Starting /dee2/code/volunteer_pipeline.sh SRR7170518 current disk space = 3052685983744 free memory = 1450199304 SRR7170518 SRAfilesize 7208ecce8d4d728ea3fdcfda2de4f0f7 SRR7170518.sra SRR7170518.sra file validated SRR7170518 is paired end SRR7170518 is conventional basespace SRR7170518 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170518_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.79975 30.0 18.0 33.0 18.0 33.0 2 29.32675 31.0 27.0 33.0 25.0 33.0 3 30.71475 31.0 29.0 33.0 27.0 33.0 4 30.8945 31.0 31.0 33.0 29.0 33.0 5 32.2955 33.0 32.0 33.0 32.0 33.0 6 36.7605 38.0 37.0 38.0 34.0 38.0 7 37.29625 38.0 38.0 38.0 36.0 38.0 8 37.589 38.0 38.0 38.0 37.0 38.0 9 37.5155 38.0 38.0 38.0 37.0 38.0 10-14 37.61935 38.0 38.0 38.0 38.0 38.0 15-19 37.66695 38.0 38.0 38.0 38.0 38.0 20-24 37.2873 38.0 38.0 38.0 36.8 38.0 25-29 36.72495 38.0 37.8 38.0 34.2 38.0 30-34 37.478849999999994 38.0 38.0 38.0 37.4 38.0 35-39 37.563199999999995 38.0 38.0 38.0 37.8 38.0 40-44 37.0028 38.0 38.0 38.0 35.4 38.0 45-49 34.9333 37.8 33.6 38.0 25.4 38.0 50-54 37.2148 38.0 37.8 38.0 36.4 38.0 55-59 37.3644 38.0 38.0 38.0 37.0 38.0 60-64 37.30615 38.0 38.0 38.0 36.8 38.0 65-69 37.2286 38.0 38.0 38.0 36.0 38.0 70-74 37.208299999999994 38.0 38.0 38.0 36.0 38.0 75-79 37.0949 38.0 38.0 38.0 36.0 38.0 80-84 36.9678 38.0 38.0 38.0 35.6 38.0 85-89 36.7162 38.0 38.0 38.0 34.8 38.0 90-94 36.546949999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.6498 38.0 38.0 38.0 34.2 38.0 100-104 36.6444 38.0 38.0 38.0 34.2 38.0 105-109 36.438399999999994 38.0 37.8 38.0 34.0 38.0 110-114 35.94154999999999 38.0 36.8 38.0 32.6 38.0 115-119 35.67475 38.0 36.4 38.0 31.0 38.0 120-124 35.53215 38.0 36.0 38.0 30.2 38.0 125-129 35.45005 38.0 36.0 38.0 30.6 38.0 130-134 35.142399999999995 38.0 35.6 38.0 29.6 38.0 135-139 34.4698 38.0 34.0 38.0 27.0 38.0 140-144 29.2223 33.6 23.6 37.0 15.6 38.0 145-149 26.141499999999997 32.0 15.8 37.6 2.0 38.0 150-151 16.303625 11.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 2.0 18 1.0 19 3.0 20 4.0 21 2.0 22 2.0 23 4.0 24 8.0 25 15.0 26 11.0 27 17.0 28 33.0 29 36.0 30 56.0 31 86.0 32 107.0 33 197.0 34 359.0 35 720.0 36 1564.0 37 772.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.46775844421699 10.670419651995907 10.951893551688844 43.90992835209826 2 20.67584480600751 16.195244055068837 36.24530663329161 26.883604505632043 3 20.95 20.1 25.775 33.175 4 22.675 28.65 22.775000000000002 25.900000000000002 5 22.2 32.95 24.25 20.599999999999998 6 18.45 36.15 24.725 20.674999999999997 7 14.025000000000002 25.525 43.1 17.349999999999998 8 18.975 24.575 30.975 25.474999999999998 9 17.125 24.55 32.550000000000004 25.775 10-14 19.455 30.075000000000003 27.384999999999998 23.085 15-19 19.470000000000002 29.099999999999998 27.644999999999996 23.785 20-24 19.715 28.525 27.810000000000002 23.95 25-29 19.45 29.255 27.915 23.380000000000003 30-34 19.759999999999998 28.88 27.845 23.515 35-39 20.135 28.74 27.905 23.22 40-44 19.650000000000002 28.89 27.29 24.169999999999998 45-49 20.599999999999998 28.04 27.71 23.65 50-54 20.105 28.615000000000002 27.950000000000003 23.330000000000002 55-59 19.025 28.904999999999998 27.85 24.22 60-64 19.99 28.765 27.694999999999997 23.549999999999997 65-69 20.325 27.845 27.38 24.45 70-74 19.902985447817173 28.434265139770964 27.94919237885683 23.713557033555034 75-79 20.015 28.37 27.860000000000003 23.755000000000003 80-84 19.405 28.925 27.935 23.735 85-89 19.925 28.425 27.515 24.135 90-94 20.047004700470048 28.542854285428543 27.577757775777577 23.832383238323832 95-99 19.91099554977749 28.506425321266065 27.586379318965946 23.996199809990497 100-104 19.96 28.904999999999998 27.37 23.765 105-109 20.225 28.08 27.975 23.72 110-114 20.765 28.23 27.400000000000002 23.605 115-119 20.39 28.12 27.76 23.73 120-124 20.91 27.26 27.675 24.154999999999998 125-129 20.24 28.21 27.415 24.135 130-134 20.595 28.42 27.21 23.775 135-139 20.505000000000003 27.915 27.534999999999997 24.044999999999998 140-144 20.27 28.165000000000003 27.52 24.044999999999998 145-149 19.955000000000002 28.21 27.605 24.23 150-151 19.775000000000002 29.062500000000004 27.5125 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 4.0 27 9.5 28 12.0 29 17.5 30 25.5 31 25.5 32 31.0 33 47.0 34 66.5 35 83.5 36 96.5 37 121.5 38 153.0 39 166.5 40 169.5 41 201.0 42 233.0 43 248.0 44 260.0 45 261.5 46 261.5 47 241.0 48 232.0 49 204.5 50 165.0 51 149.0 52 115.0 53 95.0 54 84.0 55 62.5 56 47.0 57 36.0 58 25.0 59 16.5 60 9.0 61 7.0 62 6.5 63 4.0 64 1.5 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5499999999999998 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.5999999999999996 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.0374999999999996 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.4749999999999996 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 3.95 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.45 0.0 0.0 0.0 0.0 136-137 4.6375 0.0 0.0 0.0 0.0 138-139 4.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170518 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170518_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0335 33.0 33.0 34.0 32.0 34.0 2 33.11125 34.0 33.0 34.0 32.0 34.0 3 33.12575 34.0 33.0 34.0 33.0 34.0 4 33.03 34.0 33.0 34.0 32.0 34.0 5 33.12375 34.0 33.0 34.0 33.0 34.0 6 37.15675 38.0 38.0 38.0 37.0 38.0 7 37.26 38.0 38.0 38.0 37.0 38.0 8 37.3095 38.0 38.0 38.0 37.0 38.0 9 37.3135 38.0 38.0 38.0 37.0 38.0 10-14 36.5418 38.0 37.2 38.0 32.8 38.0 15-19 36.887 38.0 37.8 38.0 35.0 38.0 20-24 36.81699999999999 38.0 38.0 38.0 35.8 38.0 25-29 36.903999999999996 38.0 38.0 38.0 35.8 38.0 30-34 37.13505 38.0 38.0 38.0 37.0 38.0 35-39 37.1212 38.0 38.0 38.0 36.8 38.0 40-44 37.105900000000005 38.0 38.0 38.0 37.0 38.0 45-49 35.86315 38.0 35.8 38.0 30.8 38.0 50-54 36.20295 38.0 37.4 38.0 32.2 38.0 55-59 37.04085 38.0 38.0 38.0 36.0 38.0 60-64 36.88465 38.0 38.0 38.0 35.8 38.0 65-69 36.80985 38.0 38.0 38.0 35.8 38.0 70-74 36.7882 38.0 38.0 38.0 35.6 38.0 75-79 36.7518 38.0 38.0 38.0 35.4 38.0 80-84 36.662099999999995 38.0 38.0 38.0 35.2 38.0 85-89 36.65905 38.0 38.0 38.0 35.0 38.0 90-94 36.60505 38.0 38.0 38.0 34.6 38.0 95-99 36.426700000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.25965 38.0 37.8 38.0 33.8 38.0 105-109 36.08075 38.0 37.4 38.0 33.2 38.0 110-114 36.08285 38.0 37.2 38.0 33.8 38.0 115-119 35.7483 38.0 37.0 38.0 32.0 38.0 120-124 35.409000000000006 38.0 36.6 38.0 29.8 38.0 125-129 34.9351 38.0 35.8 38.0 27.6 38.0 130-134 34.740449999999996 38.0 35.0 38.0 27.8 38.0 135-139 34.060700000000004 38.0 33.4 38.0 24.0 38.0 140-144 33.2764 38.0 33.0 38.0 20.2 38.0 145-149 32.472950000000004 38.0 33.0 38.0 12.8 38.0 150-151 26.541125 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 1.0 6 2.0 7 3.0 8 1.0 9 1.0 10 3.0 11 1.0 12 0.0 13 2.0 14 1.0 15 0.0 16 5.0 17 6.0 18 5.0 19 7.0 20 6.0 21 5.0 22 9.0 23 8.0 24 18.0 25 10.0 26 17.0 27 28.0 28 30.0 29 33.0 30 51.0 31 70.0 32 66.0 33 125.0 34 186.0 35 350.0 36 840.0 37 2106.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.55 20.775 14.2 29.475 2 26.275 26.924999999999997 31.35 15.45 3 20.625 27.925 30.675 20.775 4 23.150000000000002 34.300000000000004 24.0 18.55 5 24.15 37.824999999999996 21.85 16.175 6 19.5 38.525 22.775000000000002 19.2 7 19.875 20.125 39.574999999999996 20.424999999999997 8 21.025 25.35 29.15 24.474999999999998 9 22.025 24.15 30.225 23.599999999999998 10-14 22.895 28.845 26.88 21.38 15-19 22.765 28.17 28.01 21.055 20-24 22.17 28.389999999999997 28.16 21.279999999999998 25-29 23.355 28.255000000000003 28.265 20.125 30-34 22.55 27.98 28.425 21.044999999999998 35-39 22.35 27.955000000000002 28.355000000000004 21.34 40-44 22.865 27.834999999999997 28.54 20.76 45-49 22.64 28.415000000000003 27.52 21.425 50-54 22.85 28.24 28.134999999999998 20.775 55-59 23.005 27.839999999999996 28.134999999999998 21.02 60-64 23.1 28.09 27.894999999999996 20.915 65-69 22.955000000000002 27.644999999999996 27.389999999999997 22.009999999999998 70-74 23.175 28.335 27.625 20.865000000000002 75-79 23.055 27.61 27.92 21.415 80-84 23.26 27.750000000000004 27.855 21.135 85-89 23.265 28.07 27.61 21.055 90-94 23.72 27.765 27.245 21.27 95-99 23.5 27.88 27.655 20.965 100-104 23.505000000000003 27.845 27.185 21.465 105-109 23.549999999999997 27.97 27.815 20.665 110-114 23.315 28.665000000000003 27.169999999999998 20.849999999999998 115-119 23.77 28.28 27.58 20.369999999999997 120-124 23.974999999999998 27.694999999999997 27.439999999999998 20.89 125-129 24.18 28.015 27.625 20.18 130-134 24.135 27.52 27.639999999999997 20.705000000000002 135-139 24.245 27.334999999999997 27.63 20.79 140-144 23.895 27.794999999999998 27.855 20.455000000000002 145-149 24.12 28.035 27.68 20.165 150-151 24.0625 27.175 28.975 19.787499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 2.5 22 2.5 23 2.5 24 2.5 25 2.5 26 6.5 27 7.5 28 6.0 29 7.5 30 11.0 31 24.0 32 34.0 33 35.0 34 48.5 35 62.5 36 79.0 37 107.5 38 135.5 39 169.0 40 198.5 41 221.0 42 253.0 43 277.5 44 274.5 45 265.5 46 267.0 47 250.5 48 218.0 49 198.0 50 179.5 51 147.5 52 120.5 53 94.5 54 75.0 55 57.0 56 39.5 57 32.5 58 24.5 59 20.5 60 13.0 61 9.5 62 7.0 63 3.5 64 2.0 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47103274559194 98.725 2 0.3526448362720403 0.7000000000000001 3 0.12594458438287154 0.375 4 0.05037783375314861 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 2.9625000000000004 0.0 0.0 0.0 0.0 124-125 3.1625 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 3.9125 0.0 0.0 0.0 0.0 132-133 4.237500000000001 0.0 0.0 0.0 0.0 134-135 4.55 0.0 0.0 0.0 0.0 136-137 4.7875 0.0 0.0 0.0 0.0 138-139 5.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTAG 10 0.006830828 145.0 9 TATCAAG 10 0.006830828 145.0 6 GTTGTTA 10 0.006830828 145.0 8 >>END_MODULE Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra Read 661965 spots for SRR7170518.sra Written 661965 spots for SRR7170518.sra SRR ids: ['SRR7170518.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sjzaervw SRR7170518.sra spots: 13239300 blocks: [[1, 661965], [661966, 1323930], [1323931, 1985895], [1985896, 2647860], [2647861, 3309825], [3309826, 3971790], [3971791, 4633755], [4633756, 5295720], [5295721, 5957685], [5957686, 6619650], [6619651, 7281615], [7281616, 7943580], [7943581, 8605545], [8605546, 9267510], [9267511, 9929475], [9929476, 10591440], [10591441, 11253405], [11253406, 11915370], [11915371, 12577335], [12577336, 13239300]] SRR7170518 file size 4464663 SRR7170518 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170518 SRR7170518_1.fastq SRR7170518_2.fastq Input file: SRR7170518_1.fastq Paired file: SRR7170518_2.fastq trimmed: SRR7170518-trimmed-pair1.fastq, SRR7170518-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 07:25:07 2025 >> started Thu Feb 13 07:25:29 2025 >> done (21.251s) 13239300 read pairs processed; of these: 8626 ( 0.07%) short read pairs filtered out after trimming by size control 11557 ( 0.09%) empty read pairs filtered out after trimming by size control 13219117 (99.85%) read pairs available; of these: 7611890 (57.58%) trimmed read pairs available after processing 5607227 (42.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 5 0.00% 22 5 0.00% 23 7 0.00% 24 6 0.00% 25 4 0.00% 26 5 0.00% 27 0 0.00% 28 5 0.00% 29 7 0.00% 30 4 0.00% 31 6 0.00% 32 6 0.00% 33 10 0.00% 34 5 0.00% 35 14 0.00% 36 17 0.00% 37 13 0.00% 38 12 0.00% 39 19 0.00% 40 17 0.00% 41 26 0.00% 42 33 0.00% 43 33 0.00% 44 38 0.00% 45 42 0.00% 46 57 0.00% 47 54 0.00% 48 91 0.00% 49 87 0.00% 50 98 0.00% 51 117 0.00% 52 129 0.00% 53 163 0.00% 54 161 0.00% 55 158 0.00% 56 208 0.00% 57 228 0.00% 58 236 0.00% 59 310 0.00% 60 350 0.00% 61 439 0.00% 62 456 0.00% 63 523 0.00% 64 551 0.00% 65 514 0.00% 66 667 0.01% 67 824 0.01% 68 810 0.01% 69 924 0.01% 70 1112 0.01% 71 1239 0.01% 72 1443 0.01% 73 1575 0.01% 74 1833 0.01% 75 1961 0.01% 76 2409 0.02% 77 2505 0.02% 78 2539 0.02% 79 2815 0.02% 80 3015 0.02% 81 3425 0.03% 82 3809 0.03% 83 4202 0.03% 84 4982 0.04% 85 5660 0.04% 86 5873 0.04% 87 6085 0.05% 88 6339 0.05% 89 6789 0.05% 90 7028 0.05% 91 7800 0.06% 92 7940 0.06% 93 8879 0.07% 94 9287 0.07% 95 9856 0.07% 96 10055 0.08% 97 10311 0.08% 98 10609 0.08% 99 10819 0.08% 100 11476 0.09% 101 12056 0.09% 102 12281 0.09% 103 12846 0.10% 104 13526 0.10% 105 13970 0.11% 106 14587 0.11% 107 14805 0.11% 108 14867 0.11% 109 15270 0.12% 110 15742 0.12% 111 16001 0.12% 112 16721 0.13% 113 17168 0.13% 114 17965 0.14% 115 18586 0.14% 116 18807 0.14% 117 19521 0.15% 118 19848 0.15% 119 20328 0.15% 120 21217 0.16% 121 21604 0.16% 122 21885 0.17% 123 23371 0.18% 124 24362 0.18% 125 25445 0.19% 126 26941 0.20% 127 27514 0.21% 128 29152 0.22% 129 30311 0.23% 130 31943 0.24% 131 33633 0.25% 132 35650 0.27% 133 38064 0.29% 134 40668 0.31% 135 44281 0.33% 136 47867 0.36% 137 52486 0.40% 138 57491 0.43% 139 64335 0.49% 140 72215 0.55% 141 82637 0.63% 142 95857 0.73% 143 113758 0.86% 144 137719 1.04% 145 173300 1.31% 146 226594 1.71% 147 318816 2.41% 148 502267 3.80% 149 989013 7.48% 150 3714429 28.10% 151 5607227 42.42% 13219117 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=16 prefix-density=0.64 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=392.55 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=27 prefix-density=0.69 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=22.40 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.6 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7170518 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 07:26:14 Started mapping on | Feb 13 07:26:14 Finished on | Feb 13 08:42:41 Mapping speed, Million of reads per hour | 10.37 Number of input reads | 13219117 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12515609 Uniquely mapped reads % | 94.68% Average mapped length | 293.54 Number of splices: Total | 12360180 Number of splices: Annotated (sjdb) | 12092272 Number of splices: GT/AG | 12126780 Number of splices: GC/AG | 193309 Number of splices: AT/AC | 6892 Number of splices: Non-canonical | 33199 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342753 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 17551 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 369618 369618 369618 N_multimapping 342753 342753 342753 N_noFeature 452530 12308726 523618 N_ambiguous 225990 673 89835 UnstrandedReadsAssigned:11837089 PositiveStrandReadsAssigned:206210 NegativeStrandReadsAssigned:11902156 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170518 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170518-trimmed-pair1.fastq SRR7170518-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,219,117 reads, 11,844,348 reads pseudoaligned [quant] estimated average fragment length: 284.081 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7170518.ke.tsv 34699 SRR7170518.se.tsv 87100 total ==> SRR7170518.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.92 455 20.7133 Potri.005G024800.1.v4.1 1035 751.919 121 12.7096 Potri.004G059700.1.v4.1 961 677.993 6 0.698946 Potri.007G009000.2.v4.1 1416 1132.92 0 0 Potri.003G141000.2.v4.1 2943 2659.92 672.401 19.9654 Potri.016G087400.1.v4.1 270 77.8445 647 656.438 Potri.015G069301.1.v4.1 564 290 0 0 Potri.010G195200.1.v4.1 1773 1489.92 10 0.530096 Potri.012G127500.1.v4.1 977 693.951 74 8.42209 ==> SRR7170518.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 868 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 0 SRR7170518 completed mapping pipeline successfully