Starting /dee2/code/volunteer_pipeline.sh SRR7170509 current disk space = 3052624183296 free memory = 1574355060 SRR7170509 SRAfilesize e5e6add3d0ff0207e69f55a9a2d443bb SRR7170509.sra SRR7170509.sra file validated SRR7170509 is paired end SRR7170509 is conventional basespace SRR7170509 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170509_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.271 25.0 18.0 32.0 18.0 33.0 2 22.19725 18.0 18.0 27.0 18.0 33.0 3 26.46775 27.0 25.0 29.0 18.0 31.0 4 29.3355 30.0 28.0 31.0 27.0 33.0 5 31.46225 32.0 32.0 33.0 27.0 33.0 6 36.12475 37.0 36.0 38.0 33.0 38.0 7 36.9695 38.0 37.0 38.0 35.0 38.0 8 37.294 38.0 38.0 38.0 36.0 38.0 9 37.429 38.0 38.0 38.0 37.0 38.0 10-14 37.517250000000004 38.0 38.0 38.0 37.6 38.0 15-19 37.66225 38.0 38.0 38.0 38.0 38.0 20-24 37.666250000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.614799999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.5386 38.0 38.0 38.0 38.0 38.0 35-39 37.53075 38.0 38.0 38.0 38.0 38.0 40-44 37.499900000000004 38.0 38.0 38.0 37.8 38.0 45-49 37.46320000000001 38.0 38.0 38.0 37.2 38.0 50-54 37.3309 38.0 38.0 38.0 37.0 38.0 55-59 37.17215 38.0 38.0 38.0 36.0 38.0 60-64 37.11845 38.0 38.0 38.0 36.0 38.0 65-69 37.064350000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.9731 38.0 38.0 38.0 35.6 38.0 75-79 36.833999999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.69175 38.0 38.0 38.0 34.6 38.0 85-89 36.5593 38.0 38.0 38.0 34.0 38.0 90-94 36.396049999999995 38.0 37.6 38.0 33.8 38.0 95-99 36.372 38.0 37.4 38.0 33.8 38.0 100-104 35.78305 38.0 36.8 38.0 32.0 38.0 105-109 35.84825000000001 38.0 36.8 38.0 31.8 38.0 110-114 35.675149999999995 38.0 36.4 38.0 30.8 38.0 115-119 35.29380000000001 38.0 35.8 38.0 29.6 38.0 120-124 34.9573 38.0 35.2 38.0 28.0 38.0 125-129 34.518649999999994 38.0 34.4 38.0 26.0 38.0 130-134 34.541700000000006 38.0 34.8 38.0 26.4 38.0 135-139 33.787099999999995 38.0 33.4 38.0 23.2 38.0 140-144 33.067750000000004 37.8 32.6 38.0 18.6 38.0 145-149 31.3539 36.0 30.6 38.0 10.8 38.0 150-151 26.95475 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 2.0 12 0.0 13 1.0 14 0.0 15 0.0 16 3.0 17 1.0 18 5.0 19 3.0 20 3.0 21 3.0 22 4.0 23 6.0 24 13.0 25 7.0 26 11.0 27 20.0 28 28.0 29 26.0 30 52.0 31 57.0 32 77.0 33 125.0 34 285.0 35 588.0 36 1454.0 37 1223.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.54691894656098 8.82127333162874 8.309895167476348 31.32191255433393 2 26.424999999999997 10.674999999999999 36.675000000000004 26.224999999999998 3 20.1 18.375 25.174999999999997 36.35 4 22.15 27.3 23.95 26.6 5 23.05 31.025000000000002 25.0 20.925 6 19.400000000000002 34.725 25.624999999999996 20.25 7 14.224999999999998 25.674999999999997 42.75 17.349999999999998 8 17.7 26.3 30.7 25.3 9 16.675 24.6 34.2 24.525 10-14 19.48 30.125 27.24 23.155 15-19 19.55 28.965000000000003 28.075 23.41 20-24 19.445 29.104999999999997 27.935 23.515 25-29 19.37 28.73 28.28 23.62 30-34 19.96 28.549999999999997 28.12 23.369999999999997 35-39 19.455 29.225 27.875 23.445 40-44 19.71 29.215000000000003 27.975 23.1 45-49 19.470000000000002 28.660000000000004 27.944999999999997 23.925 50-54 20.03 29.575000000000003 27.125 23.27 55-59 20.27 29.12 27.755000000000003 22.855 60-64 20.125 28.125 28.055000000000003 23.695 65-69 19.994999999999997 28.715000000000003 27.54 23.75 70-74 20.09 28.68 27.694999999999997 23.535 75-79 20.18 29.07 27.275 23.474999999999998 80-84 19.655982799139956 29.04645232261613 28.026401320066004 23.27116355817791 85-89 20.51 28.939999999999998 27.839999999999996 22.71 90-94 20.225 28.199999999999996 28.4 23.175 95-99 19.785 28.655 28.395 23.165 100-104 20.36 28.59 27.38 23.669999999999998 105-109 20.255000000000003 28.83 27.675 23.24 110-114 19.78 27.985 28.360000000000003 23.875 115-119 20.150000000000002 28.435 27.860000000000003 23.555 120-124 19.64 28.84 27.485 24.035 125-129 20.93 28.95 27.1 23.02 130-134 20.13 29.044999999999998 27.445000000000004 23.380000000000003 135-139 20.775 28.73 27.305 23.189999999999998 140-144 20.62 27.82 27.775 23.785 145-149 20.155 28.155 27.43 24.26 150-151 19.8125 27.950000000000003 27.875 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 2.0 23 2.0 24 2.0 25 3.5 26 4.0 27 7.0 28 9.0 29 13.0 30 21.5 31 24.5 32 31.5 33 56.5 34 73.0 35 75.0 36 94.5 37 133.5 38 158.0 39 172.5 40 194.5 41 224.0 42 235.5 43 239.5 44 265.5 45 279.5 46 261.5 47 229.5 48 222.0 49 211.5 50 169.0 51 132.5 52 114.0 53 78.5 54 55.0 55 53.5 56 41.0 57 29.5 58 26.0 59 20.5 60 10.0 61 7.0 62 4.5 63 2.5 64 3.0 65 1.5 66 0.5 67 1.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0125 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.1375 0.0 0.0 0.025 0.0 88-89 0.225 0.0 0.0 0.025 0.0 90-91 0.36250000000000004 0.0 0.0 0.025 0.0 92-93 0.4 0.0 0.0 0.025 0.0 94-95 0.425 0.0 0.0 0.025 0.0 96-97 0.55 0.0 0.0 0.025 0.0 98-99 0.725 0.0 0.0 0.025 0.0 100-101 0.8125 0.0 0.0 0.025 0.0 102-103 0.8875 0.0 0.0 0.025 0.0 104-105 0.9874999999999999 0.0 0.0 0.025 0.0 106-107 1.225 0.0 0.0 0.025 0.0 108-109 1.4 0.0 0.0 0.025 0.0 110-111 1.55 0.0 0.0 0.025 0.0 112-113 1.7375 0.0 0.0 0.025 0.0 114-115 1.9625 0.0 0.0 0.025 0.0 116-117 2.3 0.0 0.0 0.025 0.0 118-119 2.4625 0.0 0.0 0.025 0.0 120-121 2.7249999999999996 0.0 0.0 0.025 0.0 122-123 3.0625 0.0 0.0 0.025 0.0 124-125 3.2375 0.0 0.0 0.025 0.0 126-127 3.4625 0.0 0.0 0.025 0.0 128-129 3.75 0.0 0.0 0.025 0.0 130-131 3.9625 0.025 0.0 0.025 0.0 132-133 4.125 0.025 0.0 0.025 0.0 134-135 4.325 0.025 0.0 0.025 0.0 136-137 4.575 0.025 0.0 0.025 0.0 138-139 4.9 0.025 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACTTCT 10 0.006836113 144.9625 4 >>END_MODULE SRR7170509 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170509_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.018 33.0 33.0 34.0 32.0 34.0 2 33.0995 34.0 33.0 34.0 33.0 34.0 3 33.133 34.0 33.0 34.0 33.0 34.0 4 33.061 34.0 33.0 34.0 33.0 34.0 5 33.10225 34.0 33.0 34.0 33.0 34.0 6 37.232 38.0 38.0 38.0 37.0 38.0 7 37.25275 38.0 38.0 38.0 37.0 38.0 8 37.261 38.0 38.0 38.0 37.0 38.0 9 37.28575 38.0 38.0 38.0 37.0 38.0 10-14 37.257349999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.1844 38.0 38.0 38.0 37.0 38.0 20-24 37.2025 38.0 38.0 38.0 37.0 38.0 25-29 37.2014 38.0 38.0 38.0 37.0 38.0 30-34 37.17965 38.0 38.0 38.0 37.0 38.0 35-39 37.147800000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.11965 38.0 38.0 38.0 37.0 38.0 45-49 37.0843 38.0 38.0 38.0 36.8 38.0 50-54 37.0601 38.0 38.0 38.0 36.8 38.0 55-59 36.988899999999994 38.0 38.0 38.0 36.2 38.0 60-64 36.928450000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.9133 38.0 38.0 38.0 36.0 38.0 70-74 36.87755000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.7979 38.0 38.0 38.0 35.8 38.0 80-84 36.68655 38.0 38.0 38.0 35.0 38.0 85-89 36.381249999999994 38.0 37.8 38.0 34.0 38.0 90-94 36.339150000000004 38.0 37.8 38.0 33.8 38.0 95-99 36.17915000000001 38.0 37.8 38.0 33.4 38.0 100-104 36.14575 38.0 37.4 38.0 33.8 38.0 105-109 36.044599999999996 38.0 37.4 38.0 33.4 38.0 110-114 35.895050000000005 38.0 37.0 38.0 32.2 38.0 115-119 35.71509999999999 38.0 37.0 38.0 31.8 38.0 120-124 35.4276 38.0 36.0 38.0 31.0 38.0 125-129 34.92985 38.0 36.0 38.0 28.8 38.0 130-134 34.42635 38.0 34.2 38.0 26.0 38.0 135-139 33.72705 38.0 33.0 38.0 22.8 38.0 140-144 32.9568 38.0 33.0 38.0 18.0 38.0 145-149 31.999000000000002 38.0 33.0 38.0 10.6 38.0 150-151 26.143375 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 3.0 6 0.0 7 1.0 8 1.0 9 0.0 10 4.0 11 1.0 12 3.0 13 1.0 14 0.0 15 2.0 16 3.0 17 6.0 18 9.0 19 9.0 20 6.0 21 11.0 22 13.0 23 9.0 24 9.0 25 19.0 26 22.0 27 19.0 28 20.0 29 32.0 30 39.0 31 49.0 32 60.0 33 102.0 34 189.0 35 308.0 36 870.0 37 2174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.825 19.75 14.45 28.975 2 24.4 25.974999999999998 32.074999999999996 17.549999999999997 3 20.4 28.475 31.85 19.275000000000002 4 23.549999999999997 34.0 23.45 19.0 5 24.25 36.199999999999996 22.2 17.349999999999998 6 19.725 38.0 25.2 17.075000000000003 7 19.675 19.975 40.1 20.25 8 20.424999999999997 24.4 29.725 25.45 9 22.1 25.0 30.0 22.900000000000002 10-14 22.95 28.76 27.250000000000004 21.04 15-19 22.88 28.065 28.144999999999996 20.91 20-24 22.625 28.645 28.42 20.31 25-29 22.59 28.33 28.12 20.96 30-34 22.335 28.275 28.77 20.62 35-39 23.24 28.34 27.88 20.54 40-44 22.605 27.834999999999997 28.610000000000003 20.95 45-49 22.645 28.09 28.34 20.925 50-54 22.56 28.625 28.084999999999997 20.73 55-59 22.835 27.55 28.355000000000004 21.26 60-64 23.625 27.195000000000004 28.29 20.89 65-69 23.035 28.26 27.779999999999998 20.925 70-74 22.825 28.52 28.02 20.635 75-79 23.02 28.09 28.255000000000003 20.635 80-84 23.555 27.87 27.575 21.0 85-89 23.549999999999997 28.535 27.605 20.31 90-94 23.61 27.905 28.444999999999997 20.04 95-99 23.71 28.055000000000003 27.845 20.39 100-104 23.95 28.265 27.810000000000002 19.975 105-109 23.715 28.299999999999997 27.76 20.225 110-114 23.91 28.37 27.935 19.785 115-119 23.91 28.59 27.76 19.74 120-124 23.925 28.449999999999996 27.689999999999998 19.935 125-129 23.965 28.470000000000002 27.27 20.294999999999998 130-134 24.455 27.785 28.005000000000003 19.755 135-139 24.26 27.900000000000002 27.860000000000003 19.98 140-144 24.44 27.85 27.72 19.99 145-149 24.615000000000002 28.294999999999998 27.05 20.04 150-151 24.85 27.487499999999997 26.6125 21.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 2.5 24 4.0 25 5.5 26 3.5 27 4.0 28 6.0 29 9.5 30 18.0 31 24.0 32 25.0 33 39.5 34 58.0 35 68.0 36 84.5 37 116.0 38 143.5 39 174.0 40 206.5 41 238.0 42 267.0 43 279.5 44 289.5 45 284.5 46 261.5 47 234.5 48 213.5 49 194.5 50 172.5 51 132.5 52 99.5 53 75.5 54 58.5 55 56.0 56 45.5 57 32.0 58 19.5 59 12.0 60 7.5 61 8.5 62 8.0 63 3.5 64 1.5 65 0.5 66 2.0 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44598337950139 98.725 2 0.45328632586250317 0.8999999999999999 3 0.07554772097708386 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.02518257365902795 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4249999999999998 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.575 0.0 0.0 0.0 0.0 128-129 3.85 0.0 0.0 0.0 0.0 130-131 4.0875 0.0 0.0 0.0 0.0 132-133 4.25 0.0 0.0 0.0 0.0 134-135 4.45 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAATT 10 0.006830828 145.0 6 CAGAGAA 10 0.006830828 145.0 4 >>END_MODULE Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644516 spots for SRR7170509.sra Written 644516 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra Read 644506 spots for SRR7170509.sra Written 644506 spots for SRR7170509.sra SRR ids: ['SRR7170509.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g79ao5c9 SRR7170509.sra spots: 12890130 blocks: [[1, 644506], [644507, 1289012], [1289013, 1933518], [1933519, 2578024], [2578025, 3222530], [3222531, 3867036], [3867037, 4511542], [4511543, 5156048], [5156049, 5800554], [5800555, 6445060], [6445061, 7089566], [7089567, 7734072], [7734073, 8378578], [8378579, 9023084], [9023085, 9667590], [9667591, 10312096], [10312097, 10956602], [10956603, 11601108], [11601109, 12245614], [12245615, 12890130]] SRR7170509 file size 4346341 SRR7170509 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170509 SRR7170509_1.fastq SRR7170509_2.fastq Input file: SRR7170509_1.fastq Paired file: SRR7170509_2.fastq trimmed: SRR7170509-trimmed-pair1.fastq, SRR7170509-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 08:48:26 2025 >> started Thu Feb 13 08:59:01 2025 >> done (635.568s) 12890130 read pairs processed; of these: 14276 ( 0.11%) short read pairs filtered out after trimming by size control 17056 ( 0.13%) empty read pairs filtered out after trimming by size control 12858798 (99.76%) read pairs available; of these: 8086742 (62.89%) trimmed read pairs available after processing 4772056 (37.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 2 0.00% 21 3 0.00% 22 2 0.00% 23 1 0.00% 24 5 0.00% 25 3 0.00% 26 2 0.00% 27 5 0.00% 28 2 0.00% 29 5 0.00% 30 3 0.00% 31 9 0.00% 32 5 0.00% 33 5 0.00% 34 6 0.00% 35 7 0.00% 36 12 0.00% 37 11 0.00% 38 12 0.00% 39 13 0.00% 40 24 0.00% 41 19 0.00% 42 17 0.00% 43 28 0.00% 44 27 0.00% 45 30 0.00% 46 37 0.00% 47 41 0.00% 48 56 0.00% 49 71 0.00% 50 66 0.00% 51 101 0.00% 52 105 0.00% 53 106 0.00% 54 116 0.00% 55 116 0.00% 56 158 0.00% 57 156 0.00% 58 165 0.00% 59 207 0.00% 60 251 0.00% 61 307 0.00% 62 342 0.00% 63 391 0.00% 64 428 0.00% 65 474 0.00% 66 503 0.00% 67 541 0.00% 68 617 0.00% 69 676 0.01% 70 796 0.01% 71 897 0.01% 72 1053 0.01% 73 1157 0.01% 74 1333 0.01% 75 1463 0.01% 76 1602 0.01% 77 1745 0.01% 78 1919 0.01% 79 2114 0.02% 80 2334 0.02% 81 2764 0.02% 82 3123 0.02% 83 3672 0.03% 84 4410 0.03% 85 4782 0.04% 86 5137 0.04% 87 5097 0.04% 88 5310 0.04% 89 5640 0.04% 90 5929 0.05% 91 6380 0.05% 92 6847 0.05% 93 7499 0.06% 94 7907 0.06% 95 8698 0.07% 96 8885 0.07% 97 9031 0.07% 98 9312 0.07% 99 9983 0.08% 100 10412 0.08% 101 10715 0.08% 102 11396 0.09% 103 11947 0.09% 104 12490 0.10% 105 13229 0.10% 106 14146 0.11% 107 14048 0.11% 108 14413 0.11% 109 14675 0.11% 110 15147 0.12% 111 15536 0.12% 112 16059 0.12% 113 16618 0.13% 114 17327 0.13% 115 18248 0.14% 116 18893 0.15% 117 19277 0.15% 118 19670 0.15% 119 20440 0.16% 120 21009 0.16% 121 21892 0.17% 122 22959 0.18% 123 23774 0.18% 124 25126 0.20% 125 26413 0.21% 126 27605 0.21% 127 29143 0.23% 128 30493 0.24% 129 32335 0.25% 130 34336 0.27% 131 36290 0.28% 132 38902 0.30% 133 42295 0.33% 134 45462 0.35% 135 49461 0.38% 136 54866 0.43% 137 60584 0.47% 138 67063 0.52% 139 75522 0.59% 140 85866 0.67% 141 98423 0.77% 142 113847 0.89% 143 134609 1.05% 144 163387 1.27% 145 205880 1.60% 146 272169 2.12% 147 386431 3.01% 148 605823 4.71% 149 1171509 9.11% 150 3635470 28.27% 151 4772056 37.11% 12858798 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=29 prefix-density=0.33 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=248.09 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=27 prefix-density=0.46 prefix-fanout=2.1 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=29.20 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=10.4 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170509 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:19:13 Started mapping on | Feb 13 10:19:34 Finished on | Feb 13 11:05:40 Mapping speed, Million of reads per hour | 16.74 Number of input reads | 12858798 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12041480 Uniquely mapped reads % | 93.64% Average mapped length | 293.05 Number of splices: Total | 11573916 Number of splices: Annotated (sjdb) | 11287337 Number of splices: GT/AG | 11359454 Number of splices: GC/AG | 170578 Number of splices: AT/AC | 7397 Number of splices: Non-canonical | 36487 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354166 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 59558 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.05% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 472964 472964 472964 N_multimapping 354166 354166 354166 N_noFeature 490320 11820520 556134 N_ambiguous 248102 838 92513 UnstrandedReadsAssigned:11303058 PositiveStrandReadsAssigned:220122 NegativeStrandReadsAssigned:11392833 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170509 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170509-trimmed-pair1.fastq SRR7170509-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,858,798 reads, 11,343,113 reads pseudoaligned [quant] estimated average fragment length: 279.853 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7170509.ke.tsv 34699 SRR7170509.se.tsv 87100 total ==> SRR7170509.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.15 756 33.1085 Potri.005G024800.1.v4.1 1035 756.147 283 28.5058 Potri.004G059700.1.v4.1 961 682.169 1 0.111651 Potri.007G009000.2.v4.1 1416 1137.15 0 0 Potri.003G141000.2.v4.1 2943 2664.15 566.34 16.1909 Potri.016G087400.1.v4.1 270 75.4265 590 595.774 Potri.015G069301.1.v4.1 564 290.869 0 0 Potri.010G195200.1.v4.1 1773 1494.15 171 8.71679 Potri.012G127500.1.v4.1 977 698.169 169 18.4366 ==> SRR7170509.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1192 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 15 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170509 completed mapping pipeline successfully