Starting /dee2/code/volunteer_pipeline.sh SRR7170519 current disk space = 3052814061568 free memory = 1345300588 SRR7170519 SRAfilesize 544ba758420d853e00441ae2d95f9485 SRR7170519.sra SRR7170519.sra file validated SRR7170519 is paired end SRR7170519 is conventional basespace SRR7170519 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170519_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.7065 18.0 18.0 18.0 18.0 32.0 2 27.3645 27.0 27.0 28.0 25.0 30.0 3 29.11775 29.0 29.0 31.0 25.0 33.0 4 31.64025 33.0 31.0 33.0 29.0 33.0 5 32.433 33.0 33.0 33.0 32.0 33.0 6 36.3865 38.0 36.0 38.0 34.0 38.0 7 36.98125 38.0 37.0 38.0 35.0 38.0 8 37.2815 38.0 38.0 38.0 36.0 38.0 9 37.41325 38.0 38.0 38.0 37.0 38.0 10-14 37.53295 38.0 38.0 38.0 37.0 38.0 15-19 37.582750000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.07085 38.0 37.8 38.0 35.4 38.0 25-29 35.9935 38.0 37.0 38.0 29.6 38.0 30-34 37.421800000000005 38.0 38.0 38.0 36.8 38.0 35-39 37.5311 38.0 38.0 38.0 37.4 38.0 40-44 36.900949999999995 38.0 37.8 38.0 34.8 38.0 45-49 35.245599999999996 38.0 35.6 38.0 25.4 38.0 50-54 37.09135 38.0 37.8 38.0 35.8 38.0 55-59 37.20985 38.0 38.0 38.0 36.2 38.0 60-64 37.14355 38.0 38.0 38.0 36.0 38.0 65-69 37.055 38.0 38.0 38.0 36.0 38.0 70-74 37.0159 38.0 38.0 38.0 36.0 38.0 75-79 36.873200000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.7524 38.0 38.0 38.0 34.6 38.0 85-89 36.4975 38.0 37.8 38.0 34.0 38.0 90-94 36.34015 38.0 37.0 38.0 33.8 38.0 95-99 36.447050000000004 38.0 37.4 38.0 34.0 38.0 100-104 36.30835 38.0 37.2 38.0 33.8 38.0 105-109 36.19165 38.0 37.0 38.0 33.6 38.0 110-114 35.72525 38.0 36.4 38.0 31.4 38.0 115-119 35.28315 38.0 36.0 38.0 29.4 38.0 120-124 35.12825 38.0 35.4 38.0 28.2 38.0 125-129 35.11685 38.0 35.2 38.0 29.0 38.0 130-134 34.7911 38.0 34.8 38.0 28.0 38.0 135-139 34.031 38.0 33.4 38.0 24.8 38.0 140-144 29.851300000000002 35.2 23.6 38.0 15.0 38.0 145-149 26.067 32.8 15.4 37.4 2.0 38.0 150-151 16.8295 12.5 2.0 32.5 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 1.0 15 2.0 16 0.0 17 3.0 18 4.0 19 6.0 20 1.0 21 3.0 22 7.0 23 7.0 24 6.0 25 7.0 26 16.0 27 25.0 28 31.0 29 46.0 30 58.0 31 83.0 32 119.0 33 232.0 34 363.0 35 881.0 36 1516.0 37 580.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.501519756838904 48.68287740628166 7.32016210739615 28.495440729483285 2 22.125 15.45 33.475 28.95 3 18.425 21.525 26.700000000000003 33.35 4 22.8 28.799999999999997 22.125 26.275 5 21.95 33.575 24.5 19.975 6 18.725 35.65 25.25 20.375 7 14.249999999999998 27.950000000000003 39.550000000000004 18.25 8 16.5 26.875 30.125 26.5 9 17.575 25.35 32.475 24.6 10-14 19.34 30.535 26.884999999999998 23.24 15-19 19.605 29.5 27.224999999999998 23.669999999999998 20-24 19.655 30.245 26.615 23.485 25-29 19.33 29.345 27.650000000000002 23.674999999999997 30-34 19.3 29.4 27.66 23.64 35-39 19.645000000000003 29.04 27.445000000000004 23.87 40-44 20.21303195479322 29.734460169025358 26.403960594089114 23.648547282092313 45-49 20.555 29.020000000000003 26.540000000000003 23.885 50-54 19.56 29.375 27.055 24.01 55-59 19.49 29.24 27.29 23.98 60-64 19.57 28.595 27.584999999999997 24.25 65-69 19.98 28.95 27.389999999999997 23.68 70-74 19.56989247311828 29.602400600150037 26.996749187296825 23.830957739434858 75-79 19.945 29.104999999999997 27.134999999999998 23.815 80-84 20.18 28.53 27.139999999999997 24.15 85-89 20.273040956143422 28.499274891233682 26.64399659948992 24.58368755313297 90-94 21.135567783891947 28.844422211105552 26.29814907453727 23.721860930465233 95-99 20.198079231692677 28.49139655862345 26.90576230492197 24.404761904761905 100-104 20.79 27.925 27.52 23.765 105-109 20.4 28.249999999999996 26.845000000000002 24.505 110-114 20.28 28.58 27.08 24.060000000000002 115-119 20.185 28.720000000000002 26.745 24.349999999999998 120-124 20.745 28.405 26.674999999999997 24.175 125-129 20.925 28.7 26.224999999999998 24.15 130-134 20.73 27.925 27.224999999999998 24.12 135-139 20.630000000000003 27.91 26.790000000000003 24.67 140-144 21.195 27.725 27.250000000000004 23.830000000000002 145-149 20.27 28.54 26.56 24.63 150-151 20.424999999999997 28.012500000000003 27.462500000000002 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 3.5 25 4.5 26 8.5 27 12.5 28 9.5 29 14.0 30 22.5 31 30.0 32 47.0 33 69.0 34 85.0 35 95.5 36 103.0 37 127.0 38 149.5 39 164.5 40 184.0 41 201.5 42 213.5 43 227.5 44 249.0 45 244.0 46 231.0 47 245.0 48 219.0 49 170.0 50 163.5 51 156.5 52 122.0 53 101.5 54 85.0 55 62.0 56 52.0 57 38.0 58 25.5 59 19.0 60 15.5 61 7.0 62 3.0 63 3.0 64 2.0 65 1.0 66 1.0 67 1.5 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.015 90-94 0.05 95-99 0.04 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.395008822788 98.575 2 0.5041593143433325 1.0 3 0.050415931434333254 0.15 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025207965717166627 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 3 (97% over 34bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.0125000000000002 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.95 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.275 0.0 0.0 0.0 0.0 116-117 3.5375 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 3.925 0.0 0.0 0.0 0.0 122-123 4.2625 0.0 0.0 0.0 0.0 124-125 4.5375 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.012499999999999 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 5.975 0.0 0.0 0.0 0.0 134-135 6.4375 0.0 0.0 0.0 0.0 136-137 6.7625 0.0 0.0 0.0 0.0 138-139 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170519 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170519_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03875 33.0 33.0 34.0 32.0 34.0 2 33.0805 34.0 33.0 34.0 32.0 34.0 3 33.074 34.0 33.0 34.0 33.0 34.0 4 33.03675 34.0 33.0 34.0 33.0 34.0 5 33.107 34.0 33.0 34.0 33.0 34.0 6 37.1535 38.0 38.0 38.0 37.0 38.0 7 37.273 38.0 38.0 38.0 37.0 38.0 8 37.22075 38.0 38.0 38.0 37.0 38.0 9 37.173 38.0 38.0 38.0 37.0 38.0 10-14 36.629 38.0 37.6 38.0 32.8 38.0 15-19 36.87505 38.0 37.8 38.0 35.8 38.0 20-24 36.88945 38.0 38.0 38.0 36.4 38.0 25-29 36.8998 38.0 38.0 38.0 36.4 38.0 30-34 37.0423 38.0 38.0 38.0 37.0 38.0 35-39 37.01545 38.0 38.0 38.0 36.6 38.0 40-44 37.054249999999996 38.0 38.0 38.0 37.0 38.0 45-49 36.081100000000006 38.0 37.0 38.0 30.8 38.0 50-54 36.096050000000005 38.0 37.0 38.0 32.2 38.0 55-59 36.9747 38.0 38.0 38.0 36.4 38.0 60-64 36.8814 38.0 38.0 38.0 36.2 38.0 65-69 36.82955 38.0 38.0 38.0 36.0 38.0 70-74 36.63725 38.0 38.0 38.0 35.4 38.0 75-79 36.7255 38.0 38.0 38.0 36.0 38.0 80-84 36.616 38.0 38.0 38.0 35.8 38.0 85-89 36.51345 38.0 38.0 38.0 35.0 38.0 90-94 36.4822 38.0 38.0 38.0 35.0 38.0 95-99 36.38645 38.0 38.0 38.0 34.2 38.0 100-104 36.1278 38.0 38.0 38.0 33.8 38.0 105-109 36.0788 38.0 38.0 38.0 34.0 38.0 110-114 35.926 38.0 37.2 38.0 33.2 38.0 115-119 35.72435 38.0 37.0 38.0 32.0 38.0 120-124 35.42195 38.0 36.6 38.0 30.4 38.0 125-129 34.9303 38.0 36.0 38.0 28.2 38.0 130-134 34.732600000000005 38.0 35.2 38.0 28.0 38.0 135-139 34.1655 38.0 33.8 38.0 25.2 38.0 140-144 33.4764 38.0 33.0 38.0 21.4 38.0 145-149 32.755199999999995 38.0 33.0 38.0 15.8 38.0 150-151 26.750375 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 4.0 4 3.0 5 3.0 6 2.0 7 0.0 8 2.0 9 4.0 10 1.0 11 1.0 12 4.0 13 3.0 14 3.0 15 5.0 16 7.0 17 4.0 18 2.0 19 4.0 20 7.0 21 7.0 22 9.0 23 4.0 24 6.0 25 16.0 26 9.0 27 15.0 28 24.0 29 33.0 30 32.0 31 53.0 32 69.0 33 97.0 34 172.0 35 330.0 36 863.0 37 2189.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.0 21.75 14.875 23.375 2 27.675 26.150000000000002 28.425 17.75 3 21.3 27.474999999999998 31.7 19.525000000000002 4 24.95 33.35 22.875 18.825 5 24.625 37.2 20.575 17.599999999999998 6 21.099999999999998 36.5 23.375 19.025 7 20.825 21.75 37.4 20.025000000000002 8 23.1 26.05 26.125 24.725 9 21.6 26.174999999999997 29.4 22.825 10-14 24.19 28.92 25.895000000000003 20.995 15-19 23.815 27.900000000000002 26.995 21.29 20-24 23.86 28.499999999999996 27.095000000000002 20.544999999999998 25-29 24.285 27.965 26.974999999999998 20.775 30-34 23.75 27.675 27.74 20.835 35-39 23.745 27.77 26.979999999999997 21.505 40-44 23.865 27.875 27.639999999999997 20.62 45-49 24.22 27.384999999999998 27.045 21.349999999999998 50-54 23.355 27.439999999999998 27.855 21.349999999999998 55-59 24.285 26.91 27.93 20.875 60-64 23.93 27.169999999999998 27.88 21.02 65-69 23.69 27.439999999999998 27.515 21.355 70-74 23.705000000000002 28.105000000000004 26.645000000000003 21.545 75-79 23.93 27.825 27.41 20.835 80-84 23.775 27.575 27.694999999999997 20.955 85-89 23.645 27.384999999999998 27.555000000000003 21.415 90-94 23.865 27.415 27.589999999999996 21.13 95-99 24.185000000000002 27.735 27.105 20.974999999999998 100-104 24.25 27.02 27.555000000000003 21.175 105-109 24.125 27.77 27.73 20.375 110-114 24.505 27.43 27.595 20.47 115-119 24.69 27.905 27.24 20.165 120-124 24.66 27.395000000000003 27.58 20.365 125-129 24.525 26.795 28.410000000000004 20.27 130-134 24.79 27.750000000000004 27.255000000000003 20.205000000000002 135-139 25.395 26.924999999999997 27.455000000000002 20.225 140-144 24.815 27.875 27.07 20.24 145-149 25.324999999999996 27.325 27.38 19.97 150-151 25.7625 26.937499999999996 26.5375 20.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.0 26 2.0 27 3.5 28 4.5 29 3.0 30 9.0 31 15.5 32 22.0 33 29.5 34 44.5 35 64.0 36 73.0 37 90.0 38 109.0 39 139.0 40 174.0 41 207.0 42 248.5 43 270.0 44 264.5 45 261.0 46 262.0 47 259.0 48 245.5 49 209.0 50 174.5 51 148.5 52 129.5 53 113.5 54 100.5 55 82.0 56 60.0 57 46.5 58 33.0 59 29.0 60 22.0 61 17.5 62 13.5 63 6.0 64 4.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8840984022318 97.475 2 0.8876489982247019 1.7500000000000002 3 0.1521683996956632 0.44999999999999996 4 0.050722799898554397 0.2 5 0.025361399949277198 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2375 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.6375 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.075 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.7625 0.0 0.0 0.0 0.0 112-113 3.0374999999999996 0.0 0.0 0.0 0.0 114-115 3.4 0.0 0.0 0.0 0.0 116-117 3.6625 0.0 0.0 0.0 0.0 118-119 3.8499999999999996 0.0 0.0 0.0 0.0 120-121 4.05 0.0 0.0 0.0 0.0 122-123 4.3625 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 4.85 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.6375 0.0 0.0 0.0 0.0 132-133 6.112500000000001 0.0 0.0 0.0 0.0 134-135 6.637499999999999 0.0 0.0 0.0 0.0 136-137 7.0 0.0 0.0 0.0 0.0 138-139 7.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGGATA 10 0.006830828 145.0 1 ACAAGTG 10 0.006830828 145.0 8 AAAGCCT 10 0.006830828 145.0 7 >>END_MODULE Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503137 spots for SRR7170519.sra Written 503137 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra Read 503127 spots for SRR7170519.sra Written 503127 spots for SRR7170519.sra SRR ids: ['SRR7170519.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7j6ea0xz SRR7170519.sra spots: 10062550 blocks: [[1, 503127], [503128, 1006254], [1006255, 1509381], [1509382, 2012508], [2012509, 2515635], [2515636, 3018762], [3018763, 3521889], [3521890, 4025016], [4025017, 4528143], [4528144, 5031270], [5031271, 5534397], [5534398, 6037524], [6037525, 6540651], [6540652, 7043778], [7043779, 7546905], [7546906, 8050032], [8050033, 8553159], [8553160, 9056286], [9056287, 9559413], [9559414, 10062550]] SRR7170519 file size 3388167 SRR7170519 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170519 SRR7170519_1.fastq SRR7170519_2.fastq Input file: SRR7170519_1.fastq Paired file: SRR7170519_2.fastq trimmed: SRR7170519-trimmed-pair1.fastq, SRR7170519-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 07:05:20 2025 >> started Thu Feb 13 07:05:32 2025 >> done (12.310s) 10062550 read pairs processed; of these: 18540 ( 0.18%) short read pairs filtered out after trimming by size control 42485 ( 0.42%) empty read pairs filtered out after trimming by size control 10001525 (99.39%) read pairs available; of these: 5763798 (57.63%) trimmed read pairs available after processing 4237727 (42.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 5 0.00% 22 5 0.00% 23 0 0.00% 24 5 0.00% 25 5 0.00% 26 1 0.00% 27 5 0.00% 28 2 0.00% 29 6 0.00% 30 8 0.00% 31 10 0.00% 32 9 0.00% 33 8 0.00% 34 8 0.00% 35 14 0.00% 36 12 0.00% 37 18 0.00% 38 20 0.00% 39 22 0.00% 40 19 0.00% 41 25 0.00% 42 54 0.00% 43 34 0.00% 44 37 0.00% 45 51 0.00% 46 52 0.00% 47 63 0.00% 48 64 0.00% 49 84 0.00% 50 93 0.00% 51 112 0.00% 52 136 0.00% 53 135 0.00% 54 155 0.00% 55 165 0.00% 56 189 0.00% 57 209 0.00% 58 240 0.00% 59 256 0.00% 60 322 0.00% 61 388 0.00% 62 474 0.00% 63 467 0.00% 64 490 0.00% 65 543 0.01% 66 564 0.01% 67 671 0.01% 68 759 0.01% 69 853 0.01% 70 975 0.01% 71 1155 0.01% 72 1389 0.01% 73 1475 0.01% 74 1802 0.02% 75 2225 0.02% 76 3173 0.03% 77 3045 0.03% 78 2475 0.02% 79 2519 0.03% 80 2826 0.03% 81 3180 0.03% 82 3621 0.04% 83 3934 0.04% 84 5015 0.05% 85 5799 0.06% 86 5979 0.06% 87 6209 0.06% 88 6688 0.07% 89 6780 0.07% 90 7091 0.07% 91 7642 0.08% 92 8055 0.08% 93 8845 0.09% 94 9373 0.09% 95 10039 0.10% 96 10283 0.10% 97 10469 0.10% 98 10532 0.11% 99 10795 0.11% 100 11533 0.12% 101 11952 0.12% 102 12612 0.13% 103 12898 0.13% 104 13620 0.14% 105 14328 0.14% 106 14576 0.15% 107 14649 0.15% 108 15018 0.15% 109 15249 0.15% 110 15841 0.16% 111 16066 0.16% 112 16682 0.17% 113 17465 0.17% 114 18093 0.18% 115 18706 0.19% 116 19453 0.19% 117 19661 0.20% 118 19583 0.20% 119 19687 0.20% 120 20284 0.20% 121 20611 0.21% 122 21111 0.21% 123 22150 0.22% 124 22957 0.23% 125 23759 0.24% 126 24574 0.25% 127 25396 0.25% 128 26271 0.26% 129 27213 0.27% 130 27702 0.28% 131 28776 0.29% 132 29835 0.30% 133 31599 0.32% 134 33988 0.34% 135 36461 0.36% 136 38874 0.39% 137 41369 0.41% 138 44602 0.45% 139 48698 0.49% 140 53371 0.53% 141 60628 0.61% 142 68951 0.69% 143 80656 0.81% 144 98204 0.98% 145 123133 1.23% 146 160706 1.61% 147 226251 2.26% 148 360378 3.60% 149 715342 7.15% 150 2731018 27.31% 151 4237727 42.37% 10001525 reads passed initial QC criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=1.11 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=21 fanout-score=21.43 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.5 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.83 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=37.66 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.7 sequence=ACTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170519 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 07:06:24 Started mapping on | Feb 13 07:06:24 Finished on | Feb 13 07:08:35 Mapping speed, Million of reads per hour | 274.85 Number of input reads | 10001525 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 8946816 Uniquely mapped reads % | 89.45% Average mapped length | 292.18 Number of splices: Total | 8584775 Number of splices: Annotated (sjdb) | 8408987 Number of splices: GT/AG | 8415809 Number of splices: GC/AG | 139853 Number of splices: AT/AC | 5102 Number of splices: Non-canonical | 24011 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223493 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 18770 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.07% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 844289 844289 844289 N_multimapping 223493 223493 223493 N_noFeature 201742 8739030 248981 N_ambiguous 235367 592 74562 UnstrandedReadsAssigned:8509707 PositiveStrandReadsAssigned:207194 NegativeStrandReadsAssigned:8623273 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170519 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170519-trimmed-pair1.fastq SRR7170519-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,001,525 reads, 8,614,336 reads pseudoaligned [quant] estimated average fragment length: 252.951 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR7170519.ke.tsv 34699 SRR7170519.se.tsv 87100 total ==> SRR7170519.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.05 281 13.1002 Potri.005G024800.1.v4.1 1035 783.049 210 22.0804 Potri.004G059700.1.v4.1 961 709.07 8 0.928917 Potri.007G009000.2.v4.1 1416 1164.05 0 0 Potri.003G141000.2.v4.1 2943 2691.05 206.618 6.32154 Potri.016G087400.1.v4.1 270 80.6054 572.972 585.256 Potri.015G069301.1.v4.1 564 315.628 0 0 Potri.010G195200.1.v4.1 1773 1521.05 60 3.24776 Potri.012G127500.1.v4.1 977 725.07 55 6.24538 ==> SRR7170519.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 303 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170519 completed mapping pipeline successfully