Starting /dee2/code/volunteer_pipeline.sh SRR7170514 current disk space = 3052674801664 free memory = 1582148232 SRR7170514 SRAfilesize a6bd768c3081237d992c61bc82313114 SRR7170514.sra SRR7170514.sra file validated SRR7170514 is paired end SRR7170514 is conventional basespace SRR7170514 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170514_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.43975 18.0 18.0 18.0 18.0 28.0 2 24.585 27.0 18.0 27.0 18.0 29.0 3 25.7835 27.0 25.0 29.0 18.0 31.0 4 29.4055 30.0 29.0 31.0 27.0 33.0 5 30.6935 32.0 31.0 33.0 27.0 33.0 6 35.7195 37.0 35.0 38.0 33.0 38.0 7 36.77 38.0 37.0 38.0 34.0 38.0 8 36.765 38.0 37.0 38.0 34.0 38.0 9 37.04625 38.0 38.0 38.0 35.0 38.0 10-14 37.378249999999994 38.0 38.0 38.0 36.6 38.0 15-19 37.4696 38.0 38.0 38.0 37.0 38.0 20-24 37.2344 38.0 38.0 38.0 36.0 38.0 25-29 36.6379 38.0 37.6 38.0 34.0 38.0 30-34 37.476150000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.54255 38.0 38.0 38.0 37.2 38.0 40-44 36.86625 38.0 37.8 38.0 34.8 38.0 45-49 34.75064999999999 37.8 33.6 38.0 25.0 38.0 50-54 37.099000000000004 38.0 37.8 38.0 35.6 38.0 55-59 37.287850000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.135149999999996 38.0 38.0 38.0 35.8 38.0 65-69 37.030800000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.9919 38.0 38.0 38.0 36.0 38.0 75-79 36.9514 38.0 38.0 38.0 35.4 38.0 80-84 36.8314 38.0 38.0 38.0 34.8 38.0 85-89 36.577549999999995 38.0 37.8 38.0 34.0 38.0 90-94 36.31179999999999 38.0 37.4 38.0 33.8 38.0 95-99 36.47045000000001 38.0 37.2 38.0 34.0 38.0 100-104 36.455949999999994 38.0 37.0 38.0 34.0 38.0 105-109 36.3246 38.0 37.0 38.0 33.6 38.0 110-114 35.84965 38.0 36.4 38.0 31.6 38.0 115-119 35.4208 38.0 35.6 38.0 29.4 38.0 120-124 35.27705 38.0 35.8 38.0 28.6 38.0 125-129 35.164300000000004 38.0 35.2 38.0 28.6 38.0 130-134 34.892700000000005 38.0 34.8 38.0 28.0 38.0 135-139 34.10665 38.0 33.2 38.0 24.8 38.0 140-144 28.8693 33.4 23.4 37.0 16.2 38.0 145-149 25.79805 31.8 15.2 37.6 2.0 38.0 150-151 16.4345 11.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 0.0 14 2.0 15 1.0 16 0.0 17 1.0 18 2.0 19 3.0 20 1.0 21 1.0 22 1.0 23 3.0 24 4.0 25 13.0 26 20.0 27 21.0 28 33.0 29 32.0 30 49.0 31 102.0 32 160.0 33 248.0 34 425.0 35 971.0 36 1503.0 37 400.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 11.659422142674508 52.083866018920986 7.18486320634109 29.071848632063414 2 22.225 15.425 34.425 27.925 3 21.25 20.875 25.174999999999997 32.7 4 23.0 29.7 22.275 25.025 5 22.650000000000002 34.150000000000006 23.200000000000003 20.0 6 19.400000000000002 36.05 24.349999999999998 20.200000000000003 7 13.25 26.325 41.65 18.775 8 17.4 26.075 30.625000000000004 25.900000000000002 9 16.6 24.425 34.325 24.65 10-14 19.3 30.349999999999998 27.200000000000003 23.150000000000002 15-19 19.900000000000002 29.24 27.445000000000004 23.415 20-24 19.98 29.12 27.915 22.985 25-29 19.435 29.12 27.689999999999998 23.755000000000003 30-34 19.805 29.24 27.474999999999998 23.48 35-39 19.31 29.044999999999998 27.73 23.915 40-44 19.275000000000002 29.604999999999997 27.565 23.555 45-49 20.235 28.84 27.705000000000002 23.22 50-54 19.835 29.255 27.77 23.14 55-59 19.915 28.815 27.72 23.549999999999997 60-64 20.28 28.610000000000003 27.515 23.595 65-69 20.225 28.775000000000002 26.974999999999998 24.025 70-74 20.22101105055253 28.34141707085354 28.081404070203508 23.356167808390417 75-79 19.73 28.115000000000002 28.28 23.875 80-84 20.225 28.705000000000002 27.775 23.294999999999998 85-89 20.080000000000002 28.410000000000004 28.000000000000004 23.51 90-94 19.881988198819883 28.657865786578657 27.73777377737774 23.72237223722372 95-99 19.91099554977749 28.936446822341118 27.77638881944097 23.376168808440422 100-104 20.369999999999997 28.005000000000003 27.775 23.849999999999998 105-109 20.345 28.365000000000002 27.665 23.625 110-114 20.77 28.415000000000003 27.744999999999997 23.07 115-119 20.925 28.405 27.675 22.994999999999997 120-124 20.3 28.26 27.6 23.84 125-129 20.705000000000002 28.439999999999998 27.655 23.200000000000003 130-134 20.575 28.125 27.3 24.0 135-139 20.990000000000002 28.48 27.41 23.119999999999997 140-144 20.54 28.035 27.744999999999997 23.68 145-149 20.32 28.754999999999995 26.805 24.12 150-151 20.6375 28.1125 27.800000000000004 23.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.0 22 1.5 23 2.0 24 4.5 25 5.5 26 4.5 27 6.5 28 9.5 29 13.5 30 22.0 31 35.5 32 40.5 33 50.0 34 72.5 35 82.0 36 98.0 37 131.5 38 157.0 39 195.0 40 214.0 41 222.0 42 231.0 43 247.0 44 284.0 45 281.0 46 268.0 47 234.5 48 204.0 49 192.0 50 147.5 51 118.5 52 97.5 53 74.5 54 64.0 55 51.5 56 36.5 57 26.5 58 25.0 59 16.5 60 9.5 61 5.5 62 2.5 63 2.5 64 1.5 65 0.5 66 0.5 67 2.5 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.325 0.0 0.0 0.0 0.0 128-129 3.5 0.0 0.0 0.0 0.0 130-131 3.8 0.0 0.0 0.0 0.0 132-133 4.2 0.0 0.0 0.0 0.0 134-135 4.4 0.0 0.0 0.0 0.0 136-137 4.487500000000001 0.0 0.0 0.0 0.0 138-139 4.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATAT 10 0.006836113 144.9625 3 AGAAAGA 10 0.006836113 144.9625 145 >>END_MODULE SRR7170514 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170514_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05575 33.0 33.0 34.0 32.0 34.0 2 33.13225 34.0 33.0 34.0 33.0 34.0 3 33.1465 34.0 33.0 34.0 33.0 34.0 4 33.05825 34.0 33.0 34.0 32.0 34.0 5 33.0955 34.0 33.0 34.0 33.0 34.0 6 37.23875 38.0 38.0 38.0 37.0 38.0 7 37.359 38.0 38.0 38.0 37.0 38.0 8 37.27175 38.0 38.0 38.0 37.0 38.0 9 37.31875 38.0 38.0 38.0 37.0 38.0 10-14 36.63244999999999 38.0 37.2 38.0 32.8 38.0 15-19 36.89175 38.0 37.8 38.0 35.0 38.0 20-24 36.916700000000006 38.0 38.0 38.0 36.2 38.0 25-29 36.9884 38.0 38.0 38.0 36.2 38.0 30-34 37.1605 38.0 38.0 38.0 37.0 38.0 35-39 37.110200000000006 38.0 38.0 38.0 36.8 38.0 40-44 37.1631 38.0 38.0 38.0 36.8 38.0 45-49 35.933299999999996 38.0 35.8 38.0 31.0 38.0 50-54 36.29475 38.0 37.4 38.0 32.2 38.0 55-59 37.1751 38.0 38.0 38.0 36.4 38.0 60-64 37.013 38.0 38.0 38.0 35.8 38.0 65-69 36.922250000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.86615 38.0 38.0 38.0 35.8 38.0 75-79 36.89640000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.84455 38.0 38.0 38.0 36.0 38.0 85-89 36.75345 38.0 38.0 38.0 35.4 38.0 90-94 36.69615 38.0 38.0 38.0 35.0 38.0 95-99 36.53215 38.0 38.0 38.0 34.2 38.0 100-104 36.2702 38.0 37.8 38.0 33.8 38.0 105-109 36.16930000000001 38.0 37.4 38.0 34.0 38.0 110-114 36.16095 38.0 37.2 38.0 33.8 38.0 115-119 35.8235 38.0 37.0 38.0 32.2 38.0 120-124 35.43735 38.0 36.4 38.0 29.8 38.0 125-129 34.8777 38.0 35.4 38.0 27.6 38.0 130-134 34.87555 38.0 35.2 38.0 28.8 38.0 135-139 34.098699999999994 38.0 33.6 38.0 24.6 38.0 140-144 33.2568 38.0 33.0 38.0 20.2 38.0 145-149 32.53315 38.0 33.0 38.0 14.6 38.0 150-151 26.378875 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 2.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 5.0 15 2.0 16 0.0 17 3.0 18 5.0 19 8.0 20 4.0 21 7.0 22 3.0 23 6.0 24 9.0 25 22.0 26 21.0 27 11.0 28 10.0 29 38.0 30 39.0 31 75.0 32 75.0 33 136.0 34 179.0 35 389.0 36 948.0 37 1992.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.4 21.625 13.200000000000001 26.775 2 26.325 25.7 31.6 16.375 3 20.200000000000003 29.15 30.85 19.8 4 23.75 35.3 22.2 18.75 5 24.25 35.949999999999996 22.675 17.125 6 20.65 37.574999999999996 23.599999999999998 18.175 7 19.25 21.075 40.425 19.25 8 20.275000000000002 26.05 28.799999999999997 24.875 9 22.15 25.525 29.349999999999998 22.975 10-14 22.655 29.445 26.82 21.08 15-19 23.16 27.865000000000002 28.189999999999998 20.785 20-24 22.485 28.705000000000002 27.939999999999998 20.87 25-29 23.39 28.110000000000003 28.275 20.225 30-34 22.855 27.72 28.29 21.135 35-39 22.58 27.644999999999996 28.615000000000002 21.16 40-44 23.03 27.88 28.215 20.875 45-49 22.525000000000002 28.4 28.02 21.055 50-54 22.59 28.625 27.644999999999996 21.14 55-59 23.205000000000002 27.55 28.005000000000003 21.240000000000002 60-64 22.42 27.865000000000002 28.48 21.235 65-69 23.244999999999997 27.084999999999997 28.449999999999996 21.22 70-74 23.465 28.03 27.884999999999998 20.62 75-79 23.11 27.79 28.035 21.065 80-84 23.515 27.775 27.71 21.0 85-89 23.36 27.765 28.294999999999998 20.580000000000002 90-94 23.52 28.000000000000004 27.834999999999997 20.645 95-99 23.53 27.694999999999997 28.165000000000003 20.61 100-104 23.630000000000003 27.525 27.775 21.07 105-109 23.315 27.935 28.34 20.41 110-114 23.580000000000002 27.800000000000004 27.97 20.65 115-119 23.86 28.42 27.18 20.54 120-124 23.66 28.235 27.71 20.395 125-129 23.94 27.57 27.66 20.830000000000002 130-134 23.98 27.834999999999997 27.875 20.31 135-139 24.345 27.43 28.1 20.125 140-144 24.21 27.345000000000002 28.060000000000002 20.385 145-149 24.355 27.339999999999996 27.839999999999996 20.465 150-151 25.05 27.762500000000003 27.125 20.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 1.5 24 1.5 25 3.5 26 5.0 27 6.5 28 9.0 29 12.5 30 16.0 31 23.5 32 27.0 33 32.5 34 54.0 35 72.5 36 90.0 37 116.5 38 131.0 39 152.5 40 196.5 41 228.5 42 249.5 43 261.0 44 282.5 45 287.5 46 275.0 47 260.5 48 229.0 49 207.0 50 168.0 51 126.5 52 102.5 53 84.5 54 74.0 55 60.0 56 41.0 57 26.5 58 17.5 59 13.5 60 15.5 61 12.5 62 7.5 63 4.0 64 1.5 65 2.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4206549118388 98.675 2 0.4785894206549119 0.95 3 0.025188916876574305 0.075 4 0.07556675062972291 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.8624999999999998 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.2249999999999996 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.7125 0.0 0.0 0.0 0.0 132-133 4.1875 0.0 0.0 0.0 0.0 134-135 4.4375 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138-139 5.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAAGAT 10 0.006830828 145.0 6 >>END_MODULE Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674997 spots for SRR7170514.sra Written 674997 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra Read 674989 spots for SRR7170514.sra Written 674989 spots for SRR7170514.sra SRR ids: ['SRR7170514.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9yegtvqr SRR7170514.sra spots: 13499788 blocks: [[1, 674989], [674990, 1349978], [1349979, 2024967], [2024968, 2699956], [2699957, 3374945], [3374946, 4049934], [4049935, 4724923], [4724924, 5399912], [5399913, 6074901], [6074902, 6749890], [6749891, 7424879], [7424880, 8099868], [8099869, 8774857], [8774858, 9449846], [9449847, 10124835], [10124836, 10799824], [10799825, 11474813], [11474814, 12149802], [12149803, 12824791], [12824792, 13499788]] SRR7170514 file size 4552934 SRR7170514 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170514 SRR7170514_1.fastq SRR7170514_2.fastq Input file: SRR7170514_1.fastq Paired file: SRR7170514_2.fastq trimmed: SRR7170514-trimmed-pair1.fastq, SRR7170514-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:29:36 2025 >> started Thu Feb 13 09:38:11 2025 >> done (515.723s) 13499788 read pairs processed; of these: 8665 ( 0.06%) short read pairs filtered out after trimming by size control 8584 ( 0.06%) empty read pairs filtered out after trimming by size control 13482539 (99.87%) read pairs available; of these: 7714385 (57.22%) trimmed read pairs available after processing 5768154 (42.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 4 0.00% 27 4 0.00% 28 7 0.00% 29 4 0.00% 30 2 0.00% 31 6 0.00% 32 4 0.00% 33 8 0.00% 34 4 0.00% 35 9 0.00% 36 11 0.00% 37 11 0.00% 38 16 0.00% 39 7 0.00% 40 18 0.00% 41 19 0.00% 42 34 0.00% 43 29 0.00% 44 22 0.00% 45 33 0.00% 46 35 0.00% 47 40 0.00% 48 40 0.00% 49 54 0.00% 50 67 0.00% 51 77 0.00% 52 93 0.00% 53 117 0.00% 54 104 0.00% 55 103 0.00% 56 134 0.00% 57 150 0.00% 58 163 0.00% 59 196 0.00% 60 269 0.00% 61 277 0.00% 62 300 0.00% 63 353 0.00% 64 378 0.00% 65 471 0.00% 66 457 0.00% 67 461 0.00% 68 542 0.00% 69 637 0.00% 70 720 0.01% 71 833 0.01% 72 972 0.01% 73 1133 0.01% 74 1262 0.01% 75 1372 0.01% 76 1573 0.01% 77 1553 0.01% 78 1675 0.01% 79 1950 0.01% 80 2051 0.02% 81 2407 0.02% 82 2820 0.02% 83 3153 0.02% 84 3824 0.03% 85 4353 0.03% 86 4463 0.03% 87 4641 0.03% 88 4994 0.04% 89 5256 0.04% 90 5505 0.04% 91 5974 0.04% 92 6630 0.05% 93 7330 0.05% 94 7644 0.06% 95 8343 0.06% 96 8646 0.06% 97 8966 0.07% 98 9077 0.07% 99 9407 0.07% 100 10067 0.07% 101 10547 0.08% 102 11085 0.08% 103 11762 0.09% 104 12312 0.09% 105 13076 0.10% 106 13456 0.10% 107 13648 0.10% 108 14328 0.11% 109 14399 0.11% 110 14820 0.11% 111 15176 0.11% 112 15750 0.12% 113 16479 0.12% 114 17457 0.13% 115 18049 0.13% 116 18664 0.14% 117 19351 0.14% 118 19579 0.15% 119 19822 0.15% 120 20620 0.15% 121 21174 0.16% 122 21885 0.16% 123 22764 0.17% 124 24087 0.18% 125 25071 0.19% 126 26409 0.20% 127 27545 0.20% 128 28635 0.21% 129 29602 0.22% 130 31077 0.23% 131 32821 0.24% 132 34638 0.26% 133 37914 0.28% 134 40070 0.30% 135 43824 0.33% 136 47238 0.35% 137 52234 0.39% 138 57096 0.42% 139 63862 0.47% 140 71437 0.53% 141 82023 0.61% 142 96468 0.72% 143 113812 0.84% 144 141125 1.05% 145 177454 1.32% 146 234313 1.74% 147 332385 2.47% 148 526227 3.90% 149 1030406 7.64% 150 3786026 28.08% 151 5768154 42.78% 13482539 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=17 prefix-density=0.48 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=234.28 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=20 prefix-density=0.47 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.23 sequence-density-rank=14 fanout-score=10.32 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=5.7 sequence=AAGAAAGCTTACCCTAAC SRR7170514 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:48:53 Started mapping on | Feb 13 10:49:11 Finished on | Feb 13 11:05:41 Mapping speed, Million of reads per hour | 49.03 Number of input reads | 13482539 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12694467 Uniquely mapped reads % | 94.15% Average mapped length | 293.91 Number of splices: Total | 12563619 Number of splices: Annotated (sjdb) | 12284012 Number of splices: GT/AG | 12333109 Number of splices: GC/AG | 184468 Number of splices: AT/AC | 7754 Number of splices: Non-canonical | 38288 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326561 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 52382 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.94% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 470112 470112 470112 N_multimapping 326561 326561 326561 N_noFeature 502957 12457010 574900 N_ambiguous 258140 1038 92095 UnstrandedReadsAssigned:11933370 PositiveStrandReadsAssigned:236419 NegativeStrandReadsAssigned:12027472 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170514 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170514-trimmed-pair1.fastq SRR7170514-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,482,539 reads, 11,910,426 reads pseudoaligned [quant] estimated average fragment length: 280.497 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,010 rounds 52401 SRR7170514.ke.tsv 34699 SRR7170514.se.tsv 87100 total ==> SRR7170514.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.5 629 25.4934 Potri.005G024800.1.v4.1 1035 755.503 194 18.0933 Potri.004G059700.1.v4.1 961 681.525 4 0.413552 Potri.007G009000.2.v4.1 1416 1136.5 0 0 Potri.003G141000.2.v4.1 2943 2663.5 568.364 15.0357 Potri.016G087400.1.v4.1 270 75.2644 616.726 577.37 Potri.015G069301.1.v4.1 564 291.143 0 0 Potri.010G195200.1.v4.1 1773 1493.5 179 8.44498 Potri.012G127500.1.v4.1 977 697.508 144 14.5467 ==> SRR7170514.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 411 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170514 completed mapping pipeline successfully