Starting /dee2/code/volunteer_pipeline.sh SRR7170508 current disk space = 3052682534912 free memory = 1572683180 SRR7170508 SRAfilesize 974d2baef4764d54481b84050485b75a SRR7170508.sra SRR7170508.sra file validated SRR7170508 is paired end SRR7170508 is conventional basespace SRR7170508 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170508_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.394 27.0 18.0 33.0 18.0 33.0 2 27.147 29.0 25.0 31.0 18.0 33.0 3 29.89375 31.0 29.0 33.0 27.0 33.0 4 31.78025 33.0 31.0 33.0 29.0 33.0 5 32.653 33.0 33.0 33.0 32.0 34.0 6 36.3955 38.0 36.0 38.0 34.0 38.0 7 36.83425 38.0 37.0 38.0 34.0 38.0 8 37.256 38.0 38.0 38.0 36.0 38.0 9 37.4325 38.0 38.0 38.0 37.0 38.0 10-14 37.51025 38.0 38.0 38.0 37.4 38.0 15-19 37.513799999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.603750000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.58865000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.5844 38.0 38.0 38.0 38.0 38.0 35-39 37.5098 38.0 38.0 38.0 37.6 38.0 40-44 37.45945 38.0 38.0 38.0 37.4 38.0 45-49 37.48925 38.0 38.0 38.0 37.4 38.0 50-54 37.3713 38.0 38.0 38.0 37.0 38.0 55-59 37.2861 38.0 38.0 38.0 36.8 38.0 60-64 37.254749999999994 38.0 38.0 38.0 36.4 38.0 65-69 37.188300000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.04365 38.0 38.0 38.0 35.8 38.0 75-79 36.93025 38.0 38.0 38.0 35.6 38.0 80-84 36.852850000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.762299999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.65990000000001 38.0 38.0 38.0 34.4 38.0 95-99 36.56355 38.0 38.0 38.0 34.0 38.0 100-104 36.3673 38.0 37.4 38.0 33.8 38.0 105-109 36.1777 38.0 37.0 38.0 33.6 38.0 110-114 36.00335 38.0 37.0 38.0 33.0 38.0 115-119 35.82445 38.0 36.8 38.0 31.6 38.0 120-124 35.61155 38.0 36.0 38.0 31.0 38.0 125-129 35.2983 38.0 36.0 38.0 30.2 38.0 130-134 34.96974999999999 38.0 35.4 38.0 28.8 38.0 135-139 34.47285 38.0 33.8 38.0 27.2 38.0 140-144 33.64104999999999 38.0 33.0 38.0 22.8 38.0 145-149 32.56005 38.0 33.0 38.0 14.2 38.0 150-151 26.37675 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 0.0 18 5.0 19 8.0 20 3.0 21 3.0 22 7.0 23 7.0 24 5.0 25 12.0 26 11.0 27 11.0 28 19.0 29 16.0 30 39.0 31 48.0 32 78.0 33 125.0 34 195.0 35 389.0 36 1183.0 37 1829.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.506493506493506 10.909090909090908 9.402597402597403 44.18181818181818 2 20.25 15.275 32.775 31.7 3 18.475 19.175 26.775 35.575 4 22.375 28.025 21.575 28.025 5 22.0 33.225 24.325 20.45 6 19.625 35.125 24.625 20.625 7 14.325 25.95 41.875 17.849999999999998 8 17.05 26.75 31.724999999999998 24.474999999999998 9 16.925 26.075 33.125 23.875 10-14 19.189999999999998 30.325000000000003 27.205000000000002 23.28 15-19 19.794999999999998 29.544999999999998 26.900000000000002 23.76 20-24 19.965 29.09 27.029999999999998 23.915 25-29 19.665 29.04 27.884999999999998 23.41 30-34 19.665 29.099999999999998 26.950000000000003 24.285 35-39 19.275000000000002 28.999999999999996 27.634999999999998 24.09 40-44 20.405 29.13 27.1 23.365 45-49 19.68 29.07 27.185 24.065 50-54 19.665 28.255000000000003 28.294999999999998 23.785 55-59 19.645000000000003 28.43 27.825 24.099999999999998 60-64 20.025000000000002 28.59 27.700000000000003 23.685000000000002 65-69 19.91 27.860000000000003 28.125 24.104999999999997 70-74 20.415 28.775000000000002 27.245 23.565 75-79 19.994999999999997 28.505000000000003 28.33 23.169999999999998 80-84 20.135 28.77 27.575 23.52 85-89 19.6 29.049999999999997 27.37 23.98 90-94 20.1 28.110000000000003 28.065 23.724999999999998 95-99 20.225 27.72 27.955000000000002 24.099999999999998 100-104 20.585 28.875 26.795 23.745 105-109 20.525 28.505000000000003 27.41 23.56 110-114 20.14 28.21 27.315 24.335 115-119 20.365 28.625 27.785 23.225 120-124 20.335 28.694999999999997 26.889999999999997 24.08 125-129 21.060000000000002 28.01 27.065 23.865 130-134 20.66 28.444999999999997 27.26 23.635 135-139 20.205000000000002 28.625 26.924999999999997 24.245 140-144 20.695 28.444999999999997 26.674999999999997 24.185000000000002 145-149 20.794999999999998 28.544999999999998 26.76 23.9 150-151 20.7125 27.925 27.175 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 2.0 25 5.5 26 5.0 27 5.0 28 8.0 29 12.5 30 18.5 31 30.5 32 41.5 33 49.5 34 64.5 35 86.0 36 109.0 37 120.0 38 136.0 39 162.0 40 187.0 41 217.0 42 225.0 43 230.0 44 245.5 45 260.0 46 263.5 47 239.0 48 214.0 49 204.5 50 187.0 51 152.0 52 120.0 53 95.5 54 73.5 55 55.0 56 46.5 57 38.0 58 26.0 59 19.0 60 11.5 61 8.0 62 9.5 63 5.5 64 2.5 65 2.0 66 2.0 67 1.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08883826879271 97.875 2 0.759301442672741 1.5 3 0.10124019235636549 0.3 4 0.02531004808909137 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02531004808909137 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 19 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 1.8250000000000002 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.1625 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.6625 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.4749999999999996 0.0 0.0 0.0 0.0 120-121 3.725 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.4125 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 4.9875 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.5375 0.0 0.0 0.0 0.0 134-135 5.85 0.0 0.0 0.0 0.0 136-137 6.1875 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170508 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170508_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83675 33.0 33.0 34.0 32.0 34.0 2 33.045 34.0 33.0 34.0 32.0 34.0 3 33.02925 34.0 33.0 34.0 32.0 34.0 4 33.0045 34.0 33.0 34.0 32.0 34.0 5 33.005 34.0 33.0 34.0 33.0 34.0 6 37.23125 38.0 38.0 38.0 37.0 38.0 7 37.24975 38.0 38.0 38.0 37.0 38.0 8 37.25875 38.0 38.0 38.0 37.0 38.0 9 37.251 38.0 38.0 38.0 37.0 38.0 10-14 37.2934 38.0 38.0 38.0 37.0 38.0 15-19 37.29685 38.0 38.0 38.0 37.0 38.0 20-24 37.2692 38.0 38.0 38.0 37.0 38.0 25-29 37.211349999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.150999999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.15005 38.0 38.0 38.0 37.0 38.0 40-44 37.2099 38.0 38.0 38.0 37.0 38.0 45-49 37.1139 38.0 38.0 38.0 37.0 38.0 50-54 37.08135 38.0 38.0 38.0 37.0 38.0 55-59 37.081450000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.0012 38.0 38.0 38.0 36.4 38.0 65-69 36.969 38.0 38.0 38.0 36.0 38.0 70-74 36.90775 38.0 38.0 38.0 36.0 38.0 75-79 36.78229999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.64325 38.0 38.0 38.0 35.6 38.0 85-89 36.6093 38.0 38.0 38.0 35.2 38.0 90-94 36.477050000000006 38.0 38.0 38.0 34.6 38.0 95-99 36.407599999999995 38.0 38.0 38.0 34.2 38.0 100-104 36.20675 38.0 38.0 38.0 34.0 38.0 105-109 36.1071 38.0 37.8 38.0 33.6 38.0 110-114 35.8996 38.0 37.4 38.0 33.0 38.0 115-119 35.849650000000004 38.0 37.0 38.0 33.0 38.0 120-124 35.507149999999996 38.0 36.6 38.0 31.4 38.0 125-129 35.1623 38.0 36.0 38.0 30.6 38.0 130-134 34.54215 38.0 35.0 38.0 27.4 38.0 135-139 33.829299999999996 38.0 33.2 38.0 22.8 38.0 140-144 33.20309999999999 38.0 33.0 38.0 18.8 38.0 145-149 32.1488 38.0 33.0 38.0 10.8 38.0 150-151 26.346125 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 2.0 5 1.0 6 0.0 7 1.0 8 1.0 9 2.0 10 3.0 11 2.0 12 2.0 13 5.0 14 2.0 15 1.0 16 1.0 17 7.0 18 3.0 19 10.0 20 10.0 21 8.0 22 4.0 23 6.0 24 9.0 25 12.0 26 10.0 27 24.0 28 23.0 29 23.0 30 40.0 31 51.0 32 85.0 33 100.0 34 141.0 35 289.0 36 784.0 37 2326.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.65348022033049 20.781171757636454 15.42313470205308 28.14221331997997 2 25.75719649561952 27.108886107634543 29.687108886107634 17.4468085106383 3 19.46946946946947 28.928928928928926 32.35735735735736 19.244244244244243 4 22.842131598699027 33.4250688016012 24.39329497122842 19.339504628471353 5 24.912368552829246 35.50325488232349 22.33350025037556 17.250876314471707 6 20.68017004251063 38.20955238809702 23.40585146286572 17.704426106526633 7 19.579894973743436 21.85546386596649 39.23480870217554 19.32983245811453 8 21.380345086271568 25.006251562890725 28.68217054263566 24.93123280820205 9 22.18054513628407 24.831207801950487 30.707676919229808 22.280570142535634 10-14 23.794758951790357 28.485697139427884 25.975195039007804 21.744348869773955 15-19 23.679471788715485 28.216286514605844 27.480992396958783 20.623249299719888 20-24 23.527645734300727 27.9009256942707 27.995996997748314 20.575431573680262 25-29 23.379872891958165 28.33408397137567 27.843667117049492 20.442376019616674 30-34 23.256396134781955 27.802533420117157 28.09292544935663 20.848144995744256 35-39 22.823529411764707 28.360450563204004 27.62453066332916 21.19148936170213 40-44 23.19703718532606 27.97157299434463 28.24182973825134 20.589560082077973 45-49 23.18238679009257 27.46559919939955 27.980985739304476 21.3710282712034 50-54 22.389030676074665 27.64850122604214 28.48921583345844 21.47325226442476 55-59 23.012259194395796 27.47560670502877 28.381285964473356 21.130848136102077 60-64 23.70896717373899 27.782225780624497 27.632105684547636 20.87670136108887 65-69 23.31030339441274 27.55081606087914 27.475718433964154 21.663162110743965 70-74 23.53589499524072 27.944491758929914 27.338309703922647 21.18130354190672 75-79 23.229944380417898 27.62439244375407 27.804780277596837 21.340882898231197 80-84 24.138276553106213 27.935871743486974 27.284569138276556 20.64128256513026 85-89 23.966528035275843 27.38387533196372 28.120458986821667 20.529137645938768 90-94 24.47405329593268 28.255860548988178 27.068723702664798 20.201362452414344 95-99 24.2663995993991 28.13219829744617 26.985478217325987 20.615923885828742 100-104 24.21147491739261 27.70601782317012 27.54580955241814 20.536697707019126 105-109 23.961149494342646 27.58586162010614 27.776108941624113 20.676879943927105 110-114 24.506760140210314 28.11717576364547 27.57135703555333 19.804707060590886 115-119 24.270045575199077 28.231582110482297 27.3401111834527 20.158261130865927 120-124 24.589096011224694 27.956504309480856 27.38023652034476 20.07416315894969 125-129 24.53520420947131 28.13329992483087 27.24630418441493 20.085191681282886 130-134 24.259584064144324 28.128288649461286 27.186168879979956 20.42595840641443 135-139 25.246805311951892 27.667251315459783 27.356552242545728 19.729391130042593 140-144 25.075165363800362 27.881338945680493 27.159751453197035 19.88374423732211 145-149 25.751653638003607 28.24213269192223 26.7989577069553 19.20725596311886 150-151 26.62492172824045 27.426424546023792 27.163431433938634 18.78522229179712 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 3.0 25 4.5 26 4.5 27 3.5 28 4.5 29 9.0 30 15.5 31 24.5 32 28.5 33 28.5 34 47.0 35 68.0 36 83.0 37 107.5 38 139.5 39 158.0 40 186.5 41 215.0 42 242.5 43 255.0 44 257.5 45 270.0 46 262.0 47 247.5 48 231.5 49 216.0 50 191.0 51 151.5 52 116.0 53 97.0 54 81.5 55 68.5 56 48.0 57 30.5 58 28.5 59 23.5 60 14.5 61 10.5 62 7.0 63 4.5 64 3.5 65 2.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.125 3 0.1 4 0.075 5 0.15 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.02 15-19 0.04 20-24 0.075 25-29 0.08499999999999999 30-34 0.135 35-39 0.125 40-44 0.095 45-49 0.075 50-54 0.08499999999999999 55-59 0.075 60-64 0.08 65-69 0.13 70-74 0.19499999999999998 75-79 0.215 80-84 0.2 85-89 0.215 90-94 0.18 95-99 0.15 100-104 0.13 105-109 0.13 110-114 0.15 115-119 0.165 120-124 0.22 125-129 0.22499999999999998 130-134 0.22499999999999998 135-139 0.22499999999999998 140-144 0.22 145-149 0.22 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85350318471338 97.0 2 0.8662420382165605 1.7000000000000002 3 0.12738853503184713 0.375 4 0.05095541401273885 0.2 5 0.05095541401273885 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025477707006369425 0.22499999999999998 >10 0.025477707006369425 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 10 0.25 Illumina Single End PCR Primer 1 (97% over 34bp) AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 1.7999999999999998 0.0 0.0 0.0 0.0 106-107 1.925 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 2.9125 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.45 0.0 0.0 0.0 0.0 120-121 3.7 0.0 0.0 0.0 0.0 122-123 4.0125 0.0 0.0 0.0 0.0 124-125 4.3625 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.237500000000001 0.0 0.0 0.0 0.0 132-133 5.5 0.0 0.0 0.0 0.0 134-135 5.8 0.0 0.0 0.0 0.0 136-137 6.125 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATTGT 10 0.006830828 145.0 4 >>END_MODULE Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656648 spots for SRR7170508.sra Written 656648 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra Read 656632 spots for SRR7170508.sra Written 656632 spots for SRR7170508.sra SRR ids: ['SRR7170508.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_350383xn SRR7170508.sra spots: 13132656 blocks: [[1, 656632], [656633, 1313264], [1313265, 1969896], [1969897, 2626528], [2626529, 3283160], [3283161, 3939792], [3939793, 4596424], [4596425, 5253056], [5253057, 5909688], [5909689, 6566320], [6566321, 7222952], [7222953, 7879584], [7879585, 8536216], [8536217, 9192848], [9192849, 9849480], [9849481, 10506112], [10506113, 11162744], [11162745, 11819376], [11819377, 12476008], [12476009, 13132656]] SRR7170508 file size 4428525 SRR7170508 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170508 SRR7170508_1.fastq SRR7170508_2.fastq Input file: SRR7170508_1.fastq Paired file: SRR7170508_2.fastq trimmed: SRR7170508-trimmed-pair1.fastq, SRR7170508-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:09:00 2025 >> started Thu Feb 13 09:14:26 2025 >> done (326.844s) 13132656 read pairs processed; of these: 18532 ( 0.14%) short read pairs filtered out after trimming by size control 49988 ( 0.38%) empty read pairs filtered out after trimming by size control 13064136 (99.48%) read pairs available; of these: 8189025 (62.68%) trimmed read pairs available after processing 4875111 (37.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 0 0.00% 21 3 0.00% 22 2 0.00% 23 0 0.00% 24 2 0.00% 25 4 0.00% 26 3 0.00% 27 6 0.00% 28 10 0.00% 29 7 0.00% 30 8 0.00% 31 8 0.00% 32 3 0.00% 33 15 0.00% 34 4 0.00% 35 21 0.00% 36 11 0.00% 37 17 0.00% 38 15 0.00% 39 20 0.00% 40 20 0.00% 41 31 0.00% 42 30 0.00% 43 30 0.00% 44 33 0.00% 45 50 0.00% 46 55 0.00% 47 59 0.00% 48 77 0.00% 49 86 0.00% 50 119 0.00% 51 134 0.00% 52 133 0.00% 53 142 0.00% 54 166 0.00% 55 165 0.00% 56 194 0.00% 57 225 0.00% 58 254 0.00% 59 283 0.00% 60 350 0.00% 61 373 0.00% 62 469 0.00% 63 515 0.00% 64 567 0.00% 65 607 0.00% 66 670 0.01% 67 770 0.01% 68 813 0.01% 69 926 0.01% 70 1124 0.01% 71 1243 0.01% 72 1412 0.01% 73 1617 0.01% 74 1828 0.01% 75 1986 0.02% 76 2172 0.02% 77 2449 0.02% 78 2581 0.02% 79 2951 0.02% 80 3317 0.03% 81 3847 0.03% 82 4299 0.03% 83 5051 0.04% 84 6215 0.05% 85 6637 0.05% 86 6711 0.05% 87 6814 0.05% 88 7201 0.06% 89 7553 0.06% 90 7769 0.06% 91 8654 0.07% 92 9229 0.07% 93 9926 0.08% 94 10645 0.08% 95 11569 0.09% 96 11972 0.09% 97 12415 0.10% 98 12714 0.10% 99 13265 0.10% 100 14099 0.11% 101 14366 0.11% 102 15345 0.12% 103 16277 0.12% 104 16942 0.13% 105 17962 0.14% 106 18496 0.14% 107 19005 0.15% 108 19331 0.15% 109 19867 0.15% 110 20322 0.16% 111 19916 0.15% 112 21393 0.16% 113 21735 0.17% 114 22727 0.17% 115 23793 0.18% 116 24671 0.19% 117 25392 0.19% 118 25683 0.20% 119 25678 0.20% 120 26828 0.21% 121 27217 0.21% 122 28508 0.22% 123 29434 0.23% 124 30892 0.24% 125 32282 0.25% 126 33285 0.25% 127 34613 0.26% 128 35816 0.27% 129 37014 0.28% 130 39028 0.30% 131 40519 0.31% 132 43303 0.33% 133 46423 0.36% 134 48738 0.37% 135 52607 0.40% 136 56531 0.43% 137 61352 0.47% 138 67310 0.52% 139 73672 0.56% 140 81816 0.63% 141 93636 0.72% 142 106525 0.82% 143 124197 0.95% 144 152076 1.16% 145 189152 1.45% 146 251269 1.92% 147 360334 2.76% 148 566927 4.34% 149 1100485 8.42% 150 3720560 28.48% 151 4875111 37.32% 13064136 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.68 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=24.70 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.8 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=19 prefix-density=0.57 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=28.83 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.1 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7170508 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:21:53 Started mapping on | Feb 13 10:22:15 Finished on | Feb 13 11:05:40 Mapping speed, Million of reads per hour | 18.05 Number of input reads | 13064136 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11963485 Uniquely mapped reads % | 91.58% Average mapped length | 291.81 Number of splices: Total | 11800328 Number of splices: Annotated (sjdb) | 11521339 Number of splices: GT/AG | 11583018 Number of splices: GC/AG | 172402 Number of splices: AT/AC | 7091 Number of splices: Non-canonical | 37817 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351615 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 48776 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.26% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 758509 758509 758509 N_multimapping 351615 351615 351615 N_noFeature 394194 11716356 451406 N_ambiguous 290652 651 100513 UnstrandedReadsAssigned:11278639 PositiveStrandReadsAssigned:246478 NegativeStrandReadsAssigned:11411566 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170508 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170508-trimmed-pair1.fastq SRR7170508-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,064,136 reads, 11,377,814 reads pseudoaligned [quant] estimated average fragment length: 256.716 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7170508.ke.tsv 34699 SRR7170508.se.tsv 87100 total ==> SRR7170508.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.28 1031 38.8353 Potri.005G024800.1.v4.1 1035 779.284 234 19.9326 Potri.004G059700.1.v4.1 961 705.284 6 0.564718 Potri.007G009000.2.v4.1 1416 1160.28 0 0 Potri.003G141000.2.v4.1 2943 2687.28 559 13.8084 Potri.016G087400.1.v4.1 270 80.4994 1103.77 910.185 Potri.015G069301.1.v4.1 564 311.849 0 0 Potri.010G195200.1.v4.1 1773 1517.28 97 4.24374 Potri.012G127500.1.v4.1 977 721.284 99 9.11115 ==> SRR7170508.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 302 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 281 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 3 SRR7170508 completed mapping pipeline successfully