Starting /dee2/code/volunteer_pipeline.sh SRR7170512 current disk space = 3053083508736 free memory = 1450210864 SRR7170512 SRAfilesize f3c5589ada4d05a0ea370a71905745e1 SRR7170512.sra SRR7170512.sra file validated SRR7170512 is paired end SRR7170512 is conventional basespace SRR7170512 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170512_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.63625 30.0 18.0 33.0 18.0 33.0 2 30.30625 31.0 29.0 33.0 27.0 34.0 3 31.097 33.0 31.0 33.0 27.0 33.0 4 30.422 31.0 29.0 33.0 27.0 33.0 5 32.2835 33.0 32.0 33.0 32.0 33.0 6 36.514 38.0 37.0 38.0 34.0 38.0 7 37.15725 38.0 38.0 38.0 36.0 38.0 8 37.5565 38.0 38.0 38.0 37.0 38.0 9 37.41925 38.0 38.0 38.0 37.0 38.0 10-14 37.513999999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.5477 38.0 38.0 38.0 37.4 38.0 20-24 37.58675 38.0 38.0 38.0 38.0 38.0 25-29 37.540000000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.53340000000001 38.0 38.0 38.0 37.6 38.0 35-39 37.36745 38.0 38.0 38.0 37.0 38.0 40-44 37.384949999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.1725 38.0 38.0 38.0 36.6 38.0 50-54 37.202299999999994 38.0 38.0 38.0 36.2 38.0 55-59 37.063199999999995 38.0 38.0 38.0 35.8 38.0 60-64 37.037549999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.8928 38.0 38.0 38.0 35.2 38.0 70-74 36.81745 38.0 38.0 38.0 34.8 38.0 75-79 36.5529 38.0 38.0 38.0 34.2 38.0 80-84 36.352000000000004 38.0 37.8 38.0 33.8 38.0 85-89 36.4226 38.0 37.6 38.0 34.0 38.0 90-94 36.25415 38.0 37.4 38.0 33.4 38.0 95-99 35.731700000000004 38.0 36.8 38.0 30.6 38.0 100-104 35.98695 38.0 37.0 38.0 33.0 38.0 105-109 35.644999999999996 38.0 36.4 38.0 30.8 38.0 110-114 35.37304999999999 38.0 35.8 38.0 30.0 38.0 115-119 35.015499999999996 38.0 35.4 38.0 27.8 38.0 120-124 34.62610000000001 38.0 35.0 38.0 26.2 38.0 125-129 34.21405 38.0 34.2 38.0 24.0 38.0 130-134 33.0653 37.6 32.0 38.0 17.8 38.0 135-139 32.28545 37.0 31.2 38.0 15.0 38.0 140-144 31.484950000000005 36.2 30.2 38.0 13.0 38.0 145-149 30.450499999999998 36.0 29.0 38.0 8.4 38.0 150-151 24.43725 31.5 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 1.0 17 3.0 18 3.0 19 4.0 20 4.0 21 10.0 22 6.0 23 12.0 24 20.0 25 13.0 26 27.0 27 31.0 28 38.0 29 50.0 30 73.0 31 68.0 32 98.0 33 152.0 34 271.0 35 543.0 36 1269.0 37 1301.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.02042419481539 11.102382822728462 10.159727677402461 40.71746530505368 2 22.125 14.625 32.5 30.75 3 19.575 20.150000000000002 26.400000000000002 33.875 4 23.9 27.6 22.925 25.575 5 23.075000000000003 32.95 23.674999999999997 20.3 6 19.575 35.425000000000004 25.35 19.650000000000002 7 13.950000000000001 24.85 41.75 19.45 8 17.5 27.275 29.7 25.525 9 16.725 25.75 34.1 23.425 10-14 19.759999999999998 29.925 27.565 22.75 15-19 19.645000000000003 28.74 27.534999999999997 24.08 20-24 19.915 28.525 28.26 23.3 25-29 19.845 28.544999999999998 28.055000000000003 23.555 30-34 20.162016201620162 28.95289528952895 27.182718271827184 23.7023702370237 35-39 19.926992699269928 28.822882288228826 27.317731773177318 23.932393239323932 40-44 19.986998699869986 28.91289128912891 27.47274727472747 23.62736273627363 45-49 20.36 28.53 27.18 23.93 50-54 20.175 28.535 28.23 23.06 55-59 20.035 29.03 27.46 23.474999999999998 60-64 20.185 28.610000000000003 27.339999999999996 23.865 65-69 20.09 27.71 28.365000000000002 23.835 70-74 19.885 28.244999999999997 28.015 23.855 75-79 20.1780267040056 27.98419762964445 27.97919687953193 23.858578786818022 80-84 20.497049704970497 27.65776577657766 27.992799279927993 23.85238523852385 85-89 21.006050302515124 28.546427321366068 26.64633231661583 23.801190059502975 90-94 20.84 28.26 27.395000000000003 23.505000000000003 95-99 20.635 28.549999999999997 27.41 23.405 100-104 19.994999999999997 28.249999999999996 27.694999999999997 24.060000000000002 105-109 20.674999999999997 28.555000000000003 26.955000000000002 23.815 110-114 21.279999999999998 27.955000000000002 27.389999999999997 23.375 115-119 20.625 27.76 27.615000000000002 24.0 120-124 20.65 28.134999999999998 27.060000000000002 24.154999999999998 125-129 21.29 27.884999999999998 26.924999999999997 23.9 130-134 21.325 28.485 26.71 23.48 135-139 21.13 27.650000000000002 27.49 23.73 140-144 20.415 27.525 27.485 24.575 145-149 20.345 28.050000000000004 27.265 24.34 150-151 21.1875 27.575 27.150000000000002 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 3.5 25 4.5 26 4.5 27 5.0 28 7.5 29 12.0 30 20.0 31 30.0 32 39.0 33 53.0 34 65.0 35 81.0 36 94.0 37 104.0 38 134.5 39 163.5 40 187.0 41 208.0 42 217.0 43 236.5 44 257.5 45 246.5 46 245.5 47 241.0 48 224.5 49 218.5 50 192.5 51 153.5 52 122.0 53 101.5 54 75.0 55 54.0 56 44.5 57 41.5 58 38.0 59 28.0 60 18.0 61 8.0 62 3.5 63 2.5 64 1.0 65 2.5 66 3.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.015 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.5028916268544128 1.0 3 0.0 0.0 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.5499999999999998 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.8875000000000002 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.5875 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.2375 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 4.85 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0125 0.0 134-135 5.4125 0.0 0.0 0.025 0.0 136-137 5.675 0.0 0.0 0.025 0.0 138-139 5.875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTTT 10 0.0060887975 150.61038 1 CCTGGCT 10 0.0060887975 150.61038 1 GAATGCC 10 0.006836113 144.9625 6 CCTTTTT 10 0.006836113 144.9625 2 TGGCTGT 10 0.006836113 144.9625 3 CTTTTTG 10 0.006836113 144.9625 3 >>END_MODULE SRR7170512 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170512_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9455 33.0 33.0 34.0 32.0 34.0 2 33.0805 34.0 33.0 34.0 32.0 34.0 3 33.06075 34.0 33.0 34.0 33.0 34.0 4 33.04275 34.0 33.0 34.0 33.0 34.0 5 33.02075 34.0 33.0 34.0 33.0 34.0 6 37.2685 38.0 38.0 38.0 37.0 38.0 7 37.2455 38.0 38.0 38.0 37.0 38.0 8 37.245 38.0 38.0 38.0 37.0 38.0 9 37.22525 38.0 38.0 38.0 37.0 38.0 10-14 37.25265 38.0 38.0 38.0 37.0 38.0 15-19 37.2134 38.0 38.0 38.0 37.0 38.0 20-24 37.2137 38.0 38.0 38.0 37.0 38.0 25-29 37.18155 38.0 38.0 38.0 37.0 38.0 30-34 37.16745 38.0 38.0 38.0 37.0 38.0 35-39 37.14035 38.0 38.0 38.0 37.0 38.0 40-44 37.14815 38.0 38.0 38.0 37.0 38.0 45-49 37.1244 38.0 38.0 38.0 37.0 38.0 50-54 37.07465 38.0 38.0 38.0 36.8 38.0 55-59 37.029999999999994 38.0 38.0 38.0 36.2 38.0 60-64 37.042950000000005 38.0 38.0 38.0 36.4 38.0 65-69 36.9344 38.0 38.0 38.0 36.0 38.0 70-74 36.8991 38.0 38.0 38.0 36.0 38.0 75-79 36.7949 38.0 38.0 38.0 36.0 38.0 80-84 36.77329999999999 38.0 38.0 38.0 35.8 38.0 85-89 36.725049999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.600699999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.44029999999999 38.0 38.0 38.0 34.2 38.0 100-104 36.355650000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.248149999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.1107 38.0 37.6 38.0 33.6 38.0 115-119 35.8249 38.0 37.0 38.0 32.6 38.0 120-124 35.5796 38.0 36.6 38.0 31.4 38.0 125-129 34.790949999999995 38.0 35.8 38.0 27.8 38.0 130-134 34.564800000000005 38.0 35.0 38.0 27.2 38.0 135-139 33.984750000000005 38.0 33.8 38.0 23.8 38.0 140-144 33.24015 38.0 33.0 38.0 19.0 38.0 145-149 32.620599999999996 38.0 33.0 38.0 13.8 38.0 150-151 27.241500000000002 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 3.0 12 1.0 13 1.0 14 3.0 15 3.0 16 1.0 17 7.0 18 3.0 19 5.0 20 9.0 21 15.0 22 8.0 23 11.0 24 12.0 25 15.0 26 26.0 27 21.0 28 23.0 29 29.0 30 34.0 31 59.0 32 50.0 33 102.0 34 148.0 35 268.0 36 716.0 37 2415.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.96296296296296 20.745745745745744 15.515515515515515 25.775775775775777 2 25.95095095095095 26.376376376376378 30.655655655655657 17.017017017017018 3 22.197197197197198 27.97797797797798 31.456456456456454 18.36836836836837 4 24.1991991991992 33.108108108108105 22.997997997998 19.694694694694697 5 23.723723723723726 35.91091091091091 21.696696696696698 18.66866866866867 6 20.515386539904927 37.72829622216663 25.268951713785338 16.487365524143108 7 20.590442832124094 21.541155866900176 38.17863397548161 19.68976732549412 8 21.38569284642321 25.887943971985994 27.738869434717362 24.987493746873437 9 21.5607803901951 25.212606303151574 29.739869934967484 23.486743371685844 10-14 23.813097203461904 28.550702886587626 26.344489469208064 21.29171044074241 15-19 22.96952409548116 28.213981884601914 28.279037181604366 20.537456838312565 20-24 23.483483483483482 28.22822822822823 27.34234234234234 20.945945945945947 25-29 23.643643643643646 28.23823823823824 27.557557557557555 20.56056056056056 30-34 23.833833833833832 27.967967967967965 27.007007007007005 21.19119119119119 35-39 23.143143143143146 28.133133133133132 27.7027027027027 21.02102102102102 40-44 23.513513513513516 27.962962962962962 27.677677677677675 20.845845845845844 45-49 23.603603603603602 27.25225225225225 27.90790790790791 21.236236236236238 50-54 23.143143143143146 27.967967967967965 27.652652652652655 21.236236236236238 55-59 23.76876876876877 27.187187187187188 27.66266266266266 21.38138138138138 60-64 23.433433433433436 27.002002002002 27.82782782782783 21.736736736736738 65-69 23.672223056514994 27.276367822996445 27.77193772838765 21.279471392100916 70-74 23.327993592310772 27.6431718061674 27.823388065678817 21.205446535843013 75-79 23.59949937421777 27.20400500625782 27.879849812265334 21.316645807259075 80-84 23.614518147684606 27.664580725907385 27.724655819774718 20.99624530663329 85-89 23.229036295369212 27.694618272841055 27.2991239048811 21.777221526908637 90-94 23.939924906132664 27.18898623279099 27.619524405506883 21.25156445556946 95-99 24.341775953548904 27.740514566022622 27.52027229952948 20.39743718089899 100-104 23.679863857049902 27.438810751288855 27.69407878272186 21.187246608939386 105-109 23.599779768757195 27.97937834726463 27.418789729215675 21.002052154762502 110-114 23.82001101156214 27.819210170679217 27.774162871014564 20.58661594674408 115-119 24.340425531914896 28.215269086357946 27.133917396745932 20.310387984981226 120-124 24.565707133917396 27.914893617021274 27.369211514392994 20.150187734668336 125-129 24.53066332916145 27.83479349186483 27.229036295369212 20.405506883604506 130-134 24.450563204005007 27.639549436795996 27.55944931163955 20.35043804755945 135-139 24.7909887359199 27.48435544430538 27.32916145181477 20.395494367959948 140-144 25.19148936170213 27.469336670838544 26.97371714643304 20.36545682102628 145-149 25.00125156445557 27.734668335419272 27.32415519399249 19.939924906132667 150-151 25.453635339757223 27.01789513202353 26.867726191965964 20.660743336253283 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 1.5 23 2.0 24 1.0 25 1.5 26 3.0 27 3.0 28 4.0 29 6.0 30 9.0 31 18.5 32 23.0 33 22.5 34 34.0 35 56.0 36 83.0 37 108.0 38 124.5 39 141.5 40 190.5 41 228.5 42 245.0 43 252.0 44 260.0 45 268.0 46 268.5 47 270.5 48 253.0 49 218.0 50 177.0 51 148.5 52 123.5 53 100.5 54 85.5 55 71.0 56 56.0 57 41.0 58 24.0 59 21.5 60 19.0 61 12.0 62 9.0 63 4.0 64 1.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.1 6 0.075 7 0.075 8 0.05 9 0.05 10-14 0.055 15-19 0.08499999999999999 20-24 0.1 25-29 0.1 30-34 0.1 35-39 0.1 40-44 0.1 45-49 0.1 50-54 0.1 55-59 0.1 60-64 0.1 65-69 0.11499999999999999 70-74 0.12 75-79 0.125 80-84 0.125 85-89 0.125 90-94 0.125 95-99 0.11 100-104 0.105 105-109 0.105 110-114 0.105 115-119 0.125 120-124 0.125 125-129 0.125 130-134 0.125 135-139 0.125 140-144 0.125 145-149 0.125 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14163090128756 98.175 2 0.7826306488260539 1.55 3 0.050492299924261554 0.15 4 0.0 0.0 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.4500000000000002 0.0 0.0 0.0 0.0 104-105 1.5750000000000002 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.3375000000000004 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 3.0250000000000004 0.0 0.0 0.0 0.0 118-119 3.2875 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.8499999999999996 0.0 0.0 0.0 0.0 124-125 4.075 0.0 0.0 0.0 0.0 126-127 4.2625 0.0 0.0 0.0 0.0 128-129 4.612500000000001 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.2125 0.0 0.0 0.0 0.0 134-135 5.45 0.0 0.0 0.0 0.0 136-137 5.75 0.0 0.0 0.0 0.0 138-139 5.949999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCACA 10 0.006830828 145.0 9 CATGGTT 10 0.006830828 145.0 4 TTGCCAT 10 0.006830828 145.0 6 >>END_MODULE Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720854 spots for SRR7170512.sra Written 720854 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra Read 720847 spots for SRR7170512.sra Written 720847 spots for SRR7170512.sra SRR ids: ['SRR7170512.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fj8wvecc SRR7170512.sra spots: 14416947 blocks: [[1, 720847], [720848, 1441694], [1441695, 2162541], [2162542, 2883388], [2883389, 3604235], [3604236, 4325082], [4325083, 5045929], [5045930, 5766776], [5766777, 6487623], [6487624, 7208470], [7208471, 7929317], [7929318, 8650164], [8650165, 9371011], [9371012, 10091858], [10091859, 10812705], [10812706, 11533552], [11533553, 12254399], [12254400, 12975246], [12975247, 13696093], [13696094, 14416947]] SRR7170512 file size 4863729 SRR7170512 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170512 SRR7170512_1.fastq SRR7170512_2.fastq Input file: SRR7170512_1.fastq Paired file: SRR7170512_2.fastq trimmed: SRR7170512-trimmed-pair1.fastq, SRR7170512-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:41:38 2025 >> started Thu Feb 13 06:42:01 2025 >> done (22.944s) 14416947 read pairs processed; of these: 13953 ( 0.10%) short read pairs filtered out after trimming by size control 21587 ( 0.15%) empty read pairs filtered out after trimming by size control 14381407 (99.75%) read pairs available; of these: 9497240 (66.04%) trimmed read pairs available after processing 4884167 (33.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 0 0.00% 23 4 0.00% 24 3 0.00% 25 1 0.00% 26 4 0.00% 27 11 0.00% 28 7 0.00% 29 5 0.00% 30 6 0.00% 31 19 0.00% 32 4 0.00% 33 9 0.00% 34 10 0.00% 35 18 0.00% 36 21 0.00% 37 19 0.00% 38 17 0.00% 39 19 0.00% 40 27 0.00% 41 33 0.00% 42 26 0.00% 43 44 0.00% 44 42 0.00% 45 36 0.00% 46 55 0.00% 47 53 0.00% 48 81 0.00% 49 79 0.00% 50 105 0.00% 51 131 0.00% 52 141 0.00% 53 160 0.00% 54 165 0.00% 55 160 0.00% 56 199 0.00% 57 243 0.00% 58 248 0.00% 59 300 0.00% 60 347 0.00% 61 456 0.00% 62 470 0.00% 63 556 0.00% 64 593 0.00% 65 635 0.00% 66 697 0.00% 67 777 0.01% 68 891 0.01% 69 952 0.01% 70 1190 0.01% 71 1327 0.01% 72 1573 0.01% 73 1705 0.01% 74 1837 0.01% 75 2066 0.01% 76 2210 0.02% 77 2490 0.02% 78 2612 0.02% 79 2838 0.02% 80 3156 0.02% 81 3645 0.03% 82 4203 0.03% 83 4868 0.03% 84 6006 0.04% 85 6223 0.04% 86 6443 0.04% 87 6667 0.05% 88 7025 0.05% 89 7144 0.05% 90 7663 0.05% 91 8494 0.06% 92 8821 0.06% 93 9828 0.07% 94 10431 0.07% 95 11003 0.08% 96 11599 0.08% 97 11908 0.08% 98 12641 0.09% 99 12972 0.09% 100 13324 0.09% 101 13832 0.10% 102 14875 0.10% 103 15656 0.11% 104 16325 0.11% 105 17183 0.12% 106 18006 0.13% 107 18370 0.13% 108 18752 0.13% 109 19185 0.13% 110 19507 0.14% 111 20020 0.14% 112 20972 0.15% 113 21718 0.15% 114 22943 0.16% 115 24114 0.17% 116 24977 0.17% 117 25581 0.18% 118 26420 0.18% 119 26962 0.19% 120 28173 0.20% 121 29236 0.20% 122 30638 0.21% 123 31980 0.22% 124 33875 0.24% 125 36108 0.25% 126 37908 0.26% 127 40049 0.28% 128 41767 0.29% 129 44364 0.31% 130 46793 0.33% 131 49693 0.35% 132 53359 0.37% 133 57363 0.40% 134 62028 0.43% 135 67175 0.47% 136 73051 0.51% 137 80296 0.56% 138 87583 0.61% 139 96543 0.67% 140 108176 0.75% 141 121248 0.84% 142 139540 0.97% 143 164258 1.14% 144 197970 1.38% 145 247118 1.72% 146 323862 2.25% 147 452838 3.15% 148 697119 4.85% 149 1314273 9.14% 150 4114659 28.61% 151 4884167 33.96% 14381407 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=19 prefix-density=0.64 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=48.55 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=24 prefix-density=0.51 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=83.31 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.2 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170512 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:42:48 Started mapping on | Feb 13 06:42:48 Finished on | Feb 13 06:44:59 Mapping speed, Million of reads per hour | 395.21 Number of input reads | 14381407 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13138500 Uniquely mapped reads % | 91.36% Average mapped length | 291.93 Number of splices: Total | 12593199 Number of splices: Annotated (sjdb) | 12321946 Number of splices: GT/AG | 12355011 Number of splices: GC/AG | 192647 Number of splices: AT/AC | 7531 Number of splices: Non-canonical | 38010 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338073 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 32135 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.01% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 914413 914413 914413 N_multimapping 338073 338073 338073 N_noFeature 387992 12902791 450327 N_ambiguous 270861 985 97046 UnstrandedReadsAssigned:12479647 PositiveStrandReadsAssigned:234724 NegativeStrandReadsAssigned:12591127 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR7170512 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170512-trimmed-pair1.fastq SRR7170512-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,381,407 reads, 12,542,110 reads pseudoaligned [quant] estimated average fragment length: 265.335 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR7170512.ke.tsv 34699 SRR7170512.se.tsv 87100 total ==> SRR7170512.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.66 466 18.056 Potri.005G024800.1.v4.1 1035 770.665 68 5.99549 Potri.004G059700.1.v4.1 961 696.681 13 1.26792 Potri.007G009000.2.v4.1 1416 1151.66 0 0 Potri.003G141000.2.v4.1 2943 2678.66 703.418 17.8434 Potri.016G087400.1.v4.1 270 77.3153 672 590.589 Potri.015G069301.1.v4.1 564 303.929 0 0 Potri.010G195200.1.v4.1 1773 1508.66 18 0.810702 Potri.012G127500.1.v4.1 977 712.665 64 6.10206 ==> SRR7170512.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 744 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 336 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170512 completed mapping pipeline successfully