Starting /dee2/code/volunteer_pipeline.sh SRR7170507 current disk space = 3052673835008 free memory = 1571754272 SRR7170507 SRAfilesize d67cd2bbac0b32e629c448ac76d15b16 SRR7170507.sra SRR7170507.sra file validated SRR7170507 is paired end SRR7170507 is conventional basespace SRR7170507 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170507_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.278 25.0 18.0 33.0 18.0 33.0 2 23.46475 18.0 18.0 30.0 18.0 33.0 3 26.90975 28.0 25.0 31.0 18.0 33.0 4 30.074 31.0 29.0 33.0 27.0 33.0 5 31.23275 33.0 31.0 33.0 29.0 33.0 6 35.155 37.0 34.0 38.0 29.0 38.0 7 35.65375 38.0 35.0 38.0 31.0 38.0 8 36.5845 38.0 37.0 38.0 34.0 38.0 9 37.16825 38.0 38.0 38.0 36.0 38.0 10-14 36.452600000000004 38.0 37.2 38.0 31.2 38.0 15-19 37.3744 38.0 38.0 38.0 36.8 38.0 20-24 37.4082 38.0 38.0 38.0 37.0 38.0 25-29 36.52605 38.0 37.2 38.0 32.0 38.0 30-34 37.159 38.0 38.0 38.0 36.4 38.0 35-39 37.2565 38.0 38.0 38.0 36.8 38.0 40-44 37.325300000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.304500000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.2302 38.0 38.0 38.0 36.4 38.0 55-59 37.16725 38.0 38.0 38.0 36.0 38.0 60-64 37.136399999999995 38.0 38.0 38.0 36.0 38.0 65-69 37.0304 38.0 38.0 38.0 35.8 38.0 70-74 36.576499999999996 38.0 37.8 38.0 33.6 38.0 75-79 36.8855 38.0 38.0 38.0 35.6 38.0 80-84 36.80165 38.0 38.0 38.0 35.0 38.0 85-89 36.610499999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.56615 38.0 38.0 38.0 34.0 38.0 95-99 36.471799999999995 38.0 37.6 38.0 34.0 38.0 100-104 36.44845 38.0 37.8 38.0 34.0 38.0 105-109 36.3594 38.0 37.6 38.0 33.8 38.0 110-114 36.143649999999994 38.0 37.0 38.0 33.4 38.0 115-119 35.7376 38.0 36.8 38.0 31.8 38.0 120-124 35.661500000000004 38.0 36.4 38.0 31.0 38.0 125-129 35.416900000000005 38.0 36.0 38.0 30.4 38.0 130-134 35.112700000000004 38.0 35.6 38.0 29.2 38.0 135-139 34.4632 38.0 34.8 38.0 24.4 38.0 140-144 34.441950000000006 38.0 35.0 38.0 26.6 38.0 145-149 33.85209999999999 38.0 34.2 38.0 23.4 38.0 150-151 29.606875 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 3.0 20 4.0 21 4.0 22 3.0 23 9.0 24 9.0 25 8.0 26 18.0 27 29.0 28 21.0 29 30.0 30 35.0 31 68.0 32 83.0 33 144.0 34 212.0 35 401.0 36 1143.0 37 1769.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.74574522949975 10.67560598246519 8.406395048994327 44.17225373904074 2 18.602904356534804 13.395092638958436 31.196795192789185 36.80520781171758 3 18.15 20.974999999999998 27.075 33.800000000000004 4 21.3 29.25 23.175 26.275 5 22.275 31.45 24.925 21.349999999999998 6 19.075 36.925000000000004 24.425 19.575 7 13.575000000000001 26.35 42.05 18.025 8 16.175 26.875 30.7 26.25 9 16.825000000000003 25.275 33.7 24.2 10-14 19.325 30.7 26.784999999999997 23.189999999999998 15-19 19.384999999999998 29.345 27.99 23.28 20-24 19.555 29.12 27.815 23.51 25-29 19.215 29.43 27.325 24.03 30-34 19.48 29.15 27.900000000000002 23.47 35-39 19.5 29.459999999999997 27.33 23.71 40-44 19.715 29.565 27.49 23.23 45-49 20.39 28.535 27.62 23.455000000000002 50-54 20.075000000000003 29.165000000000003 26.724999999999998 24.035 55-59 19.650000000000002 28.895 27.615000000000002 23.84 60-64 19.985 28.599999999999998 27.275 24.14 65-69 20.25 28.299999999999997 27.55 23.9 70-74 19.6 28.51 27.529999999999998 24.36 75-79 20.06 28.84 27.389999999999997 23.71 80-84 20.23 28.599999999999998 27.565 23.605 85-89 20.035 29.044999999999998 27.255000000000003 23.665 90-94 20.4 28.435 26.825 24.34 95-99 20.645 28.585 27.515 23.255 100-104 20.41 28.33 27.105 24.154999999999998 105-109 20.06 28.470000000000002 27.650000000000002 23.82 110-114 20.18 28.444999999999997 27.33 24.044999999999998 115-119 20.075000000000003 28.845 27.584999999999997 23.494999999999997 120-124 20.405 28.29 26.765 24.54 125-129 20.580000000000002 28.265 27.134999999999998 24.02 130-134 20.705000000000002 27.889999999999997 27.150000000000002 24.255 135-139 20.355 27.800000000000004 27.41 24.435000000000002 140-144 20.705000000000002 27.584999999999997 27.229999999999997 24.48 145-149 20.215 27.925 27.435 24.425 150-151 20.6125 27.85 26.9625 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 1.0 25 3.0 26 6.5 27 8.5 28 12.5 29 19.0 30 20.5 31 31.0 32 41.0 33 49.0 34 66.0 35 81.0 36 95.5 37 115.0 38 129.5 39 160.5 40 196.0 41 206.5 42 228.0 43 239.5 44 243.0 45 239.0 46 239.5 47 256.0 48 240.0 49 217.5 50 198.5 51 158.0 52 117.5 53 98.0 54 78.0 55 52.0 56 38.0 57 30.0 58 23.0 59 18.0 60 11.5 61 7.0 62 6.0 63 3.5 64 1.5 65 1.5 66 2.0 67 1.5 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19253091092607 98.275 2 0.6813020439061317 1.35 3 0.12616704516780217 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.7000000000000002 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 1.9875 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.8625 0.0 0.0 0.0 0.0 120-121 3.15 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 3.9 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.4625 0.0 0.0 0.0 0.0 132-133 4.7875 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138-139 5.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCAGCC 10 0.0068343505 144.975 7 GCAGCCT 10 0.0068343505 144.975 8 >>END_MODULE SRR7170507 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170507_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8995 33.0 33.0 34.0 32.0 34.0 2 32.965 33.0 33.0 34.0 32.0 34.0 3 32.96425 34.0 33.0 34.0 32.0 34.0 4 32.9395 34.0 33.0 34.0 32.0 34.0 5 32.93175 34.0 33.0 34.0 32.0 34.0 6 37.15475 38.0 38.0 38.0 37.0 38.0 7 37.164 38.0 38.0 38.0 37.0 38.0 8 37.11275 38.0 38.0 38.0 37.0 38.0 9 37.176 38.0 38.0 38.0 37.0 38.0 10-14 37.034800000000004 38.0 38.0 38.0 36.8 38.0 15-19 36.98635 38.0 38.0 38.0 36.8 38.0 20-24 36.9163 38.0 38.0 38.0 36.2 38.0 25-29 36.89775 38.0 38.0 38.0 36.4 38.0 30-34 37.00675 38.0 38.0 38.0 37.0 38.0 35-39 36.988350000000004 38.0 38.0 38.0 36.4 38.0 40-44 36.96325 38.0 38.0 38.0 36.2 38.0 45-49 36.82215 38.0 38.0 38.0 36.0 38.0 50-54 36.63655 38.0 38.0 38.0 35.2 38.0 55-59 36.71035 38.0 38.0 38.0 35.6 38.0 60-64 36.305699999999995 38.0 37.6 38.0 33.6 38.0 65-69 36.62925 38.0 38.0 38.0 35.0 38.0 70-74 36.2556 38.0 38.0 38.0 33.8 38.0 75-79 36.443349999999995 38.0 38.0 38.0 34.4 38.0 80-84 35.77034999999999 38.0 36.8 38.0 29.4 38.0 85-89 35.080200000000005 38.0 36.0 38.0 27.2 38.0 90-94 36.19825 38.0 37.6 38.0 33.4 38.0 95-99 36.172 38.0 38.0 38.0 33.8 38.0 100-104 35.83205 38.0 37.4 38.0 30.2 38.0 105-109 35.4188 38.0 36.4 38.0 29.8 38.0 110-114 35.3091 38.0 36.2 38.0 28.2 38.0 115-119 35.426550000000006 38.0 36.6 38.0 30.2 38.0 120-124 35.25045 38.0 36.4 38.0 29.4 38.0 125-129 34.96465 38.0 35.8 38.0 28.2 38.0 130-134 34.27055 38.0 34.0 38.0 24.8 38.0 135-139 34.2367 38.0 33.6 38.0 25.4 38.0 140-144 33.30395 38.0 33.0 38.0 19.8 38.0 145-149 32.274049999999995 38.0 33.0 38.0 11.0 38.0 150-151 27.151875 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 6.0 4 3.0 5 3.0 6 0.0 7 2.0 8 1.0 9 1.0 10 3.0 11 2.0 12 2.0 13 0.0 14 0.0 15 2.0 16 0.0 17 6.0 18 4.0 19 4.0 20 5.0 21 9.0 22 8.0 23 12.0 24 6.0 25 16.0 26 19.0 27 26.0 28 39.0 29 45.0 30 58.0 31 78.0 32 89.0 33 111.0 34 188.0 35 379.0 36 814.0 37 2047.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.0 21.425 14.399999999999999 25.174999999999997 2 25.775 25.95 30.375000000000004 17.9 3 20.65 27.750000000000004 32.175 19.425 4 23.974999999999998 34.325 22.45 19.25 5 24.15 35.775 23.125 16.950000000000003 6 20.825 36.675000000000004 23.525 18.975 7 20.474999999999998 21.725 37.8 20.0 8 22.275 25.074999999999996 27.825 24.825 9 21.9 26.125 30.4 21.575 10-14 23.97 28.005000000000003 26.779999999999998 21.245 15-19 22.99 28.199999999999996 28.044999999999998 20.765 20-24 23.244999999999997 28.035 27.855 20.865000000000002 25-29 23.205000000000002 28.09 27.765 20.94 30-34 23.09 28.035 28.49 20.385 35-39 23.119999999999997 27.93 27.800000000000004 21.15 40-44 23.735 28.155 27.375 20.735 45-49 23.435 27.61 27.834999999999997 21.12 50-54 23.32 27.91 27.639999999999997 21.13 55-59 24.05 27.675 27.66 20.615 60-64 23.64 28.15 27.295 20.915 65-69 23.41 27.575 27.71 21.305 70-74 23.54 27.250000000000004 27.755000000000003 21.455 75-79 23.49 27.215 27.87 21.425 80-84 23.43617180859043 28.23141157057853 27.44637231861593 20.88604430221511 85-89 23.935000000000002 28.165000000000003 27.325 20.575 90-94 23.69 28.17 27.555000000000003 20.585 95-99 24.21 27.49 27.975 20.325 100-104 24.07 27.01 27.900000000000002 21.02 105-109 23.585 27.474999999999998 28.22 20.72 110-114 24.325 27.42 27.6 20.655 115-119 23.855 28.02 27.38 20.745 120-124 24.255 28.27 27.21 20.265 125-129 24.38 28.08 27.465 20.075000000000003 130-134 25.019999999999996 27.87 27.29 19.82 135-139 24.365000000000002 28.155 27.985 19.495 140-144 24.955 27.62 27.68 19.744999999999997 145-149 25.15 27.839999999999996 27.639999999999997 19.37 150-151 25.4625 27.224999999999998 27.725 19.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 0.5 23 0.0 24 0.5 25 3.0 26 3.5 27 3.5 28 7.0 29 7.0 30 6.0 31 13.0 32 22.5 33 32.0 34 50.5 35 65.5 36 76.0 37 95.0 38 119.0 39 150.0 40 188.0 41 215.0 42 258.5 43 282.5 44 269.0 45 262.5 46 264.5 47 261.0 48 254.0 49 227.0 50 189.5 51 161.5 52 127.0 53 96.0 54 73.0 55 57.5 56 37.5 57 26.0 58 22.0 59 18.5 60 14.0 61 10.5 62 9.0 63 6.0 64 3.5 65 3.0 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.35167043456417985 0.7000000000000001 3 0.025119316754584273 0.075 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.7625 0.0 0.0 0.0 0.0 120-121 3.0375 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.775 0.0 0.0 0.0 0.0 128-129 4.025 0.0 0.0 0.0 0.0 130-131 4.3125 0.0 0.0 0.0 0.0 132-133 4.6375 0.0 0.0 0.0 0.0 134-135 4.9125 0.0 0.0 0.0 0.0 136-137 5.112500000000001 0.0 0.0 0.0 0.0 138-139 5.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAATA 10 0.006830828 145.0 4 ACAATAG 10 0.006830828 145.0 5 >>END_MODULE Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659968 spots for SRR7170507.sra Written 659968 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra Read 659952 spots for SRR7170507.sra Written 659952 spots for SRR7170507.sra SRR ids: ['SRR7170507.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_71z2brpi SRR7170507.sra spots: 13199056 blocks: [[1, 659952], [659953, 1319904], [1319905, 1979856], [1979857, 2639808], [2639809, 3299760], [3299761, 3959712], [3959713, 4619664], [4619665, 5279616], [5279617, 5939568], [5939569, 6599520], [6599521, 7259472], [7259473, 7919424], [7919425, 8579376], [8579377, 9239328], [9239329, 9899280], [9899281, 10559232], [10559233, 11219184], [11219185, 11879136], [11879137, 12539088], [12539089, 13199056]] SRR7170507 file size 4451026 SRR7170507 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170507 SRR7170507_1.fastq SRR7170507_2.fastq Input file: SRR7170507_1.fastq Paired file: SRR7170507_2.fastq trimmed: SRR7170507-trimmed-pair1.fastq, SRR7170507-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:14:31 2025 >> started Thu Feb 13 09:19:36 2025 >> done (304.924s) 13199056 read pairs processed; of these: 16610 ( 0.13%) short read pairs filtered out after trimming by size control 16029 ( 0.12%) empty read pairs filtered out after trimming by size control 13166417 (99.75%) read pairs available; of these: 7300227 (55.45%) trimmed read pairs available after processing 5866190 (44.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 1 0.00% 26 1 0.00% 27 2 0.00% 28 7 0.00% 29 5 0.00% 30 6 0.00% 31 5 0.00% 32 10 0.00% 33 4 0.00% 34 6 0.00% 35 5 0.00% 36 7 0.00% 37 14 0.00% 38 16 0.00% 39 15 0.00% 40 17 0.00% 41 23 0.00% 42 21 0.00% 43 30 0.00% 44 26 0.00% 45 30 0.00% 46 34 0.00% 47 46 0.00% 48 48 0.00% 49 70 0.00% 50 68 0.00% 51 95 0.00% 52 117 0.00% 53 124 0.00% 54 131 0.00% 55 120 0.00% 56 138 0.00% 57 158 0.00% 58 215 0.00% 59 229 0.00% 60 295 0.00% 61 284 0.00% 62 343 0.00% 63 371 0.00% 64 414 0.00% 65 487 0.00% 66 504 0.00% 67 579 0.00% 68 657 0.00% 69 693 0.01% 70 841 0.01% 71 953 0.01% 72 1070 0.01% 73 1216 0.01% 74 1409 0.01% 75 1531 0.01% 76 1694 0.01% 77 1912 0.01% 78 1946 0.01% 79 2195 0.02% 80 2482 0.02% 81 2881 0.02% 82 3264 0.02% 83 3651 0.03% 84 4694 0.04% 85 5348 0.04% 86 5451 0.04% 87 5765 0.04% 88 6067 0.05% 89 6575 0.05% 90 6911 0.05% 91 7307 0.06% 92 7848 0.06% 93 8307 0.06% 94 8977 0.07% 95 9887 0.08% 96 10125 0.08% 97 10457 0.08% 98 10739 0.08% 99 11411 0.09% 100 11953 0.09% 101 12452 0.09% 102 13124 0.10% 103 13789 0.10% 104 14427 0.11% 105 15111 0.11% 106 15884 0.12% 107 16185 0.12% 108 16526 0.13% 109 17014 0.13% 110 17283 0.13% 111 18107 0.14% 112 18732 0.14% 113 19301 0.15% 114 19923 0.15% 115 20987 0.16% 116 21409 0.16% 117 21783 0.17% 118 22420 0.17% 119 23077 0.18% 120 23844 0.18% 121 24043 0.18% 122 25078 0.19% 123 26218 0.20% 124 27628 0.21% 125 28326 0.22% 126 29718 0.23% 127 31037 0.24% 128 31999 0.24% 129 33237 0.25% 130 35223 0.27% 131 36454 0.28% 132 38166 0.29% 133 40677 0.31% 134 43843 0.33% 135 46693 0.35% 136 50510 0.38% 137 54332 0.41% 138 59454 0.45% 139 65636 0.50% 140 72525 0.55% 141 82071 0.62% 142 93653 0.71% 143 110448 0.84% 144 133483 1.01% 145 174369 1.32% 146 212440 1.61% 147 300290 2.28% 148 459804 3.49% 149 884638 6.72% 150 3515502 26.70% 151 5866190 44.55% 13166417 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=21 prefix-density=0.62 prefix-fanout=2.1 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=80.20 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.6 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAA criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=27 prefix-density=0.49 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=46.66 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTTGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170507 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:59:23 Started mapping on | Feb 13 09:59:38 Finished on | Feb 13 11:05:39 Mapping speed, Million of reads per hour | 11.97 Number of input reads | 13166417 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12299699 Uniquely mapped reads % | 93.42% Average mapped length | 293.15 Number of splices: Total | 11450639 Number of splices: Annotated (sjdb) | 11205003 Number of splices: GT/AG | 11221133 Number of splices: GC/AG | 188334 Number of splices: AT/AC | 6844 Number of splices: Non-canonical | 34328 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330359 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 49060 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 550939 550939 550939 N_multimapping 330359 330359 330359 N_noFeature 356853 12083686 415017 N_ambiguous 254012 888 95628 UnstrandedReadsAssigned:11688834 PositiveStrandReadsAssigned:215125 NegativeStrandReadsAssigned:11789054 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170507 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170507-trimmed-pair1.fastq SRR7170507-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,166,417 reads, 11,782,785 reads pseudoaligned [quant] estimated average fragment length: 264.724 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR7170507.ke.tsv 34699 SRR7170507.se.tsv 87100 total ==> SRR7170507.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.28 549 23.7875 Potri.005G024800.1.v4.1 1035 771.276 184 18.1335 Potri.004G059700.1.v4.1 961 697.281 16 1.74416 Potri.007G009000.2.v4.1 1416 1152.28 0 0 Potri.003G141000.2.v4.1 2943 2679.28 414 11.7451 Potri.016G087400.1.v4.1 270 77.6364 585 572.75 Potri.015G069301.1.v4.1 564 304.621 0 0 Potri.010G195200.1.v4.1 1773 1509.28 16 0.805797 Potri.012G127500.1.v4.1 977 713.281 164 17.4766 ==> SRR7170507.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 863 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 338 Potri.001G212900.v4.1 61 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR7170507 completed mapping pipeline successfully