Starting /dee2/code/volunteer_pipeline.sh SRR7170511 current disk space = 3052649857024 free memory = 1571671752 SRR7170511 SRAfilesize 4efb2222d14c44de30ef5811beef68e5 SRR7170511.sra SRR7170511.sra file validated SRR7170511 is paired end SRR7170511 is conventional basespace SRR7170511 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170511_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.218 18.0 18.0 25.0 18.0 32.0 2 29.16875 30.0 27.0 31.0 27.0 33.0 3 30.13925 31.0 29.0 33.0 27.0 33.0 4 31.76075 33.0 31.0 33.0 29.0 33.0 5 32.76 33.0 33.0 33.0 32.0 34.0 6 37.13 38.0 37.0 38.0 36.0 38.0 7 37.51625 38.0 38.0 38.0 37.0 38.0 8 37.585 38.0 38.0 38.0 37.0 38.0 9 37.42875 38.0 38.0 38.0 37.0 38.0 10-14 37.53065 38.0 38.0 38.0 37.0 38.0 15-19 37.55225 38.0 38.0 38.0 38.0 38.0 20-24 37.5396 38.0 38.0 38.0 37.2 38.0 25-29 37.4642 38.0 38.0 38.0 37.0 38.0 30-34 37.4639 38.0 38.0 38.0 37.0 38.0 35-39 37.346450000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.30415000000001 38.0 38.0 38.0 36.8 38.0 45-49 37.14905 38.0 38.0 38.0 36.0 38.0 50-54 37.0207 38.0 38.0 38.0 36.0 38.0 55-59 36.838100000000004 38.0 38.0 38.0 35.0 38.0 60-64 36.865 38.0 38.0 38.0 35.0 38.0 65-69 36.6761 38.0 38.0 38.0 34.2 38.0 70-74 36.5984 38.0 38.0 38.0 34.0 38.0 75-79 36.3269 38.0 37.0 38.0 33.8 38.0 80-84 36.1347 38.0 37.0 38.0 33.0 38.0 85-89 36.08825 38.0 37.0 38.0 33.2 38.0 90-94 35.86785 38.0 37.0 38.0 31.8 38.0 95-99 35.403800000000004 38.0 36.2 38.0 29.2 38.0 100-104 35.68 38.0 36.2 38.0 31.0 38.0 105-109 35.22814999999999 38.0 35.8 38.0 29.2 38.0 110-114 34.9951 38.0 35.2 38.0 27.8 38.0 115-119 34.525999999999996 38.0 34.8 38.0 25.4 38.0 120-124 34.18295 38.0 34.0 38.0 23.6 38.0 125-129 33.664100000000005 38.0 34.0 38.0 21.0 38.0 130-134 32.3836 37.2 31.8 38.0 15.0 38.0 135-139 31.6789 36.2 31.0 38.0 13.6 38.0 140-144 30.294399999999996 36.0 28.2 38.0 12.6 38.0 145-149 29.226350000000004 35.8 27.2 38.0 3.8 38.0 150-151 23.2695 29.5 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 1.0 17 3.0 18 2.0 19 6.0 20 5.0 21 6.0 22 11.0 23 12.0 24 21.0 25 21.0 26 19.0 27 29.0 28 52.0 29 55.0 30 91.0 31 105.0 32 136.0 33 197.0 34 332.0 35 620.0 36 1314.0 37 957.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.820094687006836 11.730668069437138 11.941083640189374 34.50815360336665 2 20.1 15.45 35.875 28.575 3 19.2 20.0 30.25 30.55 4 22.405601400350086 28.557139284821204 24.131032758189548 24.90622655663916 5 22.1 32.525 24.45 20.925 6 18.575 34.35 26.6 20.474999999999998 7 13.25 25.324999999999996 43.4 18.025 8 17.974999999999998 25.4 31.775 24.85 9 16.900000000000002 24.325 33.35 25.424999999999997 10-14 19.625 29.9 27.169999999999998 23.305 15-19 19.42 28.67 27.935 23.974999999999998 20-24 19.895 28.725 27.474999999999998 23.905 25-29 19.855 28.375 28.32 23.45 30-34 19.395969798489922 29.226461323066154 27.561378068903448 23.816190809540476 35-39 20.075000000000003 28.494999999999997 27.994999999999997 23.435 40-44 19.64 28.970000000000002 27.689999999999998 23.7 45-49 20.285 28.705000000000002 27.61 23.400000000000002 50-54 20.01 28.235 27.925 23.830000000000002 55-59 19.605 29.03 27.560000000000002 23.805 60-64 19.445 28.675 27.505000000000003 24.375 65-69 19.425 28.355000000000004 28.1 24.12 70-74 19.93 28.560000000000002 27.839999999999996 23.669999999999998 75-79 20.03200320032003 27.872787278727873 27.997799779978 24.097409740974097 80-84 20.602060206020603 28.717871787178716 27.142714271427142 23.537353735373536 85-89 20.5 28.294999999999998 27.639999999999997 23.565 90-94 19.685 28.525 27.605 24.185000000000002 95-99 20.53 28.444999999999997 27.894999999999996 23.13 100-104 20.615 28.925 27.310000000000002 23.150000000000002 105-109 19.99 28.785 27.46 23.765 110-114 20.52 28.860000000000003 27.46 23.16 115-119 20.025000000000002 28.585 28.115000000000002 23.275000000000002 120-124 20.27 28.645 27.67 23.415 125-129 20.485 27.865000000000002 27.815 23.835 130-134 20.615 28.155 27.855 23.375 135-139 20.294999999999998 27.889999999999997 27.860000000000003 23.955000000000002 140-144 20.645 28.57 27.54 23.244999999999997 145-149 20.645 28.71 27.24 23.405 150-151 20.4125 28.8625 26.875 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 2.0 24 2.0 25 2.5 26 5.5 27 8.0 28 12.0 29 16.0 30 21.0 31 26.0 32 35.0 33 44.0 34 55.5 35 81.5 36 99.5 37 109.5 38 129.0 39 149.0 40 181.0 41 213.0 42 254.5 43 286.0 44 281.0 45 270.0 46 262.0 47 241.5 48 219.5 49 200.0 50 175.5 51 153.5 52 125.5 53 90.5 54 58.5 55 47.0 56 41.0 57 32.0 58 23.0 59 13.5 60 10.0 61 7.5 62 4.5 63 2.5 64 1.0 65 1.5 66 0.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.95 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.7999999999999998 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.1125 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.5250000000000004 0.0 0.0 0.0 0.0 124-125 2.725 0.0 0.0 0.0 0.0 126-127 3.0250000000000004 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.4749999999999996 0.0 0.0 0.0 0.0 132-133 3.7 0.0 0.0 0.0 0.0 134-135 3.95 0.0 0.0 0.0 0.0 136-137 4.35 0.0 0.0 0.0 0.0 138-139 4.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170511 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170511_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.993 33.0 33.0 34.0 32.0 34.0 2 33.134 34.0 33.0 34.0 33.0 34.0 3 33.1045 34.0 33.0 34.0 33.0 34.0 4 33.11325 34.0 33.0 34.0 33.0 34.0 5 33.13075 34.0 33.0 34.0 33.0 34.0 6 37.35425 38.0 38.0 38.0 37.0 38.0 7 37.3355 38.0 38.0 38.0 37.0 38.0 8 37.3975 38.0 38.0 38.0 38.0 38.0 9 37.4065 38.0 38.0 38.0 38.0 38.0 10-14 37.4172 38.0 38.0 38.0 37.6 38.0 15-19 37.3677 38.0 38.0 38.0 37.6 38.0 20-24 37.3612 38.0 38.0 38.0 37.6 38.0 25-29 37.34185 38.0 38.0 38.0 37.2 38.0 30-34 37.317099999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.2873 38.0 38.0 38.0 37.0 38.0 40-44 37.3264 38.0 38.0 38.0 37.0 38.0 45-49 37.26195 38.0 38.0 38.0 37.0 38.0 50-54 37.2119 38.0 38.0 38.0 37.0 38.0 55-59 37.18265 38.0 38.0 38.0 37.0 38.0 60-64 37.14045 38.0 38.0 38.0 37.0 38.0 65-69 37.0966 38.0 38.0 38.0 36.4 38.0 70-74 37.0107 38.0 38.0 38.0 36.0 38.0 75-79 36.93885 38.0 38.0 38.0 36.0 38.0 80-84 36.8581 38.0 38.0 38.0 36.0 38.0 85-89 36.8464 38.0 38.0 38.0 36.0 38.0 90-94 36.703700000000005 38.0 38.0 38.0 35.0 38.0 95-99 36.57495 38.0 38.0 38.0 34.6 38.0 100-104 36.5582 38.0 38.0 38.0 34.2 38.0 105-109 36.4406 38.0 38.0 38.0 34.0 38.0 110-114 36.253550000000004 38.0 37.6 38.0 33.8 38.0 115-119 36.03685 38.0 37.0 38.0 33.2 38.0 120-124 35.65415 38.0 36.6 38.0 31.0 38.0 125-129 35.02935 38.0 36.0 38.0 28.8 38.0 130-134 34.85575 38.0 35.6 38.0 28.0 38.0 135-139 34.34265 38.0 34.2 38.0 26.4 38.0 140-144 33.83905 38.0 33.2 38.0 23.4 38.0 145-149 33.0749 38.0 33.0 38.0 19.0 38.0 150-151 27.447499999999998 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 3.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 2.0 11 2.0 12 2.0 13 1.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 3.0 20 5.0 21 8.0 22 4.0 23 3.0 24 9.0 25 12.0 26 11.0 27 14.0 28 23.0 29 25.0 30 47.0 31 51.0 32 74.0 33 104.0 34 141.0 35 269.0 36 698.0 37 2472.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.8893340010015 21.707561342013022 10.941412118177265 24.461692538808215 2 25.51326990485729 26.339509263895845 31.622433650475713 16.524787180771156 3 19.529293940911366 30.24536805207812 31.321982974461694 18.903355032548824 4 23.43515272909364 34.07611417125688 23.485227841762644 19.00350525788683 5 23.28492739108663 36.57986980470706 23.184777165748624 16.950425638457688 6 20.22022022022022 38.23823823823824 23.44844844844845 18.093093093093092 7 19.21921921921922 22.57257257257257 38.688688688688686 19.51951951951952 8 20.945945945945947 25.650650650650654 27.55255255255255 25.850850850850847 9 20.545545545545547 26.2012012012012 29.954954954954953 23.2982982982983 10-14 22.962962962962962 29.654654654654657 26.391391391391387 20.99099099099099 15-19 22.65265265265265 28.593593593593592 27.77777777777778 20.975975975975977 20-24 22.8242363545318 28.542814221331998 27.836755132699047 20.796194291437157 25-29 22.8342513770656 29.128693039559337 27.821732598898347 20.215322984476717 30-34 22.458688032048073 28.5878818227341 28.512769153730595 20.44066099148723 35-39 22.799198798197295 28.182273410115172 28.077115673510267 20.941412118177265 40-44 22.348522784176264 27.641462193289932 28.928392588883323 21.081622433650477 45-49 22.929394091136704 28.00701051577366 28.11717576364547 20.946419629444165 50-54 22.744116174261393 28.092138207310967 27.986980470706058 21.176765147721582 55-59 23.28993490235353 28.502754131196795 27.59639459188783 20.610916374561842 60-64 23.184777165748624 27.901852779168753 28.082123184777164 20.83124687030546 65-69 23.192107371794872 27.59415064102564 28.370392628205128 20.843349358974358 70-74 22.88891114895322 28.678753881598716 27.506761494540722 20.925573474907342 75-79 22.364137240170297 27.933884297520663 28.384673178061608 21.317305284247436 80-84 23.110443275732532 28.12922614575507 27.878787878787882 20.881542699724516 85-89 23.125469571750564 28.36463811670423 27.808665164037066 20.70122714750814 90-94 23.961933383420984 27.988980716253444 27.72852491860756 20.320560981718007 95-99 23.622796474358974 27.659254807692307 27.989783653846157 20.728165064102562 100-104 23.251039110621463 28.108568280835293 28.253793379738596 20.38659922880465 105-109 23.681706645300217 27.888226751464774 27.783063748810655 20.647002854424358 110-114 23.52646602233462 27.622815363813913 28.14362261505333 20.707095998798135 115-119 24.29630371631774 28.117800260442756 27.596914755083642 19.988981268155865 120-124 23.751565239168546 28.059103431004257 27.918858001502628 20.270473328324567 125-129 24.50788880540947 28.13924367643376 27.508139243676432 19.844728274480342 130-134 24.092161282243925 28.089156023040317 27.493112947658403 20.32556974705735 135-139 24.12221387427999 27.493112947658403 28.199348860505886 20.18532431755572 140-144 23.931880791384923 28.49486601552717 27.513148009015776 20.06010518407213 145-149 24.61307287753569 28.404708239418987 27.62334084648134 19.358878036563986 150-151 24.051583823713536 27.882809565544008 27.432077125328657 20.6335294854138 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 2.0 23 3.0 24 2.0 25 3.0 26 5.0 27 6.5 28 10.0 29 15.0 30 18.5 31 20.5 32 24.5 33 40.5 34 51.0 35 68.5 36 87.5 37 111.0 38 144.0 39 160.5 40 192.0 41 242.5 42 272.5 43 296.0 44 285.0 45 267.0 46 265.5 47 251.0 48 227.5 49 181.5 50 149.5 51 137.5 52 112.0 53 83.0 54 74.0 55 52.5 56 33.5 57 29.0 58 20.5 59 14.5 60 12.0 61 8.0 62 4.5 63 2.0 64 1.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.15 3 0.15 4 0.15 5 0.15 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.1 15-19 0.1 20-24 0.15 25-29 0.15 30-34 0.15 35-39 0.15 40-44 0.15 45-49 0.15 50-54 0.15 55-59 0.15 60-64 0.15 65-69 0.16 70-74 0.16999999999999998 75-79 0.17500000000000002 80-84 0.17500000000000002 85-89 0.17500000000000002 90-94 0.17500000000000002 95-99 0.16 100-104 0.155 105-109 0.155 110-114 0.155 115-119 0.16999999999999998 120-124 0.17500000000000002 125-129 0.17500000000000002 130-134 0.17500000000000002 135-139 0.17500000000000002 140-144 0.17500000000000002 145-149 0.17500000000000002 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21578547938275 98.05 2 0.6324310650139134 1.25 3 0.05059448520111307 0.15 4 0.05059448520111307 0.2 5 0.0 0.0 6 0.025297242600556536 0.15 7 0.0 0.0 8 0.025297242600556536 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.5999999999999996 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.1500000000000004 0.0 0.0 0.0 0.0 128-129 3.3499999999999996 0.0 0.0 0.0 0.0 130-131 3.625 0.0 0.0 0.0 0.0 132-133 3.8499999999999996 0.0 0.0 0.0 0.0 134-135 4.125 0.0 0.0 0.0 0.0 136-137 4.5625 0.0 0.0 0.0 0.0 138-139 4.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAAAT 10 0.006830828 145.0 1 >>END_MODULE Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798679 spots for SRR7170511.sra Written 798679 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra Read 798676 spots for SRR7170511.sra Written 798676 spots for SRR7170511.sra SRR ids: ['SRR7170511.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n6okr7cl SRR7170511.sra spots: 15973523 blocks: [[1, 798676], [798677, 1597352], [1597353, 2396028], [2396029, 3194704], [3194705, 3993380], [3993381, 4792056], [4792057, 5590732], [5590733, 6389408], [6389409, 7188084], [7188085, 7986760], [7986761, 8785436], [8785437, 9584112], [9584113, 10382788], [10382789, 11181464], [11181465, 11980140], [11980141, 12778816], [12778817, 13577492], [13577493, 14376168], [14376169, 15174844], [15174845, 15973523]] SRR7170511 file size 5391202 SRR7170511 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170511 SRR7170511_1.fastq SRR7170511_2.fastq Input file: SRR7170511_1.fastq Paired file: SRR7170511_2.fastq trimmed: SRR7170511-trimmed-pair1.fastq, SRR7170511-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:24:55 2025 >> started Thu Feb 13 09:30:52 2025 >> done (357.184s) 15973523 read pairs processed; of these: 13324 ( 0.08%) short read pairs filtered out after trimming by size control 19223 ( 0.12%) empty read pairs filtered out after trimming by size control 15940976 (99.80%) read pairs available; of these: 10871520 (68.20%) trimmed read pairs available after processing 5069456 (31.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 5 0.00% 23 5 0.00% 24 2 0.00% 25 3 0.00% 26 9 0.00% 27 7 0.00% 28 4 0.00% 29 4 0.00% 30 3 0.00% 31 18 0.00% 32 7 0.00% 33 3 0.00% 34 14 0.00% 35 12 0.00% 36 12 0.00% 37 11 0.00% 38 12 0.00% 39 21 0.00% 40 15 0.00% 41 19 0.00% 42 27 0.00% 43 14 0.00% 44 32 0.00% 45 30 0.00% 46 34 0.00% 47 45 0.00% 48 55 0.00% 49 67 0.00% 50 78 0.00% 51 68 0.00% 52 82 0.00% 53 126 0.00% 54 121 0.00% 55 107 0.00% 56 147 0.00% 57 158 0.00% 58 161 0.00% 59 214 0.00% 60 243 0.00% 61 276 0.00% 62 345 0.00% 63 422 0.00% 64 376 0.00% 65 430 0.00% 66 494 0.00% 67 554 0.00% 68 601 0.00% 69 723 0.00% 70 801 0.01% 71 980 0.01% 72 1193 0.01% 73 1221 0.01% 74 1368 0.01% 75 1599 0.01% 76 1610 0.01% 77 1889 0.01% 78 2050 0.01% 79 2235 0.01% 80 2652 0.02% 81 2958 0.02% 82 3355 0.02% 83 4029 0.03% 84 4896 0.03% 85 5006 0.03% 86 5156 0.03% 87 5471 0.03% 88 5732 0.04% 89 5988 0.04% 90 6454 0.04% 91 6985 0.04% 92 7485 0.05% 93 8242 0.05% 94 8930 0.06% 95 9464 0.06% 96 10003 0.06% 97 10212 0.06% 98 10686 0.07% 99 11081 0.07% 100 11688 0.07% 101 12279 0.08% 102 13188 0.08% 103 13759 0.09% 104 14759 0.09% 105 15327 0.10% 106 15915 0.10% 107 16494 0.10% 108 16782 0.11% 109 17084 0.11% 110 17611 0.11% 111 18598 0.12% 112 19448 0.12% 113 20297 0.13% 114 21293 0.13% 115 22860 0.14% 116 23266 0.15% 117 24882 0.16% 118 25560 0.16% 119 26293 0.16% 120 27377 0.17% 121 28745 0.18% 122 30233 0.19% 123 32163 0.20% 124 34372 0.22% 125 36138 0.23% 126 38931 0.24% 127 41000 0.26% 128 43377 0.27% 129 46107 0.29% 130 49604 0.31% 131 53510 0.34% 132 57790 0.36% 133 63061 0.40% 134 69473 0.44% 135 76435 0.48% 136 83889 0.53% 137 93452 0.59% 138 103827 0.65% 139 117293 0.74% 140 133468 0.84% 141 151750 0.95% 142 176307 1.11% 143 209923 1.32% 144 256605 1.61% 145 321644 2.02% 146 417313 2.62% 147 579970 3.64% 148 872057 5.47% 149 1572415 9.86% 150 4529952 28.42% 151 5069456 31.80% 15940976 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=16 prefix-density=0.50 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=409.04 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=26 prefix-density=0.52 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=88.27 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.8 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7170511 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:27:10 Started mapping on | Feb 13 10:27:17 Finished on | Feb 13 11:05:40 Mapping speed, Million of reads per hour | 24.92 Number of input reads | 15940976 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14801073 Uniquely mapped reads % | 92.85% Average mapped length | 292.51 Number of splices: Total | 14542964 Number of splices: Annotated (sjdb) | 14192179 Number of splices: GT/AG | 14275272 Number of splices: GC/AG | 217829 Number of splices: AT/AC | 8615 Number of splices: Non-canonical | 41248 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 400867 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 47297 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.26% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 748855 748855 748855 N_multimapping 400867 400867 400867 N_noFeature 580649 14550361 668912 N_ambiguous 281402 1117 118315 UnstrandedReadsAssigned:13939022 PositiveStrandReadsAssigned:249595 NegativeStrandReadsAssigned:14013846 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR7170511 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170511-trimmed-pair1.fastq SRR7170511-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,940,976 reads, 14,026,004 reads pseudoaligned [quant] estimated average fragment length: 283.807 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR7170511.ke.tsv 34699 SRR7170511.se.tsv 87100 total ==> SRR7170511.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.19 905 34.7368 Potri.005G024800.1.v4.1 1035 752.193 108 9.56277 Potri.004G059700.1.v4.1 961 678.226 8 0.785606 Potri.007G009000.2.v4.1 1416 1133.19 0 0 Potri.003G141000.2.v4.1 2943 2660.19 634 15.8732 Potri.016G087400.1.v4.1 270 75.7295 689.748 606.616 Potri.015G069301.1.v4.1 564 288.438 0 0 Potri.010G195200.1.v4.1 1773 1490.19 5 0.223469 Potri.012G127500.1.v4.1 977 694.198 144 13.8155 ==> SRR7170511.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1579 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7170511 completed mapping pipeline successfully