Starting /dee2/code/volunteer_pipeline.sh SRR7170510 current disk space = 3052670029824 free memory = 1579499844 SRR7170510 SRAfilesize 2449926fe3d3b87d9146829df1dddea4 SRR7170510.sra SRR7170510.sra file validated SRR7170510 is paired end SRR7170510 is conventional basespace SRR7170510 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170510_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.8705 18.0 18.0 30.0 18.0 32.0 2 30.80425 31.0 30.0 33.0 27.0 33.0 3 31.288 33.0 31.0 33.0 28.0 33.0 4 32.295 33.0 33.0 33.0 31.0 33.0 5 32.91275 33.0 33.0 33.0 32.0 34.0 6 37.10275 38.0 37.0 38.0 36.0 38.0 7 37.399 38.0 38.0 38.0 37.0 38.0 8 37.50675 38.0 38.0 38.0 37.0 38.0 9 37.60525 38.0 38.0 38.0 38.0 38.0 10-14 37.5814 38.0 38.0 38.0 37.6 38.0 15-19 37.5531 38.0 38.0 38.0 37.4 38.0 20-24 37.59394999999999 38.0 38.0 38.0 37.8 38.0 25-29 37.5601 38.0 38.0 38.0 37.8 38.0 30-34 37.522499999999994 38.0 38.0 38.0 37.4 38.0 35-39 37.5207 38.0 38.0 38.0 37.4 38.0 40-44 37.487 38.0 38.0 38.0 37.0 38.0 45-49 37.4486 38.0 38.0 38.0 37.0 38.0 50-54 37.26695 38.0 38.0 38.0 36.4 38.0 55-59 37.0668 38.0 38.0 38.0 36.0 38.0 60-64 37.01875 38.0 38.0 38.0 35.6 38.0 65-69 36.82075 38.0 38.0 38.0 35.0 38.0 70-74 36.78445 38.0 38.0 38.0 34.6 38.0 75-79 36.6781 38.0 38.0 38.0 34.0 38.0 80-84 36.477700000000006 38.0 37.4 38.0 34.0 38.0 85-89 36.3652 38.0 37.0 38.0 33.6 38.0 90-94 36.2142 38.0 37.0 38.0 33.2 38.0 95-99 36.053 38.0 37.0 38.0 32.6 38.0 100-104 35.3509 38.0 36.0 38.0 28.6 38.0 105-109 35.4831 38.0 36.0 38.0 30.6 38.0 110-114 35.2373 38.0 35.8 38.0 28.8 38.0 115-119 34.80775 38.0 35.0 38.0 27.4 38.0 120-124 34.39275 38.0 34.2 38.0 24.4 38.0 125-129 33.95055 38.0 34.0 38.0 22.8 38.0 130-134 33.86195 38.0 34.0 38.0 23.2 38.0 135-139 32.963150000000006 37.6 32.6 38.0 18.6 38.0 140-144 32.0415 36.4 31.0 38.0 14.0 38.0 145-149 30.16415 35.0 29.0 38.0 10.8 38.0 150-151 25.668125 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 2.0 19 2.0 20 0.0 21 3.0 22 8.0 23 6.0 24 6.0 25 19.0 26 15.0 27 20.0 28 34.0 29 31.0 30 64.0 31 67.0 32 118.0 33 189.0 34 298.0 35 667.0 36 1363.0 37 1081.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.91752577319588 10.541237113402062 11.70103092783505 43.84020618556701 2 21.349999999999998 15.45 35.875 27.325 3 19.825 20.3 25.424999999999997 34.449999999999996 4 23.025000000000002 28.325 23.075000000000003 25.575 5 23.95 31.900000000000002 24.224999999999998 19.925 6 18.25 36.3 25.324999999999996 20.125 7 13.4 25.650000000000002 43.9 17.05 8 17.75 24.375 31.65 26.224999999999998 9 16.875 23.75 35.05 24.325 10-14 19.115 29.82 28.035 23.03 15-19 19.35 28.57 28.7 23.380000000000003 20-24 19.715 28.865000000000002 27.950000000000003 23.47 25-29 19.425 29.330000000000002 27.700000000000003 23.544999999999998 30-34 19.305 28.26 28.965000000000003 23.47 35-39 19.96 28.95 27.77 23.32 40-44 19.74 29.12 28.065 23.075000000000003 45-49 19.825 28.83 27.6 23.745 50-54 19.215 28.83 28.65 23.305 55-59 19.759999999999998 28.575 28.51 23.155 60-64 19.68 29.104999999999997 27.96 23.255 65-69 19.7 28.660000000000004 27.950000000000003 23.69 70-74 19.52 28.46 28.18 23.84 75-79 19.29 28.610000000000003 28.83 23.27 80-84 19.27596379818991 29.176458822941147 27.711385569278463 23.836191809590478 85-89 19.72 28.199999999999996 28.235 23.845 90-94 19.755 28.77 27.88 23.595 95-99 19.650000000000002 29.53 27.16 23.66 100-104 19.535 29.185 27.534999999999997 23.745 105-109 20.275000000000002 28.715000000000003 27.705000000000002 23.305 110-114 19.71 28.799999999999997 27.439999999999998 24.05 115-119 20.39 28.555000000000003 27.96 23.095 120-124 20.005 28.299999999999997 27.634999999999998 24.060000000000002 125-129 20.39 28.335 28.015 23.26 130-134 20.06 28.18 27.87 23.89 135-139 20.075000000000003 28.425 27.694999999999997 23.805 140-144 20.61 28.389999999999997 26.979999999999997 24.02 145-149 19.71 28.325 28.02 23.945 150-151 20.05 27.425 28.4125 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 3.5 23 5.0 24 3.5 25 3.0 26 5.0 27 6.0 28 10.5 29 17.0 30 24.5 31 29.0 32 33.5 33 49.5 34 64.5 35 82.5 36 108.5 37 128.5 38 146.5 39 169.5 40 198.0 41 234.0 42 255.0 43 267.5 44 284.0 45 270.0 46 245.5 47 239.5 48 231.5 49 209.5 50 162.0 51 121.0 52 99.0 53 72.0 54 61.0 55 51.5 56 30.5 57 21.0 58 16.0 59 11.5 60 8.5 61 7.0 62 6.0 63 3.0 64 1.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.3770739064856712 0.75 3 0.050276520864756154 0.15 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.475 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.7 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.45 0.0 0.0 0.0 0.0 130-131 3.6624999999999996 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138-139 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGTC 10 0.006836113 144.9625 145 TAATGTT 10 0.006836113 144.9625 2 >>END_MODULE SRR7170510 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170510_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15575 33.0 33.0 34.0 33.0 34.0 2 33.28725 34.0 33.0 34.0 33.0 34.0 3 33.30625 34.0 33.0 34.0 33.0 34.0 4 33.27975 34.0 33.0 34.0 33.0 34.0 5 33.2905 34.0 33.0 34.0 33.0 34.0 6 37.55075 38.0 38.0 38.0 38.0 38.0 7 37.55775 38.0 38.0 38.0 38.0 38.0 8 37.51925 38.0 38.0 38.0 38.0 38.0 9 37.51475 38.0 38.0 38.0 38.0 38.0 10-14 37.525800000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.4806 38.0 38.0 38.0 38.0 38.0 20-24 37.4856 38.0 38.0 38.0 38.0 38.0 25-29 37.4652 38.0 38.0 38.0 38.0 38.0 30-34 37.3968 38.0 38.0 38.0 38.0 38.0 35-39 37.394349999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.42665 38.0 38.0 38.0 38.0 38.0 45-49 37.3912 38.0 38.0 38.0 37.8 38.0 50-54 37.32015 38.0 38.0 38.0 37.0 38.0 55-59 37.31175 38.0 38.0 38.0 37.0 38.0 60-64 37.26175 38.0 38.0 38.0 37.0 38.0 65-69 37.204899999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.15945000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.11575 38.0 38.0 38.0 36.4 38.0 80-84 36.988 38.0 38.0 38.0 36.0 38.0 85-89 36.8213 38.0 38.0 38.0 35.6 38.0 90-94 36.796350000000004 38.0 38.0 38.0 35.4 38.0 95-99 36.587849999999996 38.0 38.0 38.0 34.8 38.0 100-104 36.560199999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.4754 38.0 38.0 38.0 34.2 38.0 110-114 36.282 38.0 38.0 38.0 34.0 38.0 115-119 36.09685 38.0 37.0 38.0 33.4 38.0 120-124 35.81615000000001 38.0 36.8 38.0 32.2 38.0 125-129 35.473150000000004 38.0 36.0 38.0 31.0 38.0 130-134 35.04860000000001 38.0 35.4 38.0 30.0 38.0 135-139 34.42895 38.0 33.6 38.0 27.0 38.0 140-144 33.7365 38.0 33.0 38.0 23.0 38.0 145-149 32.751099999999994 38.0 33.0 38.0 16.6 38.0 150-151 26.943624999999997 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 3.0 5 0.0 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 2.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 2.0 18 2.0 19 1.0 20 7.0 21 5.0 22 7.0 23 6.0 24 10.0 25 4.0 26 10.0 27 12.0 28 19.0 29 22.0 30 27.0 31 29.0 32 58.0 33 82.0 34 138.0 35 287.0 36 844.0 37 2405.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.97548161120841 19.189392044033024 16.112084063047284 30.723042281711283 2 25.41906429822367 24.518388791593697 33.950462847135356 16.112084063047284 3 20.240180135101326 27.145359019264447 33.02476857643232 19.5896922692019 4 23.867900925694272 33.90042531898924 23.817863397548162 18.413810357768327 5 23.417563172379285 36.8026019514636 23.767825869402053 16.012009006755065 6 19.629907476869217 39.98499624906226 23.40585146286572 16.9792448112028 7 19.654913728432106 20.05501375343836 40.960240060015 19.32983245811453 8 21.230307576894223 25.481370342585645 28.182045511377847 25.10627656914228 9 22.83070767691923 23.730932733183295 31.257814453613403 22.18054513628407 10-14 22.93302655929575 29.440304106437253 26.859400790276595 20.767268543990397 15-19 22.834133653461386 28.351340536214487 28.16626650660264 20.64825930372149 20-24 22.767522137175447 28.845865225874228 28.080444244334384 20.306168392615938 25-29 23.108865319191516 28.001801080648388 28.652191314788872 20.237142285371224 30-34 22.50187640730548 28.211158368776584 28.58143607705779 20.705529146860144 35-39 22.665866106274393 28.19973981787251 28.56999899929951 20.564395076553588 40-44 22.385073282977338 28.332749737381825 28.59786904106848 20.684307938572356 45-49 22.701350675337668 27.94897448724362 28.704352176088044 20.645322661330663 50-54 22.672469858422133 28.71579368652759 27.820301165641105 20.791435289409176 55-59 22.8064032016008 28.844422211105552 28.059029514757377 20.290145072536266 60-64 22.785253364013805 28.567855534990745 28.372767745485465 20.27412335550998 65-69 22.78367020212127 28.131879127476484 28.547128276966177 20.53732239343606 70-74 22.876013209246473 28.079655759031326 28.479935955168617 20.564395076553588 75-79 23.152364273204903 27.52564423317488 28.081060795596695 21.240930698023515 80-84 22.50688016012009 28.171128346259692 28.416312234175635 20.905679259444586 85-89 22.912184138103576 28.36627470602952 27.850888166124594 20.870652989742304 90-94 22.912184138103576 28.526394796097073 28.116087065298974 20.445334000500377 95-99 23.5703207084605 28.10326712363036 27.91314354330315 20.413268624605994 100-104 23.51145802061443 28.099669768838186 27.849494646252378 20.539377564295005 105-109 23.63918351010606 27.751650990594356 28.29697818691215 20.312187312387433 110-114 23.475258918296895 28.138289888427476 28.71366388152299 19.67278731175264 115-119 24.448336252189144 27.950963222416814 27.77082812109082 19.829872404303227 120-124 24.23317488116087 28.441330998248688 27.335501626219667 19.989992494370778 125-129 23.91793845384038 28.55141356017013 27.75081310983237 19.779834876157118 130-134 24.06805103827871 28.56642481861396 27.645734300725543 19.719789842381786 135-139 24.048036027020263 28.841631223417565 27.52064048036027 19.5896922692019 140-144 24.273204903677758 27.955966975231423 28.426319739804857 19.344508381285966 145-149 24.293219914936202 27.910933199899922 27.755816862646988 20.040030022516888 150-151 23.85240775484678 27.82989368355222 28.392745465916196 19.924953095684803 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 2.0 24 3.0 25 3.5 26 5.5 27 11.5 28 14.5 29 14.0 30 22.0 31 26.5 32 25.0 33 39.5 34 59.5 35 75.0 36 92.5 37 124.0 38 154.0 39 170.0 40 204.5 41 243.0 42 276.0 43 295.0 44 294.0 45 284.0 46 260.0 47 236.5 48 203.0 49 174.5 50 149.5 51 125.5 52 105.0 53 73.5 54 55.0 55 47.0 56 38.0 57 29.0 58 19.0 59 11.5 60 7.0 61 5.0 62 4.5 63 3.5 64 2.5 65 1.0 66 1.5 67 1.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.034999999999999996 15-19 0.04 20-24 0.055 25-29 0.06 30-34 0.075 35-39 0.06999999999999999 40-44 0.045 45-49 0.05 50-54 0.055 55-59 0.05 60-64 0.045 65-69 0.06 70-74 0.06999999999999999 75-79 0.075 80-84 0.075 85-89 0.075 90-94 0.075 95-99 0.065 100-104 0.06999999999999999 105-109 0.06 110-114 0.065 115-119 0.075 120-124 0.075 125-129 0.075 130-134 0.075 135-139 0.075 140-144 0.075 145-149 0.075 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47089947089947 98.7 2 0.40312421264802223 0.8 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.02519526329050139 0.125 6 0.02519526329050139 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.4125 0.0 0.0 0.0 0.0 116-117 2.525 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.275 0.0 0.0 0.0 0.0 128-129 3.5250000000000004 0.0 0.0 0.0 0.0 130-131 3.7375 0.0 0.0 0.0 0.0 132-133 3.9875 0.0 0.0 0.0 0.0 134-135 4.2375 0.0 0.0 0.0 0.0 136-137 4.512499999999999 0.0 0.0 0.0 0.0 138-139 4.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAATT 15 1.1411342E-4 145.0 2 ACACAGA 10 0.006830828 145.0 4 GGAAAAT 20 3.5877043E-4 108.75 1 >>END_MODULE Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594004 spots for SRR7170510.sra Written 594004 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra Read 594003 spots for SRR7170510.sra Written 594003 spots for SRR7170510.sra SRR ids: ['SRR7170510.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_44ybp9l4 SRR7170510.sra spots: 11880061 blocks: [[1, 594003], [594004, 1188006], [1188007, 1782009], [1782010, 2376012], [2376013, 2970015], [2970016, 3564018], [3564019, 4158021], [4158022, 4752024], [4752025, 5346027], [5346028, 5940030], [5940031, 6534033], [6534034, 7128036], [7128037, 7722039], [7722040, 8316042], [8316043, 8910045], [8910046, 9504048], [9504049, 10098051], [10098052, 10692054], [10692055, 11286057], [11286058, 11880061]] SRR7170510 file size 4004062 SRR7170510 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170510 SRR7170510_1.fastq SRR7170510_2.fastq Input file: SRR7170510_1.fastq Paired file: SRR7170510_2.fastq trimmed: SRR7170510-trimmed-pair1.fastq, SRR7170510-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 07:24:58 2025 >> started Thu Feb 13 07:25:11 2025 >> done (12.663s) 11880061 read pairs processed; of these: 12572 ( 0.11%) short read pairs filtered out after trimming by size control 16888 ( 0.14%) empty read pairs filtered out after trimming by size control 11850601 (99.75%) read pairs available; of these: 7623771 (64.33%) trimmed read pairs available after processing 4226830 (35.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 5 0.00% 21 3 0.00% 22 1 0.00% 23 6 0.00% 24 4 0.00% 25 2 0.00% 26 1 0.00% 27 3 0.00% 28 6 0.00% 29 5 0.00% 30 2 0.00% 31 1 0.00% 32 5 0.00% 33 8 0.00% 34 4 0.00% 35 9 0.00% 36 11 0.00% 37 10 0.00% 38 15 0.00% 39 16 0.00% 40 21 0.00% 41 28 0.00% 42 18 0.00% 43 19 0.00% 44 27 0.00% 45 23 0.00% 46 40 0.00% 47 37 0.00% 48 49 0.00% 49 70 0.00% 50 65 0.00% 51 62 0.00% 52 94 0.00% 53 106 0.00% 54 96 0.00% 55 121 0.00% 56 107 0.00% 57 152 0.00% 58 166 0.00% 59 214 0.00% 60 247 0.00% 61 280 0.00% 62 346 0.00% 63 360 0.00% 64 402 0.00% 65 438 0.00% 66 463 0.00% 67 519 0.00% 68 579 0.00% 69 644 0.01% 70 805 0.01% 71 832 0.01% 72 980 0.01% 73 1104 0.01% 74 1222 0.01% 75 1347 0.01% 76 1472 0.01% 77 1666 0.01% 78 1656 0.01% 79 1869 0.02% 80 2327 0.02% 81 2428 0.02% 82 2801 0.02% 83 3310 0.03% 84 3935 0.03% 85 4293 0.04% 86 4454 0.04% 87 4649 0.04% 88 4663 0.04% 89 4999 0.04% 90 5170 0.04% 91 5737 0.05% 92 6055 0.05% 93 6637 0.06% 94 7128 0.06% 95 7542 0.06% 96 7898 0.07% 97 8315 0.07% 98 8497 0.07% 99 8515 0.07% 100 9256 0.08% 101 9789 0.08% 102 10030 0.08% 103 10668 0.09% 104 11243 0.09% 105 11723 0.10% 106 12510 0.11% 107 12711 0.11% 108 12791 0.11% 109 13147 0.11% 110 13481 0.11% 111 13503 0.11% 112 13917 0.12% 113 14579 0.12% 114 15290 0.13% 115 15828 0.13% 116 16596 0.14% 117 17011 0.14% 118 17376 0.15% 119 17570 0.15% 120 18282 0.15% 121 18807 0.16% 122 19512 0.16% 123 20050 0.17% 124 21704 0.18% 125 22282 0.19% 126 23557 0.20% 127 24632 0.21% 128 25362 0.21% 129 27192 0.23% 130 29005 0.24% 131 30798 0.26% 132 32718 0.28% 133 35503 0.30% 134 37687 0.32% 135 41668 0.35% 136 46193 0.39% 137 50762 0.43% 138 57050 0.48% 139 65531 0.55% 140 74391 0.63% 141 87462 0.74% 142 102880 0.87% 143 125191 1.06% 144 155498 1.31% 145 201206 1.70% 146 272926 2.30% 147 389789 3.29% 148 613034 5.17% 149 1157949 9.77% 150 3397912 28.67% 151 4226830 35.67% 11850601 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=22 prefix-density=0.34 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=11.66 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=3.7 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=22 prefix-density=0.36 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=67.85 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.6 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTT SRR7170510 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 07:25:54 Started mapping on | Feb 13 07:25:54 Finished on | Feb 13 09:39:49 Mapping speed, Million of reads per hour | 5.31 Number of input reads | 11850601 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11287369 Uniquely mapped reads % | 95.25% Average mapped length | 293.31 Number of splices: Total | 11170567 Number of splices: Annotated (sjdb) | 10893344 Number of splices: GT/AG | 10964436 Number of splices: GC/AG | 164842 Number of splices: AT/AC | 6857 Number of splices: Non-canonical | 34432 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 296714 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 12633 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 273579 273579 273579 N_multimapping 296714 296714 296714 N_noFeature 449835 11101256 510901 N_ambiguous 213842 884 88321 UnstrandedReadsAssigned:10623692 PositiveStrandReadsAssigned:185229 NegativeStrandReadsAssigned:10688147 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170510 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170510-trimmed-pair1.fastq SRR7170510-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,850,601 reads, 10,581,189 reads pseudoaligned [quant] estimated average fragment length: 278.679 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR7170510.ke.tsv 34699 SRR7170510.se.tsv 87100 total ==> SRR7170510.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.32 758 38.3427 Potri.005G024800.1.v4.1 1035 757.321 249 28.9443 Potri.004G059700.1.v4.1 961 683.347 5 0.644127 Potri.007G009000.2.v4.1 1416 1138.32 0 0 Potri.003G141000.2.v4.1 2943 2665.32 795 26.2579 Potri.016G087400.1.v4.1 270 75.2671 651 761.41 Potri.015G069301.1.v4.1 564 291.987 0 0 Potri.010G195200.1.v4.1 1773 1495.32 67 3.94442 Potri.012G127500.1.v4.1 977 699.331 90 11.3293 ==> SRR7170510.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 463 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 260 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170510 completed mapping pipeline successfully