Starting /dee2/code/volunteer_pipeline.sh SRR7170517 current disk space = 3052671741952 free memory = 1450238920 SRR7170517 SRAfilesize 2116401ba28d3849f1d85b86c417bdfd SRR7170517.sra SRR7170517.sra file validated SRR7170517 is paired end SRR7170517 is conventional basespace SRR7170517 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170517_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.49725 18.0 18.0 18.0 18.0 32.0 2 26.3625 27.0 25.0 29.0 18.0 31.0 3 28.223 29.0 27.0 31.0 25.0 33.0 4 31.15 31.0 30.0 33.0 29.0 33.0 5 32.3475 33.0 32.0 33.0 32.0 33.0 6 36.465 38.0 36.0 38.0 34.0 38.0 7 37.085 38.0 38.0 38.0 35.0 38.0 8 37.32075 38.0 38.0 38.0 36.0 38.0 9 37.52375 38.0 38.0 38.0 37.0 38.0 10-14 37.5096 38.0 38.0 38.0 37.2 38.0 15-19 37.537549999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.6557 38.0 38.0 38.0 38.0 38.0 25-29 37.61195 38.0 38.0 38.0 38.0 38.0 30-34 37.565650000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.52550000000001 38.0 38.0 38.0 37.6 38.0 40-44 37.502599999999994 38.0 38.0 38.0 37.6 38.0 45-49 37.4523 38.0 38.0 38.0 37.2 38.0 50-54 37.2667 38.0 38.0 38.0 36.4 38.0 55-59 37.110200000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.0457 38.0 38.0 38.0 35.6 38.0 65-69 36.87705 38.0 38.0 38.0 35.4 38.0 70-74 36.819449999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.727050000000006 38.0 38.0 38.0 35.0 38.0 80-84 36.52335000000001 38.0 37.8 38.0 34.0 38.0 85-89 36.37765 38.0 37.6 38.0 34.0 38.0 90-94 36.228049999999996 38.0 37.0 38.0 33.6 38.0 95-99 36.1099 38.0 37.0 38.0 33.4 38.0 100-104 35.52605 38.0 36.2 38.0 30.0 38.0 105-109 35.689 38.0 36.4 38.0 31.0 38.0 110-114 35.409749999999995 38.0 36.0 38.0 29.4 38.0 115-119 35.002300000000005 38.0 35.2 38.0 28.0 38.0 120-124 34.55645 38.0 34.8 38.0 26.2 38.0 125-129 34.2933 38.0 34.4 38.0 24.4 38.0 130-134 34.1434 38.0 34.2 38.0 23.8 38.0 135-139 33.36315 37.8 33.0 38.0 20.2 38.0 140-144 32.343900000000005 36.8 31.2 38.0 14.0 38.0 145-149 30.560000000000002 36.0 30.4 38.0 10.8 38.0 150-151 26.200375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 2.0 14 1.0 15 2.0 16 1.0 17 1.0 18 2.0 19 6.0 20 3.0 21 6.0 22 7.0 23 9.0 24 11.0 25 10.0 26 19.0 27 24.0 28 28.0 29 39.0 30 46.0 31 71.0 32 110.0 33 158.0 34 299.0 35 580.0 36 1415.0 37 1149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.18745158791634 20.19106635682933 8.029950942421896 33.59153111283243 2 22.0 14.875 35.775 27.35 3 18.4 22.975 27.250000000000004 31.374999999999996 4 22.400000000000002 29.425 22.725 25.45 5 21.349999999999998 34.125 24.65 19.875 6 18.525 35.699999999999996 24.85 20.925 7 13.575000000000001 25.650000000000002 42.525 18.25 8 17.675 26.25 29.849999999999998 26.224999999999998 9 16.675 25.1 34.4 23.825 10-14 19.2 30.705 27.58 22.515 15-19 19.314999999999998 29.244999999999997 27.985 23.455000000000002 20-24 19.45 29.544999999999998 27.810000000000002 23.195 25-29 20.115 29.095 27.765 23.025000000000002 30-34 19.439999999999998 29.175 28.310000000000002 23.075000000000003 35-39 19.265 29.485 27.67 23.580000000000002 40-44 20.0 29.18 27.500000000000004 23.32 45-49 19.950000000000003 29.315 27.62 23.115 50-54 19.675 29.165000000000003 28.08 23.080000000000002 55-59 19.77 28.27 27.939999999999998 24.02 60-64 19.865 28.610000000000003 28.035 23.49 65-69 19.755 28.945 28.15 23.150000000000002 70-74 20.119999999999997 28.275 28.16 23.445 75-79 20.424999999999997 28.555000000000003 27.689999999999998 23.330000000000002 80-84 19.880994049702487 28.706435321766087 27.75638781939097 23.656182809140457 85-89 19.470000000000002 28.335 28.24 23.955000000000002 90-94 19.965 28.720000000000002 27.705000000000002 23.61 95-99 19.84 29.15 27.025 23.985 100-104 20.57 28.355000000000004 27.965 23.11 105-109 20.674999999999997 28.555000000000003 27.325 23.445 110-114 19.925 29.345 27.224999999999998 23.505000000000003 115-119 20.544999999999998 29.265 27.095000000000002 23.095 120-124 20.549999999999997 28.645 27.12 23.685000000000002 125-129 20.145 28.4 27.49 23.965 130-134 20.585 27.755000000000003 28.105000000000004 23.555 135-139 20.830000000000002 28.625 27.455000000000002 23.09 140-144 20.84 27.76 27.700000000000003 23.7 145-149 19.49 28.685 27.794999999999998 24.03 150-151 20.3875 28.575 27.3875 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 1.5 24 3.0 25 6.0 26 8.0 27 11.0 28 12.5 29 18.0 30 24.0 31 32.5 32 47.0 33 58.5 34 74.5 35 90.0 36 104.0 37 123.0 38 151.5 39 181.0 40 207.5 41 224.0 42 237.5 43 252.5 44 263.5 45 259.0 46 237.5 47 227.5 48 208.0 49 191.0 50 167.0 51 125.5 52 99.0 53 78.0 54 61.5 55 53.0 56 46.5 57 34.0 58 23.0 59 17.0 60 10.0 61 4.5 62 4.0 63 4.0 64 2.0 65 2.5 66 2.0 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29435483870968 98.5 2 0.6048387096774194 1.2 3 0.10080645161290322 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.9 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.2750000000000004 0.0 0.0 0.0 0.0 108-109 2.5250000000000004 0.0 0.0 0.0 0.0 110-111 2.7125 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.2 0.0 0.0 0.0 0.0 116-117 3.4749999999999996 0.0 0.0 0.0 0.0 118-119 3.5999999999999996 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.5 0.0 0.0 0.0 0.0 128-129 4.762499999999999 0.0 0.0 0.0 0.0 130-131 5.074999999999999 0.0 0.0 0.0 0.0 132-133 5.175000000000001 0.0 0.0 0.0 0.0 134-135 5.262499999999999 0.0 0.0 0.0 0.0 136-137 5.5375 0.0 0.0 0.0 0.0 138-139 5.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170517 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170517_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88125 33.0 33.0 34.0 32.0 34.0 2 32.9905 34.0 33.0 34.0 32.0 34.0 3 33.0125 34.0 33.0 34.0 32.0 34.0 4 32.9235 34.0 33.0 34.0 32.0 34.0 5 32.95825 34.0 33.0 34.0 32.0 34.0 6 37.1325 38.0 38.0 38.0 37.0 38.0 7 37.15975 38.0 38.0 38.0 37.0 38.0 8 37.12225 38.0 38.0 38.0 37.0 38.0 9 37.1555 38.0 38.0 38.0 37.0 38.0 10-14 37.1126 38.0 38.0 38.0 37.0 38.0 15-19 37.08595 38.0 38.0 38.0 37.0 38.0 20-24 37.066599999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.08865 38.0 38.0 38.0 37.0 38.0 30-34 36.9994 38.0 38.0 38.0 37.0 38.0 35-39 37.047000000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.00825 38.0 38.0 38.0 37.0 38.0 45-49 36.96535 38.0 38.0 38.0 36.6 38.0 50-54 36.90195 38.0 38.0 38.0 36.4 38.0 55-59 36.86665 38.0 38.0 38.0 36.0 38.0 60-64 36.845400000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.756499999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.70479999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.669650000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.48385 38.0 38.0 38.0 35.0 38.0 85-89 36.2144 38.0 38.0 38.0 34.0 38.0 90-94 36.20285 38.0 38.0 38.0 34.0 38.0 95-99 35.90975000000001 38.0 37.8 38.0 32.8 38.0 100-104 35.9058 38.0 37.4 38.0 33.0 38.0 105-109 35.7813 38.0 37.2 38.0 32.8 38.0 110-114 35.67205 38.0 37.0 38.0 32.6 38.0 115-119 35.42615 38.0 36.8 38.0 30.8 38.0 120-124 35.0855 38.0 36.0 38.0 29.2 38.0 125-129 34.67175 38.0 35.6 38.0 27.6 38.0 130-134 34.1835 38.0 34.0 38.0 25.2 38.0 135-139 33.65849999999999 38.0 33.0 38.0 22.2 38.0 140-144 33.06825 38.0 33.0 38.0 19.0 38.0 145-149 31.776050000000005 38.0 31.8 38.0 10.6 38.0 150-151 25.877625000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 3.0 4 5.0 5 1.0 6 0.0 7 0.0 8 6.0 9 1.0 10 3.0 11 6.0 12 2.0 13 3.0 14 5.0 15 4.0 16 4.0 17 10.0 18 9.0 19 4.0 20 11.0 21 8.0 22 3.0 23 14.0 24 12.0 25 11.0 26 13.0 27 20.0 28 32.0 29 26.0 30 26.0 31 47.0 32 57.0 33 97.0 34 181.0 35 321.0 36 867.0 37 2174.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.368684342171086 23.011505752876438 15.407703851925964 24.212106053026513 2 29.064532266133064 25.662831415707853 28.76438219109555 16.50825412706353 3 19.634817408704354 29.789894947473737 30.86543271635818 19.70985492746373 4 22.461230615307652 33.96698349174587 24.68734367183592 18.884442221110557 5 24.23711855927964 36.31815907953977 22.161080540270135 17.283641820910457 6 20.335167583791897 38.519259629814904 23.13656828414207 18.009004502251123 7 19.604901225306325 21.530382595648913 38.85971492873218 20.005001250312578 8 21.680420105026258 25.63140785196299 28.40710177544386 24.281070267566893 9 21.405351337834457 25.98149537384346 29.15728932233058 23.455863965991497 10-14 22.58516332349557 29.533289980491222 27.022159971987392 20.85938672402581 15-19 22.606303151575787 28.414207103551774 27.77888944472236 21.200600300150075 20-24 22.886443221610804 28.899449724862432 28.064032016008007 20.150075037518757 25-29 23.386693346673336 28.54927463731866 28.019009504752372 20.045022511255628 30-34 22.457351543348842 28.24553504427435 28.705788183500925 20.59132522887588 35-39 22.62631315657829 28.204102051025515 28.414207103551774 20.755377688844423 40-44 23.12656328164082 28.409204602301152 28.009004502251127 20.455227613806905 45-49 23.13656828414207 28.054027013506754 28.339169584792394 20.47023511755878 50-54 23.06153076538269 28.444222111055527 27.658829414707352 20.83541770885443 55-59 22.76024210894903 28.64789155119804 27.93757190735831 20.65429443249462 60-64 23.351675837918958 28.049024512256125 27.973986993496748 20.625312656328166 65-69 22.911455727863935 28.07403701850926 28.154077038519258 20.860430215107552 70-74 23.118871322793677 27.78667200320192 27.426455873524112 21.66800080048029 75-79 23.559135481288774 27.376425855513308 28.387032219331598 20.67740644386632 80-84 23.340171111222293 28.193325661680092 27.37279231500475 21.09371091209286 85-89 23.512634475856892 27.46559919939955 28.516387290467847 20.505379034275705 90-94 23.58150705493846 28.615030521364954 27.55428800160112 20.249174422095468 95-99 23.512932112661964 28.375606583620993 27.660213117214465 20.45124818650258 100-104 23.731865932966485 28.254127063531765 27.303651825912954 20.710355177588795 105-109 23.376688344172088 27.85392696348174 28.214107053526767 20.555277638819412 110-114 23.916958479239618 28.019009504752372 27.288644322161083 20.775387693846923 115-119 24.21710855427714 28.38419209604802 27.1935967983992 20.20510255127564 120-124 23.6580119065486 27.635199359647807 28.085446995847718 20.621341737955877 125-129 24.086860802561795 28.44991494045832 27.294105874111878 20.169118382868007 130-134 24.10687481236866 27.694386070249173 28.02962073451416 20.169118382868007 135-139 24.413309982486865 27.425569176882664 28.20615461596197 19.954966224668503 140-144 23.77664365055539 27.559291504052837 28.049634744321022 20.61443010107075 145-149 24.046832782948062 28.234764335034523 27.699389572700888 20.01901330931652 150-151 23.739837398373982 29.080675422138835 27.054409005628514 20.12507817385866 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 2.5 20 3.0 21 1.0 22 2.0 23 3.0 24 3.0 25 3.5 26 4.0 27 4.0 28 5.5 29 11.0 30 15.0 31 20.0 32 25.0 33 37.5 34 55.0 35 68.5 36 87.0 37 119.5 38 154.5 39 173.5 40 202.5 41 227.0 42 247.5 43 290.5 44 301.0 45 272.5 46 266.5 47 243.5 48 204.0 49 195.0 50 167.5 51 128.0 52 105.0 53 88.5 54 66.5 55 51.0 56 41.0 57 25.5 58 17.0 59 16.0 60 14.0 61 8.5 62 6.0 63 5.0 64 3.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.025 8 0.025 9 0.025 10-14 0.045 15-19 0.05 20-24 0.05 25-29 0.05 30-34 0.055 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.045 60-64 0.05 65-69 0.05 70-74 0.06 75-79 0.06 80-84 0.065 85-89 0.075 90-94 0.06999999999999999 95-99 0.055 100-104 0.05 105-109 0.05 110-114 0.05 115-119 0.05 120-124 0.055 125-129 0.06999999999999999 130-134 0.06999999999999999 135-139 0.075 140-144 0.06999999999999999 145-149 0.06999999999999999 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21538850923817 98.0 2 0.6074411541381929 1.2 3 0.07593014426727411 0.22499999999999998 4 0.02531004808909137 0.1 5 0.02531004808909137 0.125 6 0.02531004808909137 0.15 7 0.0 0.0 8 0.02531004808909137 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.9 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.25 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.6875 0.0 0.0 0.0 0.0 112-113 2.9749999999999996 0.0 0.0 0.0 0.0 114-115 3.2125 0.0 0.0 0.0 0.0 116-117 3.5250000000000004 0.0 0.0 0.0 0.0 118-119 3.6500000000000004 0.0 0.0 0.0 0.0 120-121 3.9375 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.6 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.15 0.0 0.0 0.0 0.0 132-133 5.262499999999999 0.0 0.0 0.0 0.0 134-135 5.362500000000001 0.0 0.0 0.0 0.0 136-137 5.6375 0.0 0.0 0.0 0.0 138-139 5.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTAGGC 10 0.006830828 145.0 145 ATTCCTC 10 0.006830828 145.0 1 >>END_MODULE Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544840 spots for SRR7170517.sra Written 544840 spots for SRR7170517.sra Read 544855 spots for SRR7170517.sra Written 544855 spots for SRR7170517.sra SRR ids: ['SRR7170517.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f02u8m14 SRR7170517.sra spots: 10896815 blocks: [[1, 544840], [544841, 1089680], [1089681, 1634520], [1634521, 2179360], [2179361, 2724200], [2724201, 3269040], [3269041, 3813880], [3813881, 4358720], [4358721, 4903560], [4903561, 5448400], [5448401, 5993240], [5993241, 6538080], [6538081, 7082920], [7082921, 7627760], [7627761, 8172600], [8172601, 8717440], [8717441, 9262280], [9262281, 9807120], [9807121, 10351960], [10351961, 10896815]] SRR7170517 file size 3670872 SRR7170517 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170517 SRR7170517_1.fastq SRR7170517_2.fastq Input file: SRR7170517_1.fastq Paired file: SRR7170517_2.fastq trimmed: SRR7170517-trimmed-pair1.fastq, SRR7170517-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 07:22:32 2025 >> started Thu Feb 13 07:22:44 2025 >> done (11.494s) 10896815 read pairs processed; of these: 18884 ( 0.17%) short read pairs filtered out after trimming by size control 30694 ( 0.28%) empty read pairs filtered out after trimming by size control 10847237 (99.55%) read pairs available; of these: 7188911 (66.27%) trimmed read pairs available after processing 3658326 (33.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 6 0.00% 21 2 0.00% 22 5 0.00% 23 2 0.00% 24 3 0.00% 25 5 0.00% 26 5 0.00% 27 6 0.00% 28 7 0.00% 29 6 0.00% 30 3 0.00% 31 17 0.00% 32 10 0.00% 33 9 0.00% 34 15 0.00% 35 32 0.00% 36 22 0.00% 37 23 0.00% 38 36 0.00% 39 39 0.00% 40 45 0.00% 41 45 0.00% 42 63 0.00% 43 66 0.00% 44 72 0.00% 45 94 0.00% 46 111 0.00% 47 120 0.00% 48 135 0.00% 49 155 0.00% 50 189 0.00% 51 238 0.00% 52 230 0.00% 53 247 0.00% 54 266 0.00% 55 310 0.00% 56 350 0.00% 57 381 0.00% 58 466 0.00% 59 511 0.00% 60 645 0.01% 61 698 0.01% 62 790 0.01% 63 835 0.01% 64 952 0.01% 65 1009 0.01% 66 1105 0.01% 67 1214 0.01% 68 1303 0.01% 69 1533 0.01% 70 1761 0.02% 71 1898 0.02% 72 2275 0.02% 73 2452 0.02% 74 2742 0.03% 75 2979 0.03% 76 3391 0.03% 77 3754 0.03% 78 3817 0.04% 79 3982 0.04% 80 4348 0.04% 81 4791 0.04% 82 5419 0.05% 83 5986 0.06% 84 7114 0.07% 85 7650 0.07% 86 7741 0.07% 87 7555 0.07% 88 7856 0.07% 89 8081 0.07% 90 8580 0.08% 91 9036 0.08% 92 9412 0.09% 93 10350 0.10% 94 10741 0.10% 95 11223 0.10% 96 11188 0.10% 97 11360 0.10% 98 11258 0.10% 99 11488 0.11% 100 12016 0.11% 101 12450 0.11% 102 12813 0.12% 103 13673 0.13% 104 14091 0.13% 105 14741 0.14% 106 15035 0.14% 107 14997 0.14% 108 14936 0.14% 109 15170 0.14% 110 15274 0.14% 111 15763 0.15% 112 16339 0.15% 113 16682 0.15% 114 17399 0.16% 115 18115 0.17% 116 18682 0.17% 117 18927 0.17% 118 19178 0.18% 119 18926 0.17% 120 19982 0.18% 121 20495 0.19% 122 21404 0.20% 123 22592 0.21% 124 23481 0.22% 125 24415 0.23% 126 25799 0.24% 127 26801 0.25% 128 28185 0.26% 129 29656 0.27% 130 31157 0.29% 131 32739 0.30% 132 35535 0.33% 133 38389 0.35% 134 41816 0.39% 135 45825 0.42% 136 50119 0.46% 137 55141 0.51% 138 61241 0.56% 139 68705 0.63% 140 78651 0.73% 141 90509 0.83% 142 104588 0.96% 143 124743 1.15% 144 152152 1.40% 145 193906 1.79% 146 255869 2.36% 147 361652 3.33% 148 560141 5.16% 149 1044747 9.63% 150 2988605 27.55% 151 3658326 33.73% 10847237 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=31 prefix-density=1.01 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=107.36 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.8 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=37 prefix-density=0.67 prefix-fanout=1.0 sequence=CACATTCATACTCCAAGTCTTTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=30.12 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=10.1 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170517 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 07:23:29 Started mapping on | Feb 13 07:23:29 Finished on | Feb 13 07:24:37 Mapping speed, Million of reads per hour | 574.27 Number of input reads | 10847237 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10112491 Uniquely mapped reads % | 93.23% Average mapped length | 290.96 Number of splices: Total | 9678565 Number of splices: Annotated (sjdb) | 9438513 Number of splices: GT/AG | 9503834 Number of splices: GC/AG | 137385 Number of splices: AT/AC | 6057 Number of splices: Non-canonical | 31289 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287230 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 30272 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.78% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 460491 460491 460491 N_multimapping 287230 287230 287230 N_noFeature 384573 9890421 445251 N_ambiguous 243044 777 81327 UnstrandedReadsAssigned:9484874 PositiveStrandReadsAssigned:221293 NegativeStrandReadsAssigned:9585913 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170517 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170517-trimmed-pair1.fastq SRR7170517-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,847,237 reads, 9,485,907 reads pseudoaligned [quant] estimated average fragment length: 271.899 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR7170517.ke.tsv 34699 SRR7170517.se.tsv 87100 total ==> SRR7170517.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.1 629 30.9525 Potri.005G024800.1.v4.1 1035 764.101 304 34.2047 Potri.004G059700.1.v4.1 961 690.133 8 0.9966 Potri.007G009000.2.v4.1 1416 1145.1 0 0 Potri.003G141000.2.v4.1 2943 2672.1 395 12.7089 Potri.016G087400.1.v4.1 270 80.847 648 689.088 Potri.015G069301.1.v4.1 564 299.464 0 0 Potri.010G195200.1.v4.1 1773 1502.1 71 4.06371 Potri.012G127500.1.v4.1 977 706.123 118 14.367 ==> SRR7170517.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 425 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 17 SRR7170517 completed mapping pipeline successfully