Starting /dee2/code/volunteer_pipeline.sh SRR7170521 current disk space = 3052635176960 free memory = 1446802740 SRR7170521 SRAfilesize 817b233beed89fae47eefd40c78b342e SRR7170521.sra SRR7170521.sra file validated SRR7170521 is paired end SRR7170521 is conventional basespace SRR7170521 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170521_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.3525 18.0 18.0 18.0 18.0 32.0 2 26.43075 27.0 25.0 28.0 18.0 30.0 3 27.89075 29.0 27.0 31.0 25.0 33.0 4 30.484 31.0 29.0 33.0 27.0 33.0 5 31.16875 33.0 31.0 33.0 29.0 33.0 6 36.20925 37.0 36.0 38.0 34.0 38.0 7 37.14175 38.0 38.0 38.0 36.0 38.0 8 37.25175 38.0 38.0 38.0 36.0 38.0 9 37.413 38.0 38.0 38.0 37.0 38.0 10-14 37.4678 38.0 38.0 38.0 37.0 38.0 15-19 37.5861 38.0 38.0 38.0 37.4 38.0 20-24 37.590450000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.517100000000006 38.0 38.0 38.0 37.4 38.0 30-34 37.541250000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.525 38.0 38.0 38.0 38.0 38.0 40-44 36.668 38.0 36.6 38.0 33.4 38.0 45-49 36.062799999999996 38.0 36.6 38.0 29.2 38.0 50-54 37.2199 38.0 38.0 38.0 36.4 38.0 55-59 37.32985 38.0 38.0 38.0 37.0 38.0 60-64 37.2359 38.0 38.0 38.0 36.4 38.0 65-69 37.1985 38.0 38.0 38.0 36.4 38.0 70-74 37.010149999999996 38.0 38.0 38.0 35.8 38.0 75-79 37.01145 38.0 38.0 38.0 35.8 38.0 80-84 36.968900000000005 38.0 38.0 38.0 35.8 38.0 85-89 36.6059 38.0 37.8 38.0 34.2 38.0 90-94 36.3897 38.0 37.6 38.0 33.8 38.0 95-99 36.49885 38.0 38.0 38.0 34.0 38.0 100-104 36.49475 38.0 37.8 38.0 34.0 38.0 105-109 36.38775 38.0 37.6 38.0 33.8 38.0 110-114 36.088350000000005 38.0 37.0 38.0 32.8 38.0 115-119 35.669599999999996 38.0 36.4 38.0 30.6 38.0 120-124 35.737 38.0 36.4 38.0 31.4 38.0 125-129 35.4252 38.0 35.8 38.0 30.2 38.0 130-134 35.118 38.0 35.0 38.0 28.0 38.0 135-139 34.93325 38.0 35.0 38.0 28.0 38.0 140-144 34.0374 38.0 33.6 38.0 24.0 38.0 145-149 33.397149999999996 38.0 33.0 38.0 20.8 38.0 150-151 28.368499999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 1.0 20 1.0 21 1.0 22 2.0 23 3.0 24 10.0 25 11.0 26 11.0 27 12.0 28 18.0 29 33.0 30 45.0 31 66.0 32 96.0 33 140.0 34 215.0 35 450.0 36 1169.0 37 1709.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.16929547844374 22.00315457413249 7.255520504731862 31.5720294426919 2 23.986993496748372 14.657328664332168 31.41570785392696 29.939969984992498 3 21.525 20.200000000000003 25.85 32.425 4 23.0 28.499999999999996 24.075 24.425 5 22.75 32.225 23.799999999999997 21.224999999999998 6 18.8 34.025 25.25 21.925 7 14.2 26.0 41.8 18.0 8 17.974999999999998 26.075 30.525000000000002 25.424999999999997 9 17.8 24.0 33.800000000000004 24.4 10-14 19.095000000000002 29.775000000000002 27.32 23.810000000000002 15-19 19.8 28.294999999999998 27.99 23.915 20-24 19.965 28.485 28.03 23.52 25-29 19.455 28.51 28.07 23.965 30-34 19.85 29.285 27.639999999999997 23.225 35-39 19.31 28.470000000000002 28.050000000000004 24.169999999999998 40-44 19.9909995499775 28.561428071403572 27.721386069303467 23.726186309315466 45-49 20.535 28.63 27.150000000000002 23.685000000000002 50-54 20.345 28.185 28.265 23.205000000000002 55-59 20.155 28.685 27.68 23.48 60-64 19.8 28.244999999999997 27.755000000000003 24.2 65-69 20.145 28.105000000000004 28.435 23.315 70-74 20.235 28.970000000000002 27.245 23.549999999999997 75-79 20.1 28.84 27.435 23.625 80-84 20.29 28.735 27.46 23.515 85-89 20.075000000000003 28.275 27.744999999999997 23.905 90-94 20.40102005100255 28.111405570278514 27.40137006850343 24.08620431021551 95-99 20.53 27.905 27.900000000000002 23.665 100-104 20.415 28.89 27.6 23.095 105-109 20.225 28.860000000000003 27.355 23.56 110-114 20.8 28.315 27.41 23.474999999999998 115-119 20.44 28.32 27.855 23.385 120-124 20.990000000000002 27.79 27.675 23.544999999999998 125-129 20.935000000000002 28.389999999999997 27.250000000000004 23.425 130-134 20.69 28.505000000000003 27.175 23.630000000000003 135-139 20.349999999999998 28.139999999999997 27.305 24.205 140-144 21.08 27.93 27.625 23.365 145-149 20.424999999999997 27.944999999999997 27.85 23.78 150-151 20.6625 28.262500000000003 27.1125 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 4.0 27 7.0 28 7.5 29 9.5 30 16.5 31 24.0 32 32.0 33 47.0 34 57.0 35 68.5 36 91.0 37 114.5 38 151.5 39 181.5 40 205.5 41 220.5 42 230.5 43 244.5 44 248.5 45 263.0 46 266.0 47 256.5 48 239.5 49 204.0 50 171.0 51 143.5 52 118.0 53 96.0 54 76.0 55 61.0 56 42.0 57 25.0 58 20.0 59 13.0 60 10.0 61 11.5 62 8.0 63 3.0 64 1.0 65 1.0 66 1.0 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.2000000000000002 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.2874999999999996 0.0 0.0 0.0 0.0 130-131 3.525 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 3.975 0.0 0.0 0.0 0.0 136-137 4.225 0.0 0.0 0.0 0.0 138-139 4.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTCAG 10 0.006862618 144.77501 5 TTGGGAT 10 0.006862618 144.77501 3 >>END_MODULE SRR7170521 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170521_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2505 33.0 32.0 34.0 28.0 34.0 2 32.68525 33.0 33.0 34.0 32.0 34.0 3 29.99875 33.0 27.0 34.0 18.0 34.0 4 31.84525 33.0 32.0 34.0 27.0 34.0 5 32.507 33.0 33.0 34.0 32.0 34.0 6 36.9945 38.0 38.0 38.0 36.0 38.0 7 36.58425 38.0 38.0 38.0 35.0 38.0 8 36.988 38.0 38.0 38.0 36.0 38.0 9 37.06475 38.0 38.0 38.0 37.0 38.0 10-14 37.015750000000004 38.0 38.0 38.0 36.4 38.0 15-19 36.99679999999999 38.0 38.0 38.0 36.2 38.0 20-24 36.76515 38.0 38.0 38.0 35.6 38.0 25-29 36.6029 38.0 38.0 38.0 34.8 38.0 30-34 36.7851 38.0 38.0 38.0 35.8 38.0 35-39 36.905649999999994 38.0 38.0 38.0 36.0 38.0 40-44 35.89375 38.0 36.6 38.0 30.2 38.0 45-49 36.84165 38.0 38.0 38.0 35.4 38.0 50-54 36.839 38.0 38.0 38.0 35.8 38.0 55-59 35.45865 38.0 35.6 38.0 29.2 38.0 60-64 36.28315 38.0 37.8 38.0 33.4 38.0 65-69 35.9934 38.0 37.6 38.0 32.0 38.0 70-74 35.72815000000001 38.0 37.0 38.0 30.8 38.0 75-79 36.44349999999999 38.0 38.0 38.0 34.0 38.0 80-84 36.4593 38.0 38.0 38.0 34.4 38.0 85-89 36.338350000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.354949999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.06985 38.0 37.4 38.0 33.0 38.0 100-104 35.8399 38.0 37.0 38.0 32.2 38.0 105-109 35.57105 38.0 37.0 38.0 30.2 38.0 110-114 35.52 38.0 36.8 38.0 30.6 38.0 115-119 35.110749999999996 38.0 36.0 38.0 28.6 38.0 120-124 34.91415 38.0 35.6 38.0 27.6 38.0 125-129 34.2178 38.0 34.4 38.0 23.4 38.0 130-134 34.14084999999999 38.0 33.4 38.0 24.2 38.0 135-139 33.52675 38.0 33.0 38.0 21.2 38.0 140-144 32.572050000000004 38.0 33.0 38.0 14.4 38.0 145-149 31.574450000000002 38.0 32.6 38.0 8.4 38.0 150-151 25.67125 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 2.0 5 1.0 6 1.0 7 2.0 8 0.0 9 2.0 10 2.0 11 3.0 12 0.0 13 1.0 14 2.0 15 4.0 16 8.0 17 3.0 18 4.0 19 3.0 20 7.0 21 7.0 22 12.0 23 18.0 24 19.0 25 24.0 26 27.0 27 34.0 28 45.0 29 63.0 30 60.0 31 69.0 32 120.0 33 155.0 34 206.0 35 392.0 36 825.0 37 1871.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.275 22.1 11.325000000000001 24.3 2 25.3 27.325 30.75 16.625 3 20.8 27.250000000000004 33.4 18.55 4 23.775 34.725 23.075000000000003 18.425 5 23.95 35.65 23.200000000000003 17.2 6 19.225 38.95 23.7 18.125 7 20.674999999999997 22.175 36.625 20.525 8 21.099999999999998 25.7 28.549999999999997 24.65 9 22.05 25.624999999999996 30.275000000000002 22.05 10-14 22.91 28.799999999999997 26.665 21.625 15-19 22.715 27.68 28.265 21.34 20-24 22.919999999999998 28.439999999999998 27.98 20.66 25-29 22.89 28.185 28.08 20.845 30-34 22.81 28.02 28.65 20.52 35-39 23.25 27.62 28.194999999999997 20.935000000000002 40-44 23.32 28.46 27.134999999999998 21.085 45-49 22.37 27.744999999999997 28.33 21.555 50-54 22.975 28.455000000000002 27.955000000000002 20.615 55-59 23.315 28.244999999999997 27.605 20.835 60-64 24.044999999999998 27.295 27.665 20.995 65-69 22.96 28.025 27.965 21.05 70-74 24.355 28.075 26.97 20.599999999999998 75-79 23.215 28.005000000000003 27.715 21.065 80-84 22.975 28.134999999999998 27.834999999999997 21.055 85-89 23.565 27.084999999999997 28.470000000000002 20.880000000000003 90-94 23.36 28.22 27.43 20.990000000000002 95-99 23.74 28.084999999999997 27.474999999999998 20.7 100-104 23.665 27.800000000000004 27.644999999999996 20.89 105-109 23.65 28.315 27.810000000000002 20.225 110-114 23.7 28.044999999999998 28.084999999999997 20.169999999999998 115-119 24.224999999999998 27.994999999999997 27.875 19.905 120-124 23.84 27.665 27.935 20.560000000000002 125-129 23.985 28.000000000000004 27.87 20.145 130-134 24.47 27.689999999999998 27.529999999999998 20.31 135-139 23.990000000000002 28.02 27.315 20.674999999999997 140-144 23.66 27.605 28.915000000000003 19.82 145-149 24.740000000000002 27.91 27.445000000000004 19.905 150-151 24.587500000000002 27.0875 27.275 21.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.5 25 2.0 26 4.0 27 4.5 28 6.5 29 8.5 30 11.0 31 24.5 32 31.5 33 34.0 34 39.5 35 56.5 36 78.0 37 105.5 38 129.5 39 165.0 40 202.0 41 225.0 42 256.0 43 269.5 44 275.5 45 279.5 46 281.0 47 263.5 48 229.5 49 219.5 50 184.5 51 120.5 52 96.5 53 101.0 54 88.0 55 61.0 56 46.0 57 35.0 58 23.5 59 11.5 60 7.5 61 7.5 62 4.5 63 2.0 64 1.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.42767295597484273 0.8500000000000001 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.8999999999999999 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 3.975 0.0 0.0 0.0 0.0 136-137 4.2125 0.0 0.0 0.0 0.0 138-139 4.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATTG 10 0.006830828 145.0 3 ATTGGTC 10 0.006830828 145.0 4 >>END_MODULE Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856137 spots for SRR7170521.sra Written 856137 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra Read 856119 spots for SRR7170521.sra Written 856119 spots for SRR7170521.sra SRR ids: ['SRR7170521.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wkovwzyd SRR7170521.sra spots: 17122398 blocks: [[1, 856119], [856120, 1712238], [1712239, 2568357], [2568358, 3424476], [3424477, 4280595], [4280596, 5136714], [5136715, 5992833], [5992834, 6848952], [6848953, 7705071], [7705072, 8561190], [8561191, 9417309], [9417310, 10273428], [10273429, 11129547], [11129548, 11985666], [11985667, 12841785], [12841786, 13697904], [13697905, 14554023], [14554024, 15410142], [15410143, 16266261], [16266262, 17122398]] SRR7170521 file size 5780518 SRR7170521 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170521 SRR7170521_1.fastq SRR7170521_2.fastq Input file: SRR7170521_1.fastq Paired file: SRR7170521_2.fastq trimmed: SRR7170521-trimmed-pair1.fastq, SRR7170521-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:35:32 2025 >> started Thu Feb 13 09:40:31 2025 >> done (298.586s) 17122398 read pairs processed; of these: 17233 ( 0.10%) short read pairs filtered out after trimming by size control 20267 ( 0.12%) empty read pairs filtered out after trimming by size control 17084898 (99.78%) read pairs available; of these: 9178489 (53.72%) trimmed read pairs available after processing 7906409 (46.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 4 0.00% 21 5 0.00% 22 4 0.00% 23 4 0.00% 24 6 0.00% 25 3 0.00% 26 9 0.00% 27 5 0.00% 28 5 0.00% 29 6 0.00% 30 13 0.00% 31 9 0.00% 32 6 0.00% 33 10 0.00% 34 11 0.00% 35 12 0.00% 36 12 0.00% 37 25 0.00% 38 19 0.00% 39 25 0.00% 40 27 0.00% 41 31 0.00% 42 32 0.00% 43 29 0.00% 44 42 0.00% 45 50 0.00% 46 54 0.00% 47 71 0.00% 48 95 0.00% 49 105 0.00% 50 117 0.00% 51 107 0.00% 52 154 0.00% 53 162 0.00% 54 172 0.00% 55 191 0.00% 56 209 0.00% 57 238 0.00% 58 259 0.00% 59 312 0.00% 60 381 0.00% 61 445 0.00% 62 498 0.00% 63 591 0.00% 64 582 0.00% 65 665 0.00% 66 707 0.00% 67 789 0.00% 68 973 0.01% 69 994 0.01% 70 1183 0.01% 71 1340 0.01% 72 1649 0.01% 73 1849 0.01% 74 2000 0.01% 75 2233 0.01% 76 2802 0.02% 77 2876 0.02% 78 2791 0.02% 79 3107 0.02% 80 3465 0.02% 81 3956 0.02% 82 4570 0.03% 83 4934 0.03% 84 6043 0.04% 85 6986 0.04% 86 7092 0.04% 87 7566 0.04% 88 7923 0.05% 89 8397 0.05% 90 8882 0.05% 91 9316 0.05% 92 10183 0.06% 93 11091 0.06% 94 11728 0.07% 95 12507 0.07% 96 12791 0.07% 97 13321 0.08% 98 13512 0.08% 99 14100 0.08% 100 14654 0.09% 101 15368 0.09% 102 16623 0.10% 103 17174 0.10% 104 18085 0.11% 105 18774 0.11% 106 19247 0.11% 107 19781 0.12% 108 20113 0.12% 109 20564 0.12% 110 21135 0.12% 111 21710 0.13% 112 22379 0.13% 113 23771 0.14% 114 24342 0.14% 115 25428 0.15% 116 26294 0.15% 117 26976 0.16% 118 27158 0.16% 119 27627 0.16% 120 28392 0.17% 121 29283 0.17% 122 30444 0.18% 123 31883 0.19% 124 33477 0.20% 125 34342 0.20% 126 35702 0.21% 127 37348 0.22% 128 38815 0.23% 129 40013 0.23% 130 42123 0.25% 131 43944 0.26% 132 47393 0.28% 133 49821 0.29% 134 53247 0.31% 135 57429 0.34% 136 62191 0.36% 137 67846 0.40% 138 72853 0.43% 139 79668 0.47% 140 88563 0.52% 141 99865 0.58% 142 115072 0.67% 143 136151 0.80% 144 163915 0.96% 145 204319 1.20% 146 262177 1.53% 147 362734 2.12% 148 559927 3.28% 149 1100037 6.44% 150 4532838 26.53% 151 7906409 46.28% 17084898 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=16 prefix-density=0.54 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=323.59 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=17 prefix-density=0.60 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=20.48 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.2 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR7170521 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:24:32 Started mapping on | Feb 13 10:24:58 Finished on | Feb 13 11:05:40 Mapping speed, Million of reads per hour | 25.19 Number of input reads | 17084898 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16144878 Uniquely mapped reads % | 94.50% Average mapped length | 293.54 Number of splices: Total | 15940462 Number of splices: Annotated (sjdb) | 15574035 Number of splices: GT/AG | 15633587 Number of splices: GC/AG | 252650 Number of splices: AT/AC | 9375 Number of splices: Non-canonical | 44850 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456788 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 28283 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 498753 498753 498753 N_multimapping 456788 456788 456788 N_noFeature 583181 15860997 679251 N_ambiguous 315578 1097 127184 UnstrandedReadsAssigned:15246119 PositiveStrandReadsAssigned:282784 NegativeStrandReadsAssigned:15338443 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170521 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170521-trimmed-pair1.fastq SRR7170521-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,084,898 reads, 15,271,725 reads pseudoaligned [quant] estimated average fragment length: 272.633 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR7170521.ke.tsv 34699 SRR7170521.se.tsv 87100 total ==> SRR7170521.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.37 726 24.0397 Potri.005G024800.1.v4.1 1035 763.367 315 23.8619 Potri.004G059700.1.v4.1 961 689.408 7 0.58715 Potri.007G009000.2.v4.1 1416 1144.37 0 0 Potri.003G141000.2.v4.1 2943 2671.37 712.158 15.4159 Potri.016G087400.1.v4.1 270 76.437 804 608.247 Potri.015G069301.1.v4.1 564 298.63 0 0 Potri.010G195200.1.v4.1 1773 1501.37 34 1.30954 Potri.012G127500.1.v4.1 977 705.393 80 6.55822 ==> SRR7170521.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 469 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 34 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 63 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1 SRR7170521 completed mapping pipeline successfully