Starting /dee2/code/volunteer_pipeline.sh SRR7170513 current disk space = 3052654403584 free memory = 1582214380 SRR7170513 SRAfilesize c7c5757a032f59b6e20e77258cba9130 SRR7170513.sra SRR7170513.sra file validated SRR7170513 is paired end SRR7170513 is conventional basespace SRR7170513 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170513_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.489 18.0 18.0 18.0 18.0 32.0 2 24.82825 27.0 18.0 27.0 18.0 29.0 3 24.79625 25.0 18.0 29.0 18.0 31.0 4 28.71025 29.0 27.0 31.0 25.0 33.0 5 30.5405 32.0 31.0 33.0 27.0 33.0 6 35.3905 37.0 35.0 38.0 31.0 38.0 7 37.0135 38.0 37.0 38.0 35.0 38.0 8 37.177 38.0 38.0 38.0 36.0 38.0 9 37.42 38.0 38.0 38.0 36.0 38.0 10-14 37.554449999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.590250000000005 38.0 38.0 38.0 37.6 38.0 20-24 37.6887 38.0 38.0 38.0 38.0 38.0 25-29 37.6754 38.0 38.0 38.0 38.0 38.0 30-34 37.63485000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.61595 38.0 38.0 38.0 38.0 38.0 40-44 37.5609 38.0 38.0 38.0 37.8 38.0 45-49 37.579350000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.4293 38.0 38.0 38.0 37.0 38.0 55-59 37.402100000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.35039999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.2915 38.0 38.0 38.0 36.6 38.0 70-74 37.1769 38.0 38.0 38.0 36.0 38.0 75-79 36.86875 38.0 38.0 38.0 36.0 38.0 80-84 36.73055 38.0 38.0 38.0 35.8 38.0 85-89 36.64785 38.0 38.0 38.0 35.0 38.0 90-94 36.6161 38.0 38.0 38.0 35.0 38.0 95-99 36.495000000000005 38.0 38.0 38.0 34.6 38.0 100-104 36.225649999999995 38.0 37.6 38.0 33.8 38.0 105-109 36.0986 38.0 37.2 38.0 33.8 38.0 110-114 35.98350000000001 38.0 37.0 38.0 33.4 38.0 115-119 35.76754999999999 38.0 37.0 38.0 32.2 38.0 120-124 35.5963 38.0 36.4 38.0 31.2 38.0 125-129 35.26005 38.0 36.0 38.0 30.2 38.0 130-134 35.0212 38.0 35.6 38.0 29.0 38.0 135-139 34.61559999999999 38.0 34.4 38.0 28.4 38.0 140-144 33.94005 38.0 33.2 38.0 24.4 38.0 145-149 32.94755 38.0 33.0 38.0 18.0 38.0 150-151 27.201875 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 6.0 19 33.0 20 2.0 21 5.0 22 5.0 23 3.0 24 3.0 25 10.0 26 8.0 27 11.0 28 19.0 29 19.0 30 31.0 31 49.0 32 70.0 33 110.0 34 175.0 35 395.0 36 1321.0 37 1720.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.56153050672182 33.63495346432265 9.126163391933815 35.67735263702171 2 25.4 16.950000000000003 30.975 26.674999999999997 3 24.75 18.5 25.674999999999997 31.075000000000003 4 22.125 26.775 22.55 28.549999999999997 5 23.925 31.1 23.549999999999997 21.425 6 20.724999999999998 35.3 23.875 20.1 7 13.750000000000002 28.275 40.975 17.0 8 17.2 27.425 30.25 25.124999999999996 9 17.775 25.674999999999997 33.25 23.3 10-14 19.21 31.165 27.089999999999996 22.535 15-19 19.365 29.659999999999997 27.105 23.87 20-24 19.509999999999998 30.195 26.86 23.435 25-29 19.040000000000003 29.54 27.96 23.46 30-34 19.28289243386508 29.524428664299645 27.17907686152923 24.013602040306044 35-39 19.817972695904384 29.28939340901135 27.60914137120568 23.283492523878582 40-44 18.895 29.625 27.544999999999998 23.935000000000002 45-49 19.915 28.84 27.43 23.815 50-54 19.85 29.104999999999997 27.55 23.494999999999997 55-59 19.59 29.235 28.02 23.155 60-64 19.585 29.134999999999998 27.735 23.544999999999998 65-69 19.759999999999998 30.220000000000002 27.205000000000002 22.814999999999998 70-74 19.400000000000002 29.880000000000003 27.185 23.535 75-79 19.510853255976794 29.793938181454436 27.213163949184754 23.482044613384016 80-84 19.770931279383817 29.583875162548768 27.058117435230567 23.58707612283685 85-89 20.044999999999998 28.455000000000002 27.589999999999996 23.91 90-94 20.035 28.515 27.51 23.94 95-99 20.34 28.21 27.779999999999998 23.669999999999998 100-104 20.380000000000003 28.9 27.195000000000004 23.525 105-109 20.19 28.655 27.015 24.14 110-114 20.565 28.660000000000004 27.32 23.455000000000002 115-119 20.29 28.38 27.445000000000004 23.885 120-124 20.27 28.849999999999998 27.0 23.880000000000003 125-129 20.695 28.7 26.75 23.855 130-134 21.044999999999998 28.244999999999997 26.484999999999996 24.224999999999998 135-139 20.880000000000003 28.485 27.305 23.330000000000002 140-144 20.855 28.17 27.37 23.605 145-149 20.185 28.599999999999998 26.515 24.7 150-151 20.3125 27.8625 26.875 24.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 1.5 23 3.5 24 4.0 25 4.5 26 7.0 27 14.0 28 18.0 29 20.0 30 28.0 31 34.5 32 42.0 33 59.5 34 77.0 35 111.5 36 138.5 37 141.0 38 154.0 39 180.0 40 197.5 41 215.5 42 222.5 43 212.0 44 222.0 45 233.5 46 231.5 47 218.0 48 191.5 49 179.5 50 163.5 51 140.0 52 120.0 53 95.5 54 81.5 55 63.0 56 51.0 57 40.5 58 26.5 59 20.5 60 13.0 61 7.0 62 4.5 63 2.0 64 1.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.03 80-84 0.03 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.10737056873246 97.15 2 0.612088752869166 1.2 3 0.204029584289722 0.6 4 0.0 0.0 5 0.02550369803621525 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0510073960724305 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 20 0.5 TruSeq Adapter, Index 12 (97% over 35bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 17 0.42500000000000004 TruSeq Adapter, Index 19 (97% over 38bp) GGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.8250000000000002 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.775 0.0 0.0 0.0 0.0 120-121 3.15 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 3.8 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.725 0.0 0.0 0.0 0.0 132-133 5.1125 0.0 0.0 0.0 0.0 134-135 5.4125 0.0 0.0 0.0 0.0 136-137 5.7125 0.0 0.0 0.0 0.0 138-139 6.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 135 8.674824E-4 9.665 75-79 >>END_MODULE SRR7170513 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170513_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76525 33.0 33.0 34.0 32.0 34.0 2 32.959 34.0 33.0 34.0 32.0 34.0 3 32.955 34.0 33.0 34.0 32.0 34.0 4 32.872 34.0 33.0 34.0 32.0 34.0 5 32.96225 34.0 33.0 34.0 32.0 34.0 6 37.0935 38.0 38.0 38.0 37.0 38.0 7 37.097 38.0 38.0 38.0 37.0 38.0 8 37.1355 38.0 38.0 38.0 37.0 38.0 9 37.109 38.0 38.0 38.0 37.0 38.0 10-14 37.0654 38.0 38.0 38.0 37.0 38.0 15-19 37.0407 38.0 38.0 38.0 37.0 38.0 20-24 37.04515 38.0 38.0 38.0 37.0 38.0 25-29 37.0025 38.0 38.0 38.0 36.8 38.0 30-34 36.9741 38.0 38.0 38.0 36.6 38.0 35-39 36.966849999999994 38.0 38.0 38.0 36.8 38.0 40-44 36.962450000000004 38.0 38.0 38.0 36.4 38.0 45-49 36.945049999999995 38.0 38.0 38.0 36.8 38.0 50-54 36.89455 38.0 38.0 38.0 36.0 38.0 55-59 36.80475 38.0 38.0 38.0 36.0 38.0 60-64 36.73735 38.0 38.0 38.0 35.8 38.0 65-69 36.73245 38.0 38.0 38.0 36.0 38.0 70-74 36.6774 38.0 38.0 38.0 35.6 38.0 75-79 36.59595 38.0 38.0 38.0 35.2 38.0 80-84 36.246849999999995 38.0 38.0 38.0 34.8 38.0 85-89 36.24165 38.0 38.0 38.0 34.2 38.0 90-94 36.13905 38.0 38.0 38.0 34.0 38.0 95-99 35.961850000000005 38.0 38.0 38.0 33.8 38.0 100-104 35.8364 38.0 37.8 38.0 33.4 38.0 105-109 35.722849999999994 38.0 37.2 38.0 32.8 38.0 110-114 35.48435 38.0 37.0 38.0 31.4 38.0 115-119 35.34625 38.0 37.0 38.0 31.0 38.0 120-124 35.0186 38.0 36.4 38.0 29.4 38.0 125-129 34.61635 38.0 35.8 38.0 27.0 38.0 130-134 34.02905 38.0 34.0 38.0 23.4 38.0 135-139 33.2565 38.0 33.0 38.0 19.8 38.0 140-144 32.74855 38.0 33.0 38.0 15.6 38.0 145-149 31.784249999999997 38.0 33.0 38.0 8.4 38.0 150-151 26.0225 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 2.0 5 3.0 6 3.0 7 3.0 8 1.0 9 1.0 10 4.0 11 1.0 12 3.0 13 2.0 14 3.0 15 2.0 16 2.0 17 4.0 18 10.0 19 12.0 20 25.0 21 10.0 22 11.0 23 11.0 24 13.0 25 14.0 26 11.0 27 20.0 28 30.0 29 43.0 30 36.0 31 46.0 32 68.0 33 120.0 34 167.0 35 303.0 36 737.0 37 2261.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.24362181090545 21.260630315157577 15.632816408204103 25.86293146573287 2 28.039019509754876 26.638319159579787 28.789394697348676 16.53326663331666 3 21.635817908954476 28.039019509754876 30.490245122561284 19.834917458729365 4 23.21160580290145 34.14207103551776 22.71135567783892 19.93496748374187 5 24.893670252689517 36.00200150112585 21.891418563922944 17.212909682261696 6 21.50537634408602 37.634408602150536 23.080770192548137 17.779444861215303 7 19.529882470617654 23.330832708177045 37.4593648412103 19.679919979995 8 22.475 27.175 26.3 24.05 9 22.9057264316079 26.431607901975497 28.882220555138783 21.780445111277817 10-14 24.027402740274027 29.36293629362936 25.012501250125013 21.597159715971596 15-19 24.133446706347222 28.419946981443506 26.79437803231131 20.65222827989796 20-24 24.22711355677839 28.31415707853927 27.253626813406704 20.20510255127564 25-29 23.33166583291646 28.419209604802404 27.448724362181093 20.80040020010005 30-34 23.14272850067537 27.86032317774776 27.825303917154436 21.171644404422434 35-39 23.680392254965728 27.577925651673592 26.852454095161853 21.88922799819883 40-44 23.916958479239618 28.054027013506754 27.63881940970485 20.390195097548773 45-49 23.326663331665834 28.3591795897949 27.668834417208604 20.645322661330663 50-54 23.271635817908955 27.893946973486745 27.57878939469735 21.25562781390695 55-59 24.58729364682341 27.283641820910454 27.463731865932967 20.665332666333168 60-64 23.41670835417709 27.32866433216608 27.973986993496748 21.280640320160078 65-69 23.58533046480212 27.703006954520436 27.993195577125128 20.71846700355231 70-74 23.767825869402053 28.17613209907431 27.405554165624217 20.650487865899425 75-79 23.18238679009257 28.45133850387791 27.380535401551164 20.98573930447836 80-84 24.008006004503375 28.056042031523642 26.870152614460846 21.065799349512133 85-89 23.74781085814361 28.10607955966975 27.150362772079063 20.99574681010758 90-94 24.29822366775081 27.935951963972975 27.305479109331998 20.46034525894421 95-99 23.24627239067347 28.169718803162212 27.879515660962674 20.704493145201642 100-104 24.243333833608485 27.865325929261093 27.365050777927863 20.526289459202562 105-109 24.29957974784871 28.14188513107865 27.531518911346808 20.027016209725833 110-114 23.775454045129337 28.48851753639866 27.212688247360784 20.523340171111222 115-119 24.468351263447584 28.391293470102575 26.730047535651742 20.4103077307981 120-124 23.71278458844133 28.16112084063047 27.595696772579437 20.530397798348762 125-129 23.897923442581938 27.630723042281712 27.59069301976482 20.88066049537153 130-134 24.568426319739807 27.47060295221416 27.480610457843387 20.480360270202652 135-139 24.978734050537906 27.32049036777583 27.835876907680763 19.864898674005506 140-144 25.00375281461096 27.120340255191394 28.326244683512634 19.549662246685013 145-149 25.133850387790847 27.450587940955717 27.21040780585439 20.20515386539905 150-151 24.54340755566675 27.220415311483613 27.983487615711784 20.252689517137853 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 2.0 24 2.5 25 1.5 26 3.0 27 5.0 28 6.5 29 6.5 30 10.5 31 16.5 32 24.0 33 31.0 34 44.0 35 61.0 36 74.5 37 97.5 38 119.0 39 148.0 40 178.5 41 205.0 42 255.0 43 296.0 44 294.0 45 266.0 46 251.0 47 249.0 48 230.0 49 214.5 50 181.5 51 141.5 52 121.0 53 99.5 54 83.0 55 75.0 56 59.5 57 40.5 58 33.0 59 25.5 60 14.0 61 7.0 62 6.5 63 6.5 64 5.0 65 1.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.075 6 0.025 7 0.025 8 0.0 9 0.025 10-14 0.01 15-19 0.034999999999999996 20-24 0.05 25-29 0.05 30-34 0.055 35-39 0.065 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.065 70-74 0.075 75-79 0.075 80-84 0.075 85-89 0.075 90-94 0.075 95-99 0.06999999999999999 100-104 0.055 105-109 0.06 110-114 0.065 115-119 0.075 120-124 0.075 125-129 0.075 130-134 0.075 135-139 0.075 140-144 0.075 145-149 0.075 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.87092635360534 96.325 2 0.8981267641775725 1.7500000000000002 3 0.051321529381575574 0.15 4 0.051321529381575574 0.2 5 0.025660764690787787 0.125 6 0.0 0.0 7 0.051321529381575574 0.35000000000000003 8 0.0 0.0 9 0.025660764690787787 0.22499999999999998 >10 0.025660764690787787 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 35 0.8750000000000001 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.5375 0.0 0.0 0.0 0.0 124-125 3.8 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.45 0.0 0.0 0.0 0.0 130-131 4.7625 0.0 0.0 0.0 0.0 132-133 5.1125 0.0 0.0 0.0 0.0 134-135 5.425000000000001 0.0 0.0 0.0 0.0 136-137 5.725 0.0 0.0 0.0 0.0 138-139 6.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCATA 10 0.006830828 145.0 9 GGACCTG 10 0.006830828 145.0 4 GGCGTCA 10 0.006830828 145.0 7 AGGCGTC 10 0.006830828 145.0 6 CCACAGG 10 0.006830828 145.0 2 TGGACCT 15 1.1411342E-4 145.0 3 GCCACAG 10 0.006830828 145.0 1 CAGGCGT 10 0.006830828 145.0 5 ACAGGCG 10 0.006830828 145.0 4 >>END_MODULE Read 606937 spots for SRR7170513.sra Written 606937 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra Read 606929 spots for SRR7170513.sra Written 606929 spots for SRR7170513.sra SRR ids: ['SRR7170513.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mhzf2b69 SRR7170513.sra spots: 12138588 blocks: [[1, 606929], [606930, 1213858], [1213859, 1820787], [1820788, 2427716], [2427717, 3034645], [3034646, 3641574], [3641575, 4248503], [4248504, 4855432], [4855433, 5462361], [5462362, 6069290], [6069291, 6676219], [6676220, 7283148], [7283149, 7890077], [7890078, 8497006], [8497007, 9103935], [9103936, 9710864], [9710865, 10317793], [10317794, 10924722], [10924723, 11531651], [11531652, 12138588]] SRR7170513 file size 4091668 SRR7170513 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170513 SRR7170513_1.fastq SRR7170513_2.fastq Input file: SRR7170513_1.fastq Paired file: SRR7170513_2.fastq trimmed: SRR7170513-trimmed-pair1.fastq, SRR7170513-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:07:05 2025 >> started Thu Feb 13 09:19:35 2025 >> done (750.094s) 12138588 read pairs processed; of these: 20018 ( 0.16%) short read pairs filtered out after trimming by size control 113570 ( 0.94%) empty read pairs filtered out after trimming by size control 12005000 (98.90%) read pairs available; of these: 7416877 (61.78%) trimmed read pairs available after processing 4588123 (38.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 2 0.00% 21 13 0.00% 22 5 0.00% 23 8 0.00% 24 1 0.00% 25 3 0.00% 26 8 0.00% 27 5 0.00% 28 11 0.00% 29 3 0.00% 30 6 0.00% 31 18 0.00% 32 10 0.00% 33 7 0.00% 34 15 0.00% 35 23 0.00% 36 17 0.00% 37 14 0.00% 38 37 0.00% 39 33 0.00% 40 38 0.00% 41 32 0.00% 42 27 0.00% 43 32 0.00% 44 36 0.00% 45 45 0.00% 46 77 0.00% 47 91 0.00% 48 89 0.00% 49 95 0.00% 50 109 0.00% 51 120 0.00% 52 138 0.00% 53 115 0.00% 54 160 0.00% 55 172 0.00% 56 193 0.00% 57 203 0.00% 58 224 0.00% 59 261 0.00% 60 315 0.00% 61 381 0.00% 62 385 0.00% 63 475 0.00% 64 469 0.00% 65 547 0.00% 66 574 0.00% 67 617 0.01% 68 651 0.01% 69 755 0.01% 70 955 0.01% 71 1035 0.01% 72 1169 0.01% 73 1362 0.01% 74 1570 0.01% 75 1902 0.02% 76 2294 0.02% 77 2738 0.02% 78 2496 0.02% 79 2451 0.02% 80 2532 0.02% 81 2888 0.02% 82 3459 0.03% 83 3907 0.03% 84 5198 0.04% 85 5524 0.05% 86 5497 0.05% 87 5917 0.05% 88 6091 0.05% 89 6311 0.05% 90 6868 0.06% 91 7142 0.06% 92 7502 0.06% 93 8248 0.07% 94 9094 0.08% 95 9657 0.08% 96 9764 0.08% 97 10216 0.09% 98 10308 0.09% 99 10761 0.09% 100 11470 0.10% 101 11814 0.10% 102 12502 0.10% 103 13556 0.11% 104 14277 0.12% 105 15046 0.13% 106 15729 0.13% 107 15907 0.13% 108 16255 0.14% 109 16828 0.14% 110 17241 0.14% 111 17609 0.15% 112 18410 0.15% 113 19263 0.16% 114 20111 0.17% 115 21160 0.18% 116 21730 0.18% 117 22298 0.19% 118 22661 0.19% 119 22934 0.19% 120 23763 0.20% 121 24496 0.20% 122 25291 0.21% 123 26638 0.22% 124 27771 0.23% 125 29082 0.24% 126 30340 0.25% 127 31565 0.26% 128 32707 0.27% 129 34261 0.29% 130 36377 0.30% 131 38172 0.32% 132 40963 0.34% 133 43951 0.37% 134 46400 0.39% 135 49840 0.42% 136 53128 0.44% 137 58525 0.49% 138 63684 0.53% 139 68987 0.57% 140 76389 0.64% 141 86183 0.72% 142 97882 0.82% 143 112868 0.94% 144 137424 1.14% 145 168721 1.41% 146 222045 1.85% 147 316990 2.64% 148 496528 4.14% 149 976925 8.14% 150 3429650 28.57% 151 4588123 38.22% 12005000 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=30 prefix-density=0.48 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=349.75 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=16.8 sequence=ATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=21 prefix-density=0.49 prefix-fanout=2.2 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=19.49 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.8 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7170513 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:33:14 Started mapping on | Feb 13 10:33:29 Finished on | Feb 13 11:05:41 Mapping speed, Million of reads per hour | 22.37 Number of input reads | 12005000 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 10469731 Uniquely mapped reads % | 87.21% Average mapped length | 292.22 Number of splices: Total | 9620662 Number of splices: Annotated (sjdb) | 9399723 Number of splices: GT/AG | 9444252 Number of splices: GC/AG | 139615 Number of splices: AT/AC | 6103 Number of splices: Non-canonical | 30692 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297221 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 17113 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.09% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1249130 1249130 1249130 N_multimapping 297221 297221 297221 N_noFeature 294602 10182580 353603 N_ambiguous 316633 730 88354 UnstrandedReadsAssigned:9858496 PositiveStrandReadsAssigned:286421 NegativeStrandReadsAssigned:10027774 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170513 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170513-trimmed-pair1.fastq SRR7170513-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,005,000 reads, 9,930,531 reads pseudoaligned [quant] estimated average fragment length: 254.779 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR7170513.ke.tsv 34699 SRR7170513.se.tsv 87100 total ==> SRR7170513.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.22 505 18.6425 Potri.005G024800.1.v4.1 1035 781.221 580 48.3527 Potri.004G059700.1.v4.1 961 707.226 2 0.184178 Potri.007G009000.2.v4.1 1416 1162.22 0 0 Potri.003G141000.2.v4.1 2943 2689.22 437 10.5833 Potri.016G087400.1.v4.1 270 77.5934 1166.49 979.086 Potri.015G069301.1.v4.1 564 313.339 0 0 Potri.010G195200.1.v4.1 1773 1519.22 184 7.88793 Potri.012G127500.1.v4.1 977 723.226 189 17.0198 ==> SRR7170513.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 473 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 356 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 73 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170513 completed mapping pipeline successfully