Starting /dee2/code/volunteer_pipeline.sh SRR7170516 current disk space = 3053003702272 free memory = 1310546600 SRR7170516 SRAfilesize c3ba2a127e1f96df9366ee1e144f7756 SRR7170516.sra SRR7170516.sra file validated SRR7170516 is paired end SRR7170516 is conventional basespace SRR7170516 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170516_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.6805 18.0 18.0 25.0 18.0 32.0 2 29.61525 30.0 27.0 31.0 27.0 33.0 3 31.006 33.0 30.0 33.0 27.0 33.0 4 32.01125 33.0 31.0 33.0 30.0 33.0 5 32.77375 33.0 33.0 33.0 32.0 34.0 6 36.939 38.0 37.0 38.0 35.0 38.0 7 37.39375 38.0 38.0 38.0 37.0 38.0 8 37.51075 38.0 38.0 38.0 37.0 38.0 9 37.53325 38.0 38.0 38.0 37.0 38.0 10-14 37.50135 38.0 38.0 38.0 37.0 38.0 15-19 37.53805 38.0 38.0 38.0 37.4 38.0 20-24 37.43585 38.0 38.0 38.0 37.0 38.0 25-29 37.457550000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.4226 38.0 38.0 38.0 37.0 38.0 35-39 37.38105 38.0 38.0 38.0 37.0 38.0 40-44 37.3476 38.0 38.0 38.0 37.0 38.0 45-49 37.3042 38.0 38.0 38.0 37.0 38.0 50-54 37.227349999999994 38.0 38.0 38.0 36.2 38.0 55-59 37.0322 38.0 38.0 38.0 35.8 38.0 60-64 37.01765 38.0 38.0 38.0 35.6 38.0 65-69 36.9576 38.0 38.0 38.0 35.6 38.0 70-74 36.866200000000006 38.0 38.0 38.0 35.2 38.0 75-79 36.684599999999996 38.0 38.0 38.0 34.4 38.0 80-84 36.70585 38.0 38.0 38.0 34.6 38.0 85-89 36.4068 38.0 37.4 38.0 34.0 38.0 90-94 36.29845 38.0 37.0 38.0 34.0 38.0 95-99 36.201049999999995 38.0 37.0 38.0 33.2 38.0 100-104 36.173649999999995 38.0 37.0 38.0 33.0 38.0 105-109 35.97035 38.0 36.8 38.0 33.0 38.0 110-114 35.65065 38.0 36.4 38.0 31.0 38.0 115-119 35.16645 38.0 35.4 38.0 28.6 38.0 120-124 35.34525 38.0 36.0 38.0 29.6 38.0 125-129 34.91725 38.0 35.2 38.0 27.6 38.0 130-134 31.2999 34.6 27.6 38.0 19.0 38.0 135-139 33.2405 37.8 32.8 38.0 21.8 38.0 140-144 29.425549999999998 33.2 24.6 37.2 14.0 38.0 145-149 31.3805 36.0 31.0 38.0 13.2 38.0 150-151 26.879875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 0.0 15 1.0 16 1.0 17 2.0 18 4.0 19 2.0 20 3.0 21 2.0 22 3.0 23 10.0 24 6.0 25 19.0 26 13.0 27 31.0 28 30.0 29 48.0 30 50.0 31 70.0 32 109.0 33 162.0 34 317.0 35 576.0 36 1528.0 37 1009.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.96239226952207 10.054844606946983 14.23348132671716 39.74928179681379 2 20.740555416562422 15.636727545659243 35.876907680760574 27.745809357017766 3 19.15 21.099999999999998 27.275 32.475 4 22.15 29.125 22.5 26.224999999999998 5 22.05 33.6 23.9 20.45 6 18.625 35.25 26.85 19.275000000000002 7 14.399999999999999 24.85 43.1 17.65 8 18.9 24.4 30.625000000000004 26.075 9 17.599999999999998 24.7 34.425 23.275000000000002 10-14 19.75 29.95 27.265 23.035 15-19 19.08 29.335 27.845 23.74 20-24 20.115 28.199999999999996 28.24 23.445 25-29 19.46 29.07 28.02 23.45 30-34 19.345000000000002 28.405 28.525 23.724999999999998 35-39 19.965 29.054999999999996 27.665 23.315 40-44 19.055 28.74 28.22 23.985 45-49 19.93 28.89 27.42 23.76 50-54 19.905 29.310000000000002 27.485 23.3 55-59 20.0 28.875 27.284999999999997 23.84 60-64 19.71 28.735 27.68 23.875 65-69 20.474999999999998 28.74 27.805000000000003 22.98 70-74 20.22 28.475 27.18 24.125 75-79 19.564999999999998 28.4 27.944999999999997 24.09 80-84 20.29 28.599999999999998 27.79 23.32 85-89 20.07 28.54 27.26 24.13 90-94 20.59 28.025 27.47 23.915 95-99 20.365 28.53 27.400000000000002 23.705000000000002 100-104 20.585 28.68 27.055 23.68 105-109 20.294999999999998 27.884999999999998 28.105000000000004 23.715 110-114 20.865000000000002 28.215 27.455000000000002 23.465 115-119 20.51 29.265 26.979999999999997 23.244999999999997 120-124 20.7 27.93 27.48 23.89 125-129 20.74 28.025 27.01 24.224999999999998 130-134 20.849999999999998 28.515 26.974999999999998 23.66 135-139 21.275 28.375 26.56 23.79 140-144 20.974999999999998 27.865000000000002 27.21 23.95 145-149 20.575 28.305000000000003 26.905 24.215 150-151 20.3875 28.749999999999996 27.537499999999998 23.325000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 2.0 25 5.0 26 5.5 27 8.0 28 11.5 29 13.0 30 23.5 31 30.0 32 36.5 33 53.0 34 68.0 35 86.0 36 95.0 37 112.5 38 133.0 39 157.0 40 191.5 41 211.5 42 228.5 43 260.0 44 274.0 45 265.5 46 259.0 47 239.5 48 225.0 49 208.5 50 175.5 51 145.5 52 113.0 53 89.0 54 72.5 55 52.5 56 39.5 57 30.0 58 22.5 59 14.5 60 9.5 61 7.0 62 6.0 63 5.5 64 3.0 65 2.0 66 2.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.6124999999999998 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.35 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 3.95 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.5125 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.05 0.0 0.0 0.0 0.0 134-135 5.2875 0.0 0.0 0.0 0.0 136-137 5.625 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAACTT 10 0.0068378756 144.95 4 >>END_MODULE SRR7170516 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170516_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0925 33.0 33.0 34.0 32.0 34.0 2 33.12725 34.0 33.0 34.0 32.0 34.0 3 33.1855 34.0 33.0 34.0 33.0 34.0 4 33.22725 34.0 33.0 34.0 33.0 34.0 5 33.16825 34.0 33.0 34.0 33.0 34.0 6 37.3345 38.0 38.0 38.0 37.0 38.0 7 37.30375 38.0 38.0 38.0 37.0 38.0 8 37.31025 38.0 38.0 38.0 37.0 38.0 9 37.2495 38.0 38.0 38.0 37.0 38.0 10-14 37.298249999999996 38.0 38.0 38.0 37.0 38.0 15-19 36.08475 38.0 36.4 38.0 31.4 38.0 20-24 37.08415 38.0 38.0 38.0 37.0 38.0 25-29 36.9543 38.0 38.0 38.0 36.4 38.0 30-34 37.115700000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.168699999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.098349999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.09135 38.0 38.0 38.0 36.6 38.0 50-54 37.067449999999994 38.0 38.0 38.0 36.8 38.0 55-59 37.0463 38.0 38.0 38.0 36.6 38.0 60-64 36.9876 38.0 38.0 38.0 36.0 38.0 65-69 36.949850000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.9149 38.0 38.0 38.0 36.0 38.0 75-79 36.86175 38.0 38.0 38.0 36.0 38.0 80-84 36.79665 38.0 38.0 38.0 36.0 38.0 85-89 36.4199 38.0 37.8 38.0 34.0 38.0 90-94 34.2936 37.6 33.6 38.0 25.8 38.0 95-99 36.33385 38.0 37.8 38.0 34.0 38.0 100-104 36.32235 38.0 38.0 38.0 34.0 38.0 105-109 36.14200000000001 38.0 37.4 38.0 33.8 38.0 110-114 36.01715 38.0 37.0 38.0 33.2 38.0 115-119 35.85585 38.0 37.0 38.0 32.6 38.0 120-124 35.2546 38.0 36.2 38.0 30.0 38.0 125-129 34.98655 38.0 36.0 38.0 28.4 38.0 130-134 34.70185 38.0 35.2 38.0 28.0 38.0 135-139 33.998450000000005 38.0 34.0 38.0 23.6 38.0 140-144 33.179700000000004 38.0 33.0 38.0 20.0 38.0 145-149 31.851399999999995 38.0 32.2 38.0 10.4 38.0 150-151 25.776875 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 2.0 5 3.0 6 1.0 7 2.0 8 0.0 9 0.0 10 0.0 11 3.0 12 2.0 13 2.0 14 2.0 15 2.0 16 1.0 17 1.0 18 2.0 19 5.0 20 2.0 21 7.0 22 6.0 23 14.0 24 6.0 25 18.0 26 16.0 27 17.0 28 36.0 29 35.0 30 36.0 31 69.0 32 77.0 33 112.0 34 204.0 35 356.0 36 913.0 37 2035.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.275000000000006 20.200000000000003 15.1 27.425 2 27.1 25.025 31.474999999999998 16.400000000000002 3 20.625 27.575 31.525 20.275000000000002 4 23.325000000000003 33.050000000000004 23.65 19.975 5 25.0 37.1 22.425 15.475 6 20.075000000000003 37.65 24.224999999999998 18.05 7 18.85 21.15 39.925 20.075000000000003 8 22.0 25.95 28.025 24.025 9 22.225 25.074999999999996 29.799999999999997 22.900000000000002 10-14 23.535 28.78 26.224999999999998 21.46 15-19 23.16 28.18 27.750000000000004 20.91 20-24 22.455 28.67 27.700000000000003 21.175 25-29 23.400000000000002 28.165000000000003 27.98 20.455000000000002 30-34 23.155 27.915 28.04 20.89 35-39 22.939999999999998 27.700000000000003 28.189999999999998 21.17 40-44 22.82 28.244999999999997 27.755000000000003 21.18 45-49 22.535 27.85 28.115000000000002 21.5 50-54 23.05 27.325 28.595 21.029999999999998 55-59 22.82 27.66 28.375 21.145 60-64 22.905 27.565 28.4 21.13 65-69 22.93 28.050000000000004 28.16 20.86 70-74 23.515 27.639999999999997 27.76 21.085 75-79 22.955000000000002 28.165000000000003 28.115000000000002 20.765 80-84 23.02 28.125 28.09 20.765 85-89 23.705000000000002 27.38 27.884999999999998 21.029999999999998 90-94 22.86 27.805000000000003 28.144999999999996 21.19 95-99 23.105 28.28 28.16 20.455000000000002 100-104 23.93 27.74 27.805000000000003 20.525 105-109 24.0 27.985 27.474999999999998 20.54 110-114 23.34 27.875 28.38 20.405 115-119 23.775 27.825 27.61 20.79 120-124 23.94 27.810000000000002 27.98 20.27 125-129 24.185000000000002 27.894999999999996 27.595 20.325 130-134 24.235 27.544999999999998 27.845 20.375 135-139 24.035 28.015 27.894999999999996 20.055 140-144 24.055 28.105000000000004 27.765 20.075000000000003 145-149 24.81 28.084999999999997 26.985 20.119999999999997 150-151 23.724999999999998 27.712500000000002 28.4 20.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 3.0 25 3.0 26 2.5 27 7.0 28 12.0 29 14.0 30 16.0 31 25.0 32 30.5 33 35.0 34 54.0 35 74.0 36 93.0 37 109.5 38 127.0 39 165.0 40 199.5 41 217.0 42 247.5 43 270.5 44 280.5 45 276.0 46 252.5 47 244.5 48 226.0 49 193.5 50 158.0 51 127.0 52 118.0 53 100.5 54 76.5 55 64.5 56 49.5 57 34.5 58 25.5 59 17.5 60 10.5 61 9.0 62 9.0 63 6.5 64 4.5 65 2.5 66 2.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5535983895319577 1.0999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.7375 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.5250000000000004 0.0 0.0 0.0 0.0 122-123 3.8499999999999996 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.2625 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 4.9875 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138-139 6.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAGAA 10 0.006830828 145.0 3 AAAGAAA 40 0.005621335 54.375 4 >>END_MODULE Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810653 spots for SRR7170516.sra Written 810653 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra Read 810651 spots for SRR7170516.sra Written 810651 spots for SRR7170516.sra SRR ids: ['SRR7170516.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mj2_25vn SRR7170516.sra spots: 16213022 blocks: [[1, 810651], [810652, 1621302], [1621303, 2431953], [2431954, 3242604], [3242605, 4053255], [4053256, 4863906], [4863907, 5674557], [5674558, 6485208], [6485209, 7295859], [7295860, 8106510], [8106511, 8917161], [8917162, 9727812], [9727813, 10538463], [10538464, 11349114], [11349115, 12159765], [12159766, 12970416], [12970417, 13781067], [13781068, 14591718], [14591719, 15402369], [15402370, 16213022]] SRR7170516 file size 5472360 SRR7170516 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170516 SRR7170516_1.fastq SRR7170516_2.fastq Input file: SRR7170516_1.fastq Paired file: SRR7170516_2.fastq trimmed: SRR7170516-trimmed-pair1.fastq, SRR7170516-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:46:13 2025 >> started Thu Feb 13 06:46:31 2025 >> done (18.753s) 16213022 read pairs processed; of these: 12334 ( 0.08%) short read pairs filtered out after trimming by size control 18585 ( 0.11%) empty read pairs filtered out after trimming by size control 16182103 (99.81%) read pairs available; of these: 9670298 (59.76%) trimmed read pairs available after processing 6511805 (40.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 7 0.00% 21 2 0.00% 22 5 0.00% 23 3 0.00% 24 3 0.00% 25 1 0.00% 26 5 0.00% 27 4 0.00% 28 7 0.00% 29 4 0.00% 30 8 0.00% 31 14 0.00% 32 18 0.00% 33 15 0.00% 34 6 0.00% 35 14 0.00% 36 17 0.00% 37 23 0.00% 38 16 0.00% 39 34 0.00% 40 33 0.00% 41 51 0.00% 42 49 0.00% 43 59 0.00% 44 42 0.00% 45 45 0.00% 46 62 0.00% 47 81 0.00% 48 116 0.00% 49 103 0.00% 50 128 0.00% 51 154 0.00% 52 182 0.00% 53 179 0.00% 54 204 0.00% 55 234 0.00% 56 251 0.00% 57 280 0.00% 58 322 0.00% 59 404 0.00% 60 459 0.00% 61 523 0.00% 62 578 0.00% 63 661 0.00% 64 720 0.00% 65 795 0.00% 66 857 0.01% 67 982 0.01% 68 1050 0.01% 69 1166 0.01% 70 1351 0.01% 71 1456 0.01% 72 1797 0.01% 73 2025 0.01% 74 2124 0.01% 75 2527 0.02% 76 2941 0.02% 77 2952 0.02% 78 3160 0.02% 79 3479 0.02% 80 3844 0.02% 81 4246 0.03% 82 4908 0.03% 83 5436 0.03% 84 6520 0.04% 85 7338 0.05% 86 7726 0.05% 87 8196 0.05% 88 8334 0.05% 89 8844 0.05% 90 9529 0.06% 91 10119 0.06% 92 10730 0.07% 93 11915 0.07% 94 12626 0.08% 95 13538 0.08% 96 13967 0.09% 97 14278 0.09% 98 14810 0.09% 99 15221 0.09% 100 16063 0.10% 101 16364 0.10% 102 17480 0.11% 103 18585 0.11% 104 19328 0.12% 105 20089 0.12% 106 20741 0.13% 107 21405 0.13% 108 21589 0.13% 109 22268 0.14% 110 22508 0.14% 111 23413 0.14% 112 24310 0.15% 113 25147 0.16% 114 26195 0.16% 115 27126 0.17% 116 27970 0.17% 117 28695 0.18% 118 29204 0.18% 119 29338 0.18% 120 30236 0.19% 121 31041 0.19% 122 31971 0.20% 123 33611 0.21% 124 34838 0.22% 125 36409 0.22% 126 38041 0.24% 127 39718 0.25% 128 41371 0.26% 129 42796 0.26% 130 44059 0.27% 131 46801 0.29% 132 49244 0.30% 133 52822 0.33% 134 56121 0.35% 135 60469 0.37% 136 65990 0.41% 137 71264 0.44% 138 78767 0.49% 139 87296 0.54% 140 96590 0.60% 141 109998 0.68% 142 126454 0.78% 143 148910 0.92% 144 179416 1.11% 145 224925 1.39% 146 291565 1.80% 147 410572 2.54% 148 639513 3.95% 149 1249983 7.72% 150 4534771 28.02% 151 6511805 40.24% 16182103 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=37 prefix-density=0.46 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=216.66 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.0 sequence=CATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGAT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=6.00 fanout-score-rank=17 prefix-density=0.87 prefix-fanout=1.8 sequence=ATGGCTTCCTCCTCTATGATCTCATCGGCAGCCGTTGCCACCGTCAACCGCACCCCGGCACAAGCCAATATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=84.39 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=11.1 sequence=GAAAGAGATGAGGCCTAACGTAAGTATTGAATTCCTCTGGTGGCTCTCTTTAACTATCCTGCTGGTTTCTGTGATCACATCTACTTCTACAGCTGCCTTTCTTGAAAGCAACTCGAGCCCCATTTTCAATGCCACAATCGGTGAAGGTAATGAAGAGGAGTTCTCTATGGAATCTGAAGTGCATCAGAGACTGCTGGCCTATCCGGGTAATCATATTAACTATAAGACTTTAGAACGACAACAAGTTTGCAATGCACAAATGTATGGCAGCTGT SRR7170516 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:47:18 Started mapping on | Feb 13 06:47:18 Finished on | Feb 13 06:49:25 Mapping speed, Million of reads per hour | 458.71 Number of input reads | 16182103 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15179335 Uniquely mapped reads % | 93.80% Average mapped length | 292.65 Number of splices: Total | 14641348 Number of splices: Annotated (sjdb) | 14284236 Number of splices: GT/AG | 14356379 Number of splices: GC/AG | 234305 Number of splices: AT/AC | 9084 Number of splices: Non-canonical | 41580 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422138 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 23198 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.40% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 592517 592517 592517 N_multimapping 422138 422138 422138 N_noFeature 557200 14955397 641672 N_ambiguous 265274 949 125251 UnstrandedReadsAssigned:14356861 PositiveStrandReadsAssigned:222989 NegativeStrandReadsAssigned:14412412 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170516 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170516-trimmed-pair1.fastq SRR7170516-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,182,103 reads, 14,391,119 reads pseudoaligned [quant] estimated average fragment length: 263.192 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,023 rounds 52401 SRR7170516.ke.tsv 34699 SRR7170516.se.tsv 87100 total ==> SRR7170516.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.81 520 19.5706 Potri.005G024800.1.v4.1 1035 772.808 323 27.6191 Potri.004G059700.1.v4.1 961 698.834 3 0.283678 Potri.007G009000.2.v4.1 1416 1153.81 1 0.0572724 Potri.003G141000.2.v4.1 2943 2680.81 438.235 10.8024 Potri.016G087400.1.v4.1 270 79.3228 853 710.607 Potri.015G069301.1.v4.1 564 306.789 0 0 Potri.010G195200.1.v4.1 1773 1510.81 12 0.524869 Potri.012G127500.1.v4.1 977 714.813 452 41.7854 ==> SRR7170516.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 417 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 335 Potri.001G212900.v4.1 119 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170516 completed mapping pipeline successfully