Starting /dee2/code/volunteer_pipeline.sh SRR7170520 current disk space = 3052676894720 free memory = 1349311092 SRR7170520 SRAfilesize 18e8786041ab4236489eea079f3ca8ad SRR7170520.sra SRR7170520.sra file validated SRR7170520 is paired end SRR7170520 is conventional basespace SRR7170520 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170520_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.32175 18.0 18.0 18.0 18.0 32.0 2 29.539 30.0 28.0 31.0 27.0 33.0 3 31.086 33.0 31.0 33.0 28.0 33.0 4 31.69725 33.0 31.0 33.0 29.0 33.0 5 32.42625 33.0 33.0 33.0 31.0 34.0 6 36.6615 38.0 37.0 38.0 34.0 38.0 7 37.00925 38.0 37.0 38.0 35.0 38.0 8 37.241 38.0 38.0 38.0 36.0 38.0 9 37.34375 38.0 38.0 38.0 37.0 38.0 10-14 37.36555 38.0 38.0 38.0 36.8 38.0 15-19 37.44965 38.0 38.0 38.0 37.0 38.0 20-24 37.46945 38.0 38.0 38.0 37.0 38.0 25-29 37.297799999999995 38.0 38.0 38.0 36.8 38.0 30-34 37.39104999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.39190000000001 38.0 38.0 38.0 37.0 38.0 40-44 36.750800000000005 38.0 37.6 38.0 32.8 38.0 45-49 36.3313 38.0 37.2 38.0 32.4 38.0 50-54 36.98885 38.0 38.0 38.0 35.8 38.0 55-59 37.0129 38.0 38.0 38.0 36.0 38.0 60-64 36.9298 38.0 38.0 38.0 35.4 38.0 65-69 36.85725 38.0 38.0 38.0 35.2 38.0 70-74 36.67359999999999 38.0 38.0 38.0 34.2 38.0 75-79 36.64115 38.0 37.8 38.0 34.2 38.0 80-84 36.51819999999999 38.0 37.6 38.0 34.0 38.0 85-89 36.2645 38.0 37.2 38.0 33.2 38.0 90-94 35.942350000000005 38.0 37.0 38.0 32.0 38.0 95-99 36.015 38.0 37.0 38.0 33.0 38.0 100-104 35.91215 38.0 37.0 38.0 32.2 38.0 105-109 35.83175 38.0 36.6 38.0 31.8 38.0 110-114 35.53435 38.0 36.0 38.0 30.8 38.0 115-119 35.015750000000004 38.0 35.0 38.0 28.2 38.0 120-124 34.979000000000006 38.0 35.2 38.0 27.8 38.0 125-129 34.778499999999994 38.0 35.0 38.0 27.2 38.0 130-134 34.23585 38.0 34.4 38.0 24.0 38.0 135-139 33.8429 38.0 33.8 38.0 22.8 38.0 140-144 32.8515 37.2 32.6 38.0 17.4 38.0 145-149 31.8966 36.8 31.0 38.0 14.6 38.0 150-151 25.704875 32.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 3.0 17 3.0 18 3.0 19 6.0 20 5.0 21 3.0 22 5.0 23 5.0 24 10.0 25 12.0 26 17.0 27 28.0 28 22.0 29 48.0 30 40.0 31 73.0 32 107.0 33 170.0 34 299.0 35 567.0 36 1296.0 37 1273.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.50361944157187 11.530506721820062 13.46949327817994 35.49638055842813 2 21.646646646646648 14.714714714714713 33.35835835835836 30.28028028028028 3 18.6 21.85 27.125 32.425 4 23.0 28.799999999999997 23.175 25.025 5 21.775 33.85 23.95 20.424999999999997 6 20.025000000000002 34.949999999999996 25.374999999999996 19.650000000000002 7 15.15 26.0 42.05 16.8 8 18.625 25.7 29.625 26.05 9 17.0 24.25 33.85 24.9 10-14 19.2 30.220000000000002 27.455000000000002 23.125 15-19 19.2 29.62 27.500000000000004 23.68 20-24 19.18 29.075 27.79 23.955000000000002 25-29 19.6 29.509999999999998 27.255000000000003 23.635 30-34 19.81 29.4 27.560000000000002 23.23 35-39 20.23 29.099999999999998 27.189999999999998 23.48 40-44 19.880994049702487 29.746487324366218 27.391369568478424 22.981149057452875 45-49 19.545 29.56 26.935 23.96 50-54 19.895 29.645 27.415 23.044999999999998 55-59 19.5 29.299999999999997 26.99 24.21 60-64 19.915 28.725 27.57 23.79 65-69 19.35 29.065 27.22 24.365000000000002 70-74 19.485 29.13 27.57 23.815 75-79 19.53 29.165000000000003 27.82 23.485 80-84 20.44 28.64 27.744999999999997 23.175 85-89 19.765 28.565 27.3 24.37 90-94 19.945 28.28 27.85 23.925 95-99 19.825 28.38 28.205000000000002 23.59 100-104 20.05 28.84 26.640000000000004 24.47 105-109 20.025000000000002 28.625 27.365000000000002 23.985 110-114 19.759999999999998 28.785 27.400000000000002 24.055 115-119 20.474999999999998 27.79 27.589999999999996 24.145 120-124 20.315 28.360000000000003 27.58 23.745 125-129 20.22 28.59 27.185 24.005000000000003 130-134 20.535 28.15 27.175 24.14 135-139 20.66 27.575 27.38 24.385 140-144 20.45 28.265 27.33 23.955000000000002 145-149 20.79 28.04 26.8 24.37 150-151 20.275000000000002 27.675 28.000000000000004 24.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 5.0 25 7.5 26 9.5 27 8.5 28 13.0 29 19.5 30 23.0 31 32.0 32 43.5 33 48.0 34 59.5 35 83.5 36 110.5 37 131.0 38 156.5 39 178.0 40 181.5 41 209.0 42 237.0 43 233.0 44 241.5 45 260.5 46 258.0 47 239.0 48 203.5 49 188.0 50 175.5 51 138.0 52 102.5 53 84.0 54 77.0 55 61.5 56 54.5 57 42.5 58 23.5 59 14.5 60 10.0 61 10.5 62 8.0 63 3.0 64 1.5 65 2.0 66 2.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19253091092607 98.275 2 0.7065354529396921 1.4000000000000001 3 0.0757002271006813 0.22499999999999998 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.7999999999999998 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.9000000000000004 0.0 0.0 0.0 0.0 122-123 3.1375 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.6375 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.15 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.5625 0.0 0.0 0.0 0.0 136-137 4.8125 0.0 0.0 0.0 0.0 138-139 5.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCT 10 0.006836113 144.9625 4 AAAGAGC 10 0.006836113 144.9625 3 >>END_MODULE SRR7170520 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170520_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60475 33.0 33.0 34.0 32.0 34.0 2 32.9345 33.0 33.0 34.0 32.0 34.0 3 31.001 33.0 32.0 34.0 18.0 34.0 4 32.275 33.0 33.0 34.0 28.0 34.0 5 32.72025 33.0 33.0 34.0 32.0 34.0 6 37.1825 38.0 38.0 38.0 37.0 38.0 7 36.9705 38.0 38.0 38.0 36.0 38.0 8 37.191 38.0 38.0 38.0 37.0 38.0 9 37.20775 38.0 38.0 38.0 37.0 38.0 10-14 37.152 38.0 38.0 38.0 37.0 38.0 15-19 37.14565 38.0 38.0 38.0 37.0 38.0 20-24 36.945800000000006 38.0 38.0 38.0 36.2 38.0 25-29 36.8849 38.0 38.0 38.0 36.2 38.0 30-34 37.02120000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.0708 38.0 38.0 38.0 37.0 38.0 40-44 36.40745 38.0 37.6 38.0 33.6 38.0 45-49 37.047850000000004 38.0 38.0 38.0 36.8 38.0 50-54 36.9982 38.0 38.0 38.0 36.4 38.0 55-59 36.034299999999995 38.0 37.2 38.0 30.2 38.0 60-64 36.304050000000004 38.0 37.6 38.0 33.4 38.0 65-69 36.20335 38.0 37.6 38.0 31.8 38.0 70-74 35.7639 38.0 37.0 38.0 30.6 38.0 75-79 36.510349999999995 38.0 38.0 38.0 34.8 38.0 80-84 36.65085 38.0 38.0 38.0 35.6 38.0 85-89 36.606399999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.53415 38.0 38.0 38.0 35.0 38.0 95-99 36.3466 38.0 38.0 38.0 34.0 38.0 100-104 36.17745 38.0 38.0 38.0 34.0 38.0 105-109 36.043 38.0 37.8 38.0 33.4 38.0 110-114 35.9584 38.0 37.2 38.0 33.2 38.0 115-119 35.631800000000005 38.0 36.6 38.0 31.8 38.0 120-124 35.3665 38.0 36.0 38.0 30.6 38.0 125-129 34.9066 38.0 36.0 38.0 28.2 38.0 130-134 34.69455 38.0 35.4 38.0 27.6 38.0 135-139 34.1098 38.0 33.4 38.0 24.8 38.0 140-144 33.26195 38.0 33.0 38.0 20.2 38.0 145-149 32.4525 38.0 33.0 38.0 13.0 38.0 150-151 26.676250000000003 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 4.0 5 1.0 6 1.0 7 1.0 8 3.0 9 3.0 10 4.0 11 3.0 12 1.0 13 3.0 14 1.0 15 2.0 16 5.0 17 3.0 18 6.0 19 9.0 20 10.0 21 4.0 22 10.0 23 5.0 24 11.0 25 11.0 26 13.0 27 12.0 28 19.0 29 40.0 30 32.0 31 53.0 32 79.0 33 123.0 34 161.0 35 390.0 36 918.0 37 2044.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.3 21.725 15.975 26.0 2 28.65 26.025 28.875 16.45 3 20.525 29.075 31.825 18.575 4 23.25 33.1 24.675 18.975 5 24.95 35.525 21.825 17.7 6 19.375 38.15 23.375 19.1 7 20.075000000000003 21.575 38.2 20.150000000000002 8 22.975 25.424999999999997 27.525 24.075 9 22.85 24.9 28.825 23.425 10-14 23.05 29.425 26.66 20.865000000000002 15-19 23.585 28.470000000000002 27.215 20.73 20-24 22.89 28.665000000000003 27.37 21.075 25-29 23.77 28.189999999999998 27.534999999999997 20.505000000000003 30-34 23.085 28.499999999999996 27.46 20.955 35-39 23.155 27.700000000000003 27.92 21.224999999999998 40-44 24.055 28.21 26.889999999999997 20.845 45-49 23.5 28.64 27.689999999999998 20.169999999999998 50-54 22.470000000000002 28.244999999999997 28.22 21.065 55-59 23.635 27.560000000000002 28.084999999999997 20.72 60-64 23.474999999999998 27.76 27.58 21.185000000000002 65-69 23.525 27.384999999999998 27.975 21.115000000000002 70-74 23.724999999999998 27.785 27.36 21.13 75-79 23.369999999999997 28.084999999999997 27.27 21.275 80-84 23.474999999999998 27.24 27.785 21.5 85-89 23.915 27.05 27.744999999999997 21.29 90-94 23.36 27.485 27.715 21.44 95-99 23.915 28.205000000000002 27.235 20.645 100-104 23.98 28.59 26.755000000000003 20.674999999999997 105-109 23.794999999999998 27.49 28.04 20.674999999999997 110-114 24.175 28.37 27.595 19.86 115-119 24.645 28.060000000000002 27.305 19.99 120-124 24.44 27.93 27.41 20.22 125-129 23.845 27.685 27.944999999999997 20.525 130-134 24.005000000000003 28.165000000000003 27.67 20.16 135-139 24.695 27.644999999999996 27.865000000000002 19.794999999999998 140-144 24.925 28.095 27.325 19.655 145-149 24.8 27.765 27.855 19.580000000000002 150-151 25.825 27.474999999999998 26.974999999999998 19.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 3.0 28 5.5 29 10.5 30 14.5 31 20.0 32 24.5 33 29.5 34 36.0 35 46.0 36 75.5 37 105.5 38 132.5 39 167.0 40 198.5 41 227.5 42 251.5 43 268.0 44 282.5 45 283.0 46 261.5 47 250.5 48 233.5 49 192.0 50 171.5 51 156.0 52 116.0 53 96.0 54 96.5 55 77.5 56 55.5 57 36.0 58 21.5 59 18.0 60 11.5 61 6.0 62 6.5 63 4.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11302584896097 97.775 2 0.7095793208312215 1.4000000000000001 3 0.10136847440446022 0.3 4 0.0 0.0 5 0.025342118601115054 0.125 6 0.0 0.0 7 0.025342118601115054 0.17500000000000002 8 0.0 0.0 9 0.025342118601115054 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.7999999999999998 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.1625 0.0 0.0 0.0 0.0 116-117 2.4000000000000004 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.0875 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.525 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.5 0.0 0.0 0.0 0.0 136-137 4.775 0.0 0.0 0.0 0.0 138-139 5.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557759 spots for SRR7170520.sra Written 557759 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra Read 557748 spots for SRR7170520.sra Written 557748 spots for SRR7170520.sra SRR ids: ['SRR7170520.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hu5kzpr1 SRR7170520.sra spots: 11154971 blocks: [[1, 557748], [557749, 1115496], [1115497, 1673244], [1673245, 2230992], [2230993, 2788740], [2788741, 3346488], [3346489, 3904236], [3904237, 4461984], [4461985, 5019732], [5019733, 5577480], [5577481, 6135228], [6135229, 6692976], [6692977, 7250724], [7250725, 7808472], [7808473, 8366220], [8366221, 8923968], [8923969, 9481716], [9481717, 10039464], [10039465, 10597212], [10597213, 11154971]] SRR7170520 file size 3758353 SRR7170520 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170520 SRR7170520_1.fastq SRR7170520_2.fastq Input file: SRR7170520_1.fastq Paired file: SRR7170520_2.fastq trimmed: SRR7170520-trimmed-pair1.fastq, SRR7170520-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 08:01:48 2025 >> started Thu Feb 13 08:04:54 2025 >> done (186.265s) 11154971 read pairs processed; of these: 14737 ( 0.13%) short read pairs filtered out after trimming by size control 16149 ( 0.14%) empty read pairs filtered out after trimming by size control 11124085 (99.72%) read pairs available; of these: 6161019 (55.38%) trimmed read pairs available after processing 4963066 (44.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 6 0.00% 26 2 0.00% 27 10 0.00% 28 2 0.00% 29 3 0.00% 30 8 0.00% 31 2 0.00% 32 7 0.00% 33 7 0.00% 34 14 0.00% 35 6 0.00% 36 9 0.00% 37 9 0.00% 38 13 0.00% 39 21 0.00% 40 23 0.00% 41 21 0.00% 42 35 0.00% 43 26 0.00% 44 31 0.00% 45 28 0.00% 46 37 0.00% 47 50 0.00% 48 53 0.00% 49 71 0.00% 50 80 0.00% 51 84 0.00% 52 85 0.00% 53 101 0.00% 54 100 0.00% 55 113 0.00% 56 146 0.00% 57 138 0.00% 58 166 0.00% 59 227 0.00% 60 266 0.00% 61 308 0.00% 62 319 0.00% 63 361 0.00% 64 385 0.00% 65 416 0.00% 66 477 0.00% 67 500 0.00% 68 568 0.01% 69 681 0.01% 70 727 0.01% 71 871 0.01% 72 985 0.01% 73 1127 0.01% 74 1207 0.01% 75 1467 0.01% 76 1619 0.01% 77 1659 0.01% 78 1727 0.02% 79 1916 0.02% 80 2080 0.02% 81 2391 0.02% 82 2712 0.02% 83 3050 0.03% 84 3996 0.04% 85 4657 0.04% 86 4794 0.04% 87 4972 0.04% 88 5280 0.05% 89 5386 0.05% 90 5865 0.05% 91 6158 0.06% 92 6679 0.06% 93 7332 0.07% 94 7920 0.07% 95 8475 0.08% 96 8859 0.08% 97 8956 0.08% 98 9068 0.08% 99 9363 0.08% 100 9784 0.09% 101 10171 0.09% 102 10956 0.10% 103 11556 0.10% 104 12153 0.11% 105 12778 0.11% 106 13316 0.12% 107 13338 0.12% 108 13632 0.12% 109 13881 0.12% 110 14452 0.13% 111 14976 0.13% 112 15334 0.14% 113 16012 0.14% 114 16694 0.15% 115 17226 0.15% 116 17936 0.16% 117 18242 0.16% 118 18524 0.17% 119 19014 0.17% 120 19341 0.17% 121 19919 0.18% 122 20236 0.18% 123 21414 0.19% 124 22409 0.20% 125 23155 0.21% 126 23680 0.21% 127 24701 0.22% 128 25371 0.23% 129 26242 0.24% 130 27186 0.24% 131 28224 0.25% 132 30130 0.27% 133 31839 0.29% 134 33953 0.31% 135 36270 0.33% 136 39168 0.35% 137 42302 0.38% 138 45921 0.41% 139 50577 0.45% 140 55868 0.50% 141 63102 0.57% 142 73214 0.66% 143 86562 0.78% 144 105774 0.95% 145 132611 1.19% 146 173520 1.56% 147 246386 2.21% 148 388563 3.49% 149 776396 6.98% 150 3039683 27.33% 151 4963066 44.62% 11124085 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=12 prefix-density=0.69 prefix-fanout=2.4 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=91.42 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.0 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=1.25 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=20 prefix-density=1.29 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=42.14 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.4 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATT SRR7170520 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:12:17 Started mapping on | Feb 13 09:12:26 Finished on | Feb 13 10:47:43 Mapping speed, Million of reads per hour | 7.00 Number of input reads | 11124085 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10392722 Uniquely mapped reads % | 93.43% Average mapped length | 293.48 Number of splices: Total | 10129479 Number of splices: Annotated (sjdb) | 9903204 Number of splices: GT/AG | 9945651 Number of splices: GC/AG | 145020 Number of splices: AT/AC | 6552 Number of splices: Non-canonical | 32256 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267255 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 47380 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.65% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 475369 475369 475369 N_multimapping 267255 267255 267255 N_noFeature 323878 10135989 384260 N_ambiguous 279031 791 82253 UnstrandedReadsAssigned:9789813 PositiveStrandReadsAssigned:255942 NegativeStrandReadsAssigned:9926209 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170520 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170520-trimmed-pair1.fastq SRR7170520-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,124,085 reads, 9,849,533 reads pseudoaligned [quant] estimated average fragment length: 262.812 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52401 SRR7170520.ke.tsv 34699 SRR7170520.se.tsv 87100 total ==> SRR7170520.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.19 539 21.0305 Potri.005G024800.1.v4.1 1035 773.188 344 30.4863 Potri.004G059700.1.v4.1 961 699.193 8 0.784015 Potri.007G009000.2.v4.1 1416 1154.19 0 0 Potri.003G141000.2.v4.1 2943 2681.19 439 11.2194 Potri.016G087400.1.v4.1 270 76.4118 1157 1037.54 Potri.015G069301.1.v4.1 564 306.318 0 0 Potri.010G195200.1.v4.1 1773 1511.19 51 2.31251 Potri.012G127500.1.v4.1 977 715.193 253 24.2398 ==> SRR7170520.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 318 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 402 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170520 completed mapping pipeline successfully