], [14602951, 15576480], [15576481, 16550010], [16550011, 17523540], [17523541, 18497070], [18497071, 19470614]] SRR7170506 file size 6576251 SRR7170506 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170506 SRR7170506_1.fastq SRR7170506_2.fastq Input file: SRR7170506_1.fastq Paired file: SRR7170506_2.fastq trimmed: SRR7170506-trimmed-pair1.fastq, SRR7170506-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:41:45 2025 >> started Thu Feb 13 06:42:07 2025 >> done (21.620s) 19470614 read pairs processed; of these: 12028 ( 0.06%) short read pairs filtered out after trimming by size control 12766 ( 0.07%) empty read pairs filtered out after trimming by size control 19445820 (99.87%) read pairs available; of these: 10434260 (53.66%) trimmed read pairs available after processing 9011560 (46.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 6 0.00% 21 0 0.00% 22 3 0.00% 23 0 0.00% 24 2 0.00% 25 2 0.00% 26 4 0.00% 27 2 0.00% 28 9 0.00% 29 7 0.00% 30 8 0.00% 31 6 0.00% 32 4 0.00% 33 11 0.00% 34 11 0.00% 35 10 0.00% 36 20 0.00% 37 14 0.00% 38 8 0.00% 39 14 0.00% 40 17 0.00% 41 26 0.00% 42 33 0.00% 43 31 0.00% 44 49 0.00% 45 64 0.00% 46 47 0.00% 47 62 0.00% 48 81 0.00% 49 101 0.00% 50 112 0.00% 51 119 0.00% 52 153 0.00% 53 157 0.00% 54 158 0.00% 55 189 0.00% 56 208 0.00% 57 268 0.00% 58 306 0.00% 59 344 0.00% 60 363 0.00% 61 465 0.00% 62 503 0.00% 63 592 0.00% 64 640 0.00% 65 727 0.00% 66 737 0.00% 67 855 0.00% 68 946 0.00% 69 971 0.00% 70 1251 0.01% 71 1374 0.01% 72 1601 0.01% 73 1768 0.01% 74 2002 0.01% 75 2244 0.01% 76 2585 0.01% 77 2784 0.01% 78 2971 0.02% 79 3202 0.02% 80 3451 0.02% 81 3994 0.02% 82 4487 0.02% 83 5270 0.03% 84 6266 0.03% 85 6908 0.04% 86 7485 0.04% 87 7897 0.04% 88 8358 0.04% 89 9032 0.05% 90 9470 0.05% 91 10200 0.05% 92 10931 0.06% 93 12028 0.06% 94 13120 0.07% 95 13932 0.07% 96 14402 0.07% 97 15396 0.08% 98 15548 0.08% 99 16225 0.08% 100 17037 0.09% 101 17849 0.09% 102 18734 0.10% 103 19752 0.10% 104 20758 0.11% 105 21892 0.11% 106 23081 0.12% 107 23748 0.12% 108 24003 0.12% 109 24870 0.13% 110 25403 0.13% 111 26651 0.14% 112 27084 0.14% 113 27987 0.14% 114 29791 0.15% 115 30538 0.16% 116 31749 0.16% 117 32484 0.17% 118 33282 0.17% 119 33817 0.17% 120 35101 0.18% 121 36298 0.19% 122 37047 0.19% 123 38641 0.20% 124 40421 0.21% 125 41769 0.21% 126 43998 0.23% 127 45819 0.24% 128 48024 0.25% 129 49525 0.25% 130 52133 0.27% 131 54420 0.28% 132 57181 0.29% 133 60864 0.31% 134 65114 0.33% 135 70112 0.36% 136 75339 0.39% 137 81554 0.42% 138 88436 0.45% 139 97954 0.50% 140 107396 0.55% 141 120400 0.62% 142 137283 0.71% 143 158112 0.81% 144 189038 0.97% 145 244011 1.25% 146 292242 1.50% 147 411367 2.12% 148 619158 3.18% 149 1189886 6.12% 150 5109451 26.28% 151 9011560 46.34% 19445820 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.49 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=64.69 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=11 prefix-density=0.61 prefix-fanout=2.7 sequence=GAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=27.43 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.4 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170506 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:42:50 Started mapping on | Feb 13 06:42:51 Finished on | Feb 13 06:45:19 Mapping speed, Million of reads per hour | 473.01 Number of input reads | 19445820 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17996768 Uniquely mapped reads % | 92.55% Average mapped length | 293.43 Number of splices: Total | 17531757 Number of splices: Annotated (sjdb) | 17161103 Number of splices: GT/AG | 17212195 Number of splices: GC/AG | 257542 Number of splices: AT/AC | 10402 Number of splices: Non-canonical | 51618 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 557284 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 147254 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 903643 903643 903643 N_multimapping 557284 557284 557284 N_noFeature 594842 17658136 683730 N_ambiguous 383047 1426 132510 UnstrandedReadsAssigned:17018879 PositiveStrandReadsAssigned:337206 NegativeStrandReadsAssigned:17180528 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170506 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170506-trimmed-pair1.fastq SRR7170506-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,445,820 reads, 17,143,976 reads pseudoaligned [quant] estimated average fragment length: 270.631 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR7170506.ke.tsv 34699 SRR7170506.se.tsv 87100 total ==> SRR7170506.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.37 694 19.162 Potri.005G024800.1.v4.1 1035 765.369 369 23.2739 Potri.004G059700.1.v4.1 961 691.379 1 0.0698229 Potri.007G009000.2.v4.1 1416 1146.37 0 0 Potri.003G141000.2.v4.1 2943 2673.37 1076.77 19.4436 Potri.016G087400.1.v4.1 270 77.7205 1256 780.132 Potri.015G069301.1.v4.1 564 299.353 0 0 Potri.010G195200.1.v4.1 1773 1503.37 109 3.50006 Potri.012G127500.1.v4.1 977 707.374 346 23.6124 ==> SRR7170506.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 614 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 381 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 134 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170506 completed mapping pipeline successfully