Starting /dee2/code/volunteer_pipeline.sh SRR7170515 current disk space = 3053167644672 free memory = 1323105952 SRR7170515 SRAfilesize 082129121e18a997449524f69b1fbc71 SRR7170515.sra SRR7170515.sra file validated SRR7170515 is paired end SRR7170515 is conventional basespace SRR7170515 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170515_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.49375 25.0 18.0 32.0 18.0 33.0 2 22.125 18.0 18.0 27.0 18.0 33.0 3 26.43525 27.0 25.0 30.0 18.0 33.0 4 29.549 30.0 29.0 31.0 27.0 33.0 5 30.7745 31.0 30.0 33.0 28.0 33.0 6 35.28425 37.0 35.0 38.0 31.0 38.0 7 36.2815 38.0 36.0 38.0 33.0 38.0 8 37.21825 38.0 38.0 38.0 36.0 38.0 9 37.36275 38.0 38.0 38.0 37.0 38.0 10-14 36.676750000000006 38.0 37.4 38.0 34.0 38.0 15-19 37.50070000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.5086 38.0 38.0 38.0 37.4 38.0 25-29 36.462149999999994 38.0 37.0 38.0 32.0 38.0 30-34 37.175850000000004 38.0 38.0 38.0 35.8 38.0 35-39 37.2817 38.0 38.0 38.0 36.8 38.0 40-44 37.431650000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.34285 38.0 38.0 38.0 37.0 38.0 50-54 37.33055 38.0 38.0 38.0 37.0 38.0 55-59 37.2779 38.0 38.0 38.0 36.4 38.0 60-64 37.202749999999995 38.0 38.0 38.0 36.2 38.0 65-69 37.129650000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.55715 38.0 37.8 38.0 33.8 38.0 75-79 36.90575 38.0 38.0 38.0 35.2 38.0 80-84 36.88054999999999 38.0 38.0 38.0 35.4 38.0 85-89 36.6836 38.0 38.0 38.0 34.8 38.0 90-94 36.618 38.0 38.0 38.0 34.4 38.0 95-99 36.510200000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.5395 38.0 38.0 38.0 34.0 38.0 105-109 36.42495 38.0 37.8 38.0 34.0 38.0 110-114 36.283100000000005 38.0 37.2 38.0 34.0 38.0 115-119 35.813900000000004 38.0 36.8 38.0 32.0 38.0 120-124 35.766949999999994 38.0 36.8 38.0 31.8 38.0 125-129 35.483050000000006 38.0 36.0 38.0 30.4 38.0 130-134 35.24395 38.0 36.0 38.0 29.6 38.0 135-139 34.62025 38.0 34.8 38.0 25.8 38.0 140-144 34.6113 38.0 35.0 38.0 27.8 38.0 145-149 33.99415 38.0 34.2 38.0 24.6 38.0 150-151 30.173875 35.5 28.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 2.0 17 2.0 18 4.0 19 1.0 20 4.0 21 3.0 22 3.0 23 5.0 24 10.0 25 5.0 26 10.0 27 22.0 28 15.0 29 22.0 30 38.0 31 70.0 32 81.0 33 130.0 34 204.0 35 412.0 36 1094.0 37 1856.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.88786008230453 10.468106995884774 9.387860082304526 33.25617283950617 2 26.73515409671762 11.400651465798045 33.876221498371336 27.987972939113003 3 20.575 18.6 25.45 35.375 4 21.975 28.225 23.1 26.700000000000003 5 21.349999999999998 32.05 24.95 21.65 6 19.15 34.25 25.724999999999998 20.875 7 13.725000000000001 25.474999999999998 42.125 18.675 8 17.724999999999998 24.425 32.6 25.25 9 17.849999999999998 23.474999999999998 34.699999999999996 23.974999999999998 10-14 19.78 30.104999999999997 26.840000000000003 23.275000000000002 15-19 20.25 28.115000000000002 27.625 24.01 20-24 20.8 28.02 27.875 23.305 25-29 19.615 28.565 28.095 23.724999999999998 30-34 19.994999999999997 29.154999999999998 27.18 23.669999999999998 35-39 20.0 29.220000000000002 27.265 23.515 40-44 20.155 29.154999999999998 27.275 23.415 45-49 20.555 28.235 27.49 23.72 50-54 20.02 28.754999999999995 26.97 24.255 55-59 20.419999999999998 28.37 27.51 23.7 60-64 20.465 28.125 27.779999999999998 23.630000000000003 65-69 19.825 28.494999999999997 27.685 23.995 70-74 20.04 28.58 27.315 24.065 75-79 19.98 28.249999999999996 27.51 24.26 80-84 20.255000000000003 28.18 27.26 24.305 85-89 20.305 28.515 26.985 24.195 90-94 20.815 28.235 27.205000000000002 23.745 95-99 20.724999999999998 28.345 27.0 23.93 100-104 20.54 28.470000000000002 27.265 23.724999999999998 105-109 20.775 27.779999999999998 27.33 24.115000000000002 110-114 20.8 27.279999999999998 27.735 24.185000000000002 115-119 21.065 28.005000000000003 27.005000000000003 23.925 120-124 20.849999999999998 28.355000000000004 26.779999999999998 24.015 125-129 20.8 28.215 26.625 24.36 130-134 20.150000000000002 28.38 27.66 23.810000000000002 135-139 20.794999999999998 27.794999999999998 27.169999999999998 24.240000000000002 140-144 21.385 27.66 26.795 24.16 145-149 21.295 27.62 27.175 23.91 150-151 20.7875 27.975 28.012500000000003 23.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 1.5 24 3.0 25 2.0 26 4.0 27 7.0 28 8.0 29 12.5 30 21.0 31 24.5 32 32.5 33 42.0 34 49.5 35 71.5 36 87.0 37 104.0 38 131.5 39 153.5 40 178.5 41 191.5 42 208.5 43 247.0 44 270.0 45 257.5 46 261.5 47 249.0 48 243.0 49 232.5 50 183.0 51 153.0 52 118.0 53 104.0 54 89.5 55 64.5 56 51.5 57 38.0 58 26.5 59 22.0 60 17.0 61 7.5 62 5.5 63 7.5 64 4.5 65 2.5 66 2.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.8000000000000003 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.475 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.1625 0.0 0.0 0.0 0.0 128-129 3.5374999999999996 0.0 0.0 0.0 0.0 130-131 3.8499999999999996 0.0 0.0 0.0 0.0 132-133 4.0125 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.375 0.0 0.0 0.0 0.0 138-139 4.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAAGA 20 3.5889345E-4 108.74062 145 CCCCCCC 40 0.0076588374 18.123438 125-129 >>END_MODULE SRR7170515 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170515_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97325 33.0 33.0 34.0 32.0 34.0 2 32.94575 33.0 33.0 34.0 32.0 34.0 3 32.93375 34.0 33.0 34.0 32.0 34.0 4 32.95375 34.0 33.0 34.0 32.0 34.0 5 32.961 34.0 33.0 34.0 32.0 34.0 6 37.114 38.0 38.0 38.0 37.0 38.0 7 37.0895 38.0 38.0 38.0 36.0 38.0 8 37.17275 38.0 38.0 38.0 37.0 38.0 9 37.15375 38.0 38.0 38.0 37.0 38.0 10-14 37.06565 38.0 38.0 38.0 36.6 38.0 15-19 36.97315 38.0 38.0 38.0 36.0 38.0 20-24 36.92215 38.0 38.0 38.0 36.0 38.0 25-29 36.968399999999995 38.0 38.0 38.0 36.0 38.0 30-34 37.042649999999995 38.0 38.0 38.0 36.2 38.0 35-39 36.97665 38.0 38.0 38.0 36.2 38.0 40-44 36.93659999999999 38.0 38.0 38.0 36.2 38.0 45-49 36.79595 38.0 38.0 38.0 35.8 38.0 50-54 36.546350000000004 38.0 38.0 38.0 34.6 38.0 55-59 36.70065 38.0 38.0 38.0 35.4 38.0 60-64 36.15865 38.0 37.4 38.0 32.0 38.0 65-69 36.56255 38.0 38.0 38.0 34.4 38.0 70-74 36.13549999999999 38.0 37.8 38.0 33.0 38.0 75-79 36.3193 38.0 37.8 38.0 33.6 38.0 80-84 35.60855 38.0 36.6 38.0 29.2 38.0 85-89 34.9542 38.0 35.8 38.0 26.8 38.0 90-94 36.0302 38.0 37.4 38.0 33.0 38.0 95-99 35.94925 38.0 37.2 38.0 32.6 38.0 100-104 35.66125 38.0 37.2 38.0 30.0 38.0 105-109 35.1974 38.0 36.2 38.0 28.8 38.0 110-114 35.076100000000004 38.0 36.0 38.0 27.4 38.0 115-119 35.2576 38.0 36.0 38.0 29.2 38.0 120-124 35.02015 38.0 36.0 38.0 28.0 38.0 125-129 34.67435 38.0 35.8 38.0 26.8 38.0 130-134 34.0477 38.0 33.6 38.0 23.0 38.0 135-139 33.8334 38.0 33.0 38.0 22.8 38.0 140-144 32.7922 38.0 32.6 38.0 17.0 38.0 145-149 31.836599999999997 38.0 32.6 38.0 10.4 38.0 150-151 26.904625 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 2.0 5 3.0 6 4.0 7 3.0 8 1.0 9 0.0 10 2.0 11 3.0 12 0.0 13 1.0 14 3.0 15 1.0 16 2.0 17 4.0 18 6.0 19 5.0 20 8.0 21 2.0 22 8.0 23 15.0 24 19.0 25 18.0 26 26.0 27 24.0 28 34.0 29 47.0 30 66.0 31 80.0 32 88.0 33 164.0 34 221.0 35 376.0 36 814.0 37 1939.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.95 19.3 14.725 29.025000000000002 2 26.525 25.6 29.9 17.974999999999998 3 20.5 27.725 30.575000000000003 21.2 4 22.125 34.725 23.375 19.775000000000002 5 24.2 36.15 22.650000000000002 17.0 6 20.974999999999998 37.6 23.75 17.675 7 19.175 21.075 39.900000000000006 19.85 8 22.6 24.725 28.4 24.275 9 23.325000000000003 24.675 28.775000000000002 23.225 10-14 22.975 29.095 25.990000000000002 21.94 15-19 23.185 27.925 28.189999999999998 20.7 20-24 23.285 28.144999999999996 27.065 21.505 25-29 23.28 27.900000000000002 27.639999999999997 21.18 30-34 23.345 27.834999999999997 28.01 20.810000000000002 35-39 23.264652930586116 28.045609121824366 27.3004600920184 21.389277855571116 40-44 23.549999999999997 27.845 26.834999999999997 21.77 45-49 22.675 28.16 27.91 21.255 50-54 23.49 28.125 27.12 21.265 55-59 23.5 27.055 28.015 21.43 60-64 23.185 27.310000000000002 27.705000000000002 21.8 65-69 23.56 27.165 27.560000000000002 21.715 70-74 23.45 28.115000000000002 26.91 21.525 75-79 23.86477295459092 27.350470094018803 27.120424084816964 21.664332866573314 80-84 23.400530238607374 27.962583162423087 27.367315291881344 21.26957130708819 85-89 23.575 27.700000000000003 27.26 21.465 90-94 23.115 28.01 27.52 21.355 95-99 24.04 27.82 26.900000000000002 21.240000000000002 100-104 23.714742948589716 28.29565913182637 27.10542108421684 20.884176835367075 105-109 23.97 27.98 27.295 20.755000000000003 110-114 23.91 28.21 26.784999999999997 21.095 115-119 23.492047614284285 27.613283985195558 27.63829148744623 21.25637691307392 120-124 23.83476695339068 28.250650130026006 27.08041608321664 20.834166833366673 125-129 24.858700545190818 27.96478767568649 26.59430800780273 20.58220377131996 130-134 24.692407722316695 27.87836350905272 27.093127938381517 20.336100830249073 135-139 24.72870930639596 27.509126368955343 27.524128619292892 20.238035705355802 140-144 24.875 27.334999999999997 26.950000000000003 20.84 145-149 24.313647047057056 27.744161624243635 27.43911586738011 20.5030754613192 150-151 25.647117669125922 27.085156933850197 26.62248343128673 20.645241965737153 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 3.0 25 4.0 26 4.5 27 4.0 28 4.0 29 5.0 30 6.5 31 16.0 32 20.5 33 31.5 34 44.5 35 53.0 36 76.0 37 95.5 38 122.0 39 158.0 40 182.0 41 204.5 42 228.0 43 242.0 44 253.5 45 272.0 46 272.5 47 268.5 48 257.0 49 228.5 50 201.5 51 159.5 52 128.5 53 110.5 54 87.0 55 61.0 56 48.0 57 39.5 58 29.0 59 23.5 60 17.5 61 12.5 62 6.5 63 4.0 64 4.0 65 3.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.02 80-84 0.045 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.0 110-114 0.0 115-119 0.03 120-124 0.02 125-129 0.034999999999999996 130-134 0.03 135-139 0.015 140-144 0.0 145-149 0.015 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39546599496222 98.65 2 0.4785894206549119 0.95 3 0.10075566750629722 0.3 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0125000000000002 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.475 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.1500000000000004 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.8499999999999996 0.0 0.0 0.0 0.0 132-133 4.0125 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.362500000000001 0.0 0.0 0.0 0.0 138-139 4.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTATG 10 0.006830828 145.0 9 >>END_MODULE Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra Read 755000 spots for SRR7170515.sra Written 755000 spots for SRR7170515.sra Read 754984 spots for SRR7170515.sra Written 754984 spots for SRR7170515.sra SRR ids: ['SRR7170515.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ymwdt89k SRR7170515.sra spots: 15099696 blocks: [[1, 754984], [754985, 1509968], [1509969, 2264952], [2264953, 3019936], [3019937, 3774920], [3774921, 4529904], [4529905, 5284888], [5284889, 6039872], [6039873, 6794856], [6794857, 7549840], [7549841, 8304824], [8304825, 9059808], [9059809, 9814792], [9814793, 10569776], [10569777, 11324760], [11324761, 12079744], [12079745, 12834728], [12834729, 13589712], [13589713, 14344696], [14344697, 15099696]] SRR7170515 file size 5095091 SRR7170515 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170515 SRR7170515_1.fastq SRR7170515_2.fastq Input file: SRR7170515_1.fastq Paired file: SRR7170515_2.fastq trimmed: SRR7170515-trimmed-pair1.fastq, SRR7170515-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:25:30 2025 >> started Thu Feb 13 06:25:48 2025 >> done (18.147s) 15099696 read pairs processed; of these: 11051 ( 0.07%) short read pairs filtered out after trimming by size control 11414 ( 0.08%) empty read pairs filtered out after trimming by size control 15077231 (99.85%) read pairs available; of these: 8416125 (55.82%) trimmed read pairs available after processing 6661106 (44.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 3 0.00% 24 3 0.00% 25 6 0.00% 26 2 0.00% 27 1 0.00% 28 1 0.00% 29 3 0.00% 30 5 0.00% 31 3 0.00% 32 3 0.00% 33 2 0.00% 34 6 0.00% 35 7 0.00% 36 8 0.00% 37 9 0.00% 38 18 0.00% 39 24 0.00% 40 28 0.00% 41 27 0.00% 42 24 0.00% 43 22 0.00% 44 41 0.00% 45 20 0.00% 46 50 0.00% 47 42 0.00% 48 62 0.00% 49 86 0.00% 50 83 0.00% 51 101 0.00% 52 124 0.00% 53 131 0.00% 54 128 0.00% 55 128 0.00% 56 154 0.00% 57 200 0.00% 58 227 0.00% 59 234 0.00% 60 284 0.00% 61 353 0.00% 62 345 0.00% 63 409 0.00% 64 435 0.00% 65 465 0.00% 66 543 0.00% 67 610 0.00% 68 644 0.00% 69 727 0.00% 70 876 0.01% 71 966 0.01% 72 1126 0.01% 73 1257 0.01% 74 1371 0.01% 75 1624 0.01% 76 1714 0.01% 77 1963 0.01% 78 2071 0.01% 79 2246 0.01% 80 2420 0.02% 81 2701 0.02% 82 3172 0.02% 83 3680 0.02% 84 4387 0.03% 85 5113 0.03% 86 5252 0.03% 87 5583 0.04% 88 6033 0.04% 89 6341 0.04% 90 6768 0.04% 91 7219 0.05% 92 7959 0.05% 93 8547 0.06% 94 9183 0.06% 95 9804 0.07% 96 10126 0.07% 97 10767 0.07% 98 10962 0.07% 99 11393 0.08% 100 11917 0.08% 101 12743 0.08% 102 13631 0.09% 103 14162 0.09% 104 14595 0.10% 105 15778 0.10% 106 16265 0.11% 107 16553 0.11% 108 17108 0.11% 109 17746 0.12% 110 18196 0.12% 111 18740 0.12% 112 19356 0.13% 113 20179 0.13% 114 21257 0.14% 115 21913 0.15% 116 22846 0.15% 117 23566 0.16% 118 24052 0.16% 119 24647 0.16% 120 25416 0.17% 121 26225 0.17% 122 27295 0.18% 123 28607 0.19% 124 29783 0.20% 125 31397 0.21% 126 32974 0.22% 127 34324 0.23% 128 35954 0.24% 129 37578 0.25% 130 39909 0.26% 131 41712 0.28% 132 44437 0.29% 133 47736 0.32% 134 51225 0.34% 135 55678 0.37% 136 60314 0.40% 137 65220 0.43% 138 71486 0.47% 139 79203 0.53% 140 87687 0.58% 141 99784 0.66% 142 114643 0.76% 143 134303 0.89% 144 161405 1.07% 145 210036 1.39% 146 255771 1.70% 147 360432 2.39% 148 546298 3.62% 149 1039582 6.90% 150 4014993 26.63% 151 6661106 44.18% 15077231 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=8.05 fanout-score-rank=8 prefix-density=0.38 prefix-fanout=5.3 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=74.13 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.3 sequence=ATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGAT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=32 prefix-density=0.29 prefix-fanout=2.5 sequence=ATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=33 fanout-score=59.44 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=12.4 sequence=GCTGCTGTTTCTATCCCATCTTTCACCGGTCTTAAGGCAGCCAGTGCCTCCAATGCCAAAGTCAGTGCCAGTGCCAAGGTTTCAGCCTCTCCACTTCCAAGGCTCAGCATCAAGGCTTCATTGAAAGAAGTCGGTGCTGCTGTTGTCGCCACCGCTGCTAGCGCAATGATTGCTAGCAATGCTATGGCCGTTGACGTCTTGCTTGGA SRR7170515 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:26:36 Started mapping on | Feb 13 06:26:36 Finished on | Feb 13 06:28:42 Mapping speed, Million of reads per hour | 430.78 Number of input reads | 15077231 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14103080 Uniquely mapped reads % | 93.54% Average mapped length | 293.71 Number of splices: Total | 13721738 Number of splices: Annotated (sjdb) | 13445108 Number of splices: GT/AG | 13471403 Number of splices: GC/AG | 209926 Number of splices: AT/AC | 8305 Number of splices: Non-canonical | 32104 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415921 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 51536 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.26% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 569083 569083 569083 N_multimapping 415921 415921 415921 N_noFeature 352939 13915893 422014 N_ambiguous 212093 1104 93295 UnstrandedReadsAssigned:13538048 PositiveStrandReadsAssigned:186083 NegativeStrandReadsAssigned:13587771 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170515 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170515-trimmed-pair1.fastq SRR7170515-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,077,231 reads, 13,664,891 reads pseudoaligned [quant] estimated average fragment length: 274.321 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52401 SRR7170515.ke.tsv 34699 SRR7170515.se.tsv 87100 total ==> SRR7170515.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.68 306 11.9165 Potri.005G024800.1.v4.1 1035 761.679 132 11.7745 Potri.004G059700.1.v4.1 961 687.699 8 0.790374 Potri.007G009000.2.v4.1 1416 1142.68 0 0 Potri.003G141000.2.v4.1 2943 2669.68 199 5.06449 Potri.016G087400.1.v4.1 270 76.2873 895.627 797.657 Potri.015G069301.1.v4.1 564 296.069 0 0 Potri.010G195200.1.v4.1 1773 1499.68 3 0.135914 Potri.012G127500.1.v4.1 977 703.689 828 79.9449 ==> SRR7170515.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170515 completed mapping pipeline successfully