Starting /dee2/code/volunteer_pipeline.sh SRR7170612 current disk space = 3092714602496 free memory = 1567401240 SRR7170612 SRAfilesize d0f2b7fb37a7f0d566e56eac5eb7b620 SRR7170612.sra SRR7170612.sra file validated SRR7170612 is paired end SRR7170612 is conventional basespace SRR7170612 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170612_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.00625 28.0 18.0 32.0 18.0 33.0 2 31.10825 31.0 30.0 33.0 27.0 33.0 3 31.7115 33.0 31.0 33.0 29.0 33.0 4 32.155 33.0 33.0 33.0 31.0 34.0 5 32.69375 33.0 33.0 34.0 31.0 34.0 6 37.00925 38.0 37.0 38.0 35.0 38.0 7 37.11 38.0 38.0 38.0 36.0 38.0 8 37.3555 38.0 38.0 38.0 37.0 38.0 9 37.35225 38.0 38.0 38.0 37.0 38.0 10-14 37.3304 38.0 38.0 38.0 37.0 38.0 15-19 37.3662 38.0 38.0 38.0 37.0 38.0 20-24 37.465050000000005 38.0 38.0 38.0 37.2 38.0 25-29 37.504099999999994 38.0 38.0 38.0 37.8 38.0 30-34 37.473749999999995 38.0 38.0 38.0 37.8 38.0 35-39 37.423199999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.408849999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.37949999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.2472 38.0 38.0 38.0 36.8 38.0 55-59 37.178999999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.135149999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.12905 38.0 38.0 38.0 36.0 38.0 70-74 37.04015 38.0 38.0 38.0 36.0 38.0 75-79 36.9049 38.0 38.0 38.0 35.6 38.0 80-84 36.76985 38.0 38.0 38.0 35.2 38.0 85-89 36.749849999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.58105 38.0 38.0 38.0 34.4 38.0 95-99 36.48035 38.0 38.0 38.0 34.0 38.0 100-104 36.300700000000006 38.0 37.2 38.0 33.8 38.0 105-109 36.2125 38.0 37.0 38.0 33.6 38.0 110-114 35.8702 38.0 37.0 38.0 31.8 38.0 115-119 35.6743 38.0 36.2 38.0 30.8 38.0 120-124 35.5056 38.0 36.0 38.0 31.0 38.0 125-129 35.395799999999994 38.0 36.0 38.0 30.4 38.0 130-134 35.1803 38.0 35.4 38.0 29.4 38.0 135-139 34.71935 38.0 35.0 38.0 27.6 38.0 140-144 34.229400000000005 38.0 34.6 38.0 25.2 38.0 145-149 33.2993 38.0 33.2 38.0 20.6 38.0 150-151 28.391000000000002 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 2.0 18 3.0 19 11.0 20 2.0 21 2.0 22 4.0 23 6.0 24 4.0 25 7.0 26 10.0 27 14.0 28 20.0 29 31.0 30 38.0 31 50.0 32 90.0 33 110.0 34 208.0 35 374.0 36 915.0 37 2092.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.33795582948125 17.539804827940422 11.941448382126348 34.18079096045198 2 19.975 24.45 38.75 16.825000000000003 3 16.45 31.624999999999996 28.050000000000004 23.875 4 20.875 35.35 23.25 20.525 5 20.70263488080301 37.11417816813049 24.015056461731493 18.168130489335006 6 16.950000000000003 35.15 25.074999999999996 22.825 7 13.200000000000001 19.275000000000002 45.525 22.0 8 16.75 22.325 29.125 31.8 9 16.75 21.175 32.725 29.349999999999998 10-14 19.275000000000002 30.14 26.650000000000002 23.935000000000002 15-19 19.31 28.18 27.560000000000002 24.95 20-24 20.01 28.38 27.235 24.375 25-29 19.57 28.715000000000003 27.725 23.990000000000002 30-34 19.715 29.38 27.089999999999996 23.815 35-39 19.465 29.755 27.185 23.595 40-44 19.825 30.115 26.740000000000002 23.32 45-49 20.025000000000002 29.125 26.965 23.885 50-54 19.73 28.799999999999997 27.3 24.169999999999998 55-59 19.75 28.425 27.71 24.115000000000002 60-64 20.32 28.405 27.224999999999998 24.05 65-69 20.115 28.470000000000002 27.589999999999996 23.825 70-74 19.695 28.915000000000003 27.615000000000002 23.775 75-79 20.45 28.88 27.115000000000002 23.555 80-84 20.035 28.23 27.334999999999997 24.4 85-89 20.14 28.849999999999998 26.69 24.32 90-94 20.51 28.815 26.640000000000004 24.035 95-99 20.72 28.425 27.63 23.225 100-104 20.424999999999997 28.305000000000003 27.639999999999997 23.630000000000003 105-109 20.34 28.005000000000003 27.27 24.385 110-114 20.7 27.865000000000002 27.63 23.805 115-119 21.145 28.04 27.13 23.685000000000002 120-124 21.055 28.43 27.26 23.255 125-129 20.979999999999997 28.705000000000002 26.855 23.46 130-134 21.240000000000002 28.27 26.655 23.835 135-139 21.025 28.000000000000004 26.82 24.154999999999998 140-144 20.905 27.96 27.150000000000002 23.985 145-149 20.669999999999998 27.985 26.955000000000002 24.39 150-151 20.287679799874923 27.904940587867415 27.954971857410882 23.85240775484678 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 1.0 23 3.0 24 4.5 25 5.5 26 7.0 27 7.5 28 12.0 29 21.5 30 27.5 31 27.5 32 42.0 33 54.5 34 64.5 35 86.0 36 101.0 37 131.5 38 150.5 39 158.0 40 186.0 41 196.5 42 208.5 43 227.5 44 238.5 45 246.0 46 241.5 47 231.0 48 230.5 49 209.0 50 173.5 51 147.5 52 113.5 53 95.0 54 86.5 55 71.5 56 60.0 57 45.5 58 26.0 59 19.5 60 12.0 61 8.5 62 8.5 63 2.5 64 1.0 65 0.5 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.65 2 0.0 3 0.0 4 0.0 5 0.375 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.17808570695406 95.65 2 1.4626635873749037 2.85 3 0.2052861175263023 0.6 4 0.07698229407236336 0.3 5 0.025660764690787787 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025660764690787787 0.22499999999999998 >10 0.025660764690787787 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 10 0.25 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 7 (97% over 35bp) GTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.5875 0.0 0.0 0.0 0.0 116-117 1.8624999999999998 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.6 0.0 0.0 0.0 0.0 130-131 3.7750000000000004 0.0 0.0 0.0 0.0 132-133 4.1875 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170612 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170612_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65925 33.0 33.0 34.0 32.0 34.0 2 32.88325 33.0 33.0 34.0 32.0 34.0 3 32.9635 34.0 33.0 34.0 32.0 34.0 4 32.88175 34.0 33.0 34.0 32.0 34.0 5 32.9425 34.0 33.0 34.0 32.0 34.0 6 37.1115 38.0 38.0 38.0 37.0 38.0 7 37.16925 38.0 38.0 38.0 37.0 38.0 8 37.2055 38.0 38.0 38.0 37.0 38.0 9 37.12475 38.0 38.0 38.0 37.0 38.0 10-14 37.16495 38.0 38.0 38.0 37.0 38.0 15-19 37.14205 38.0 38.0 38.0 36.8 38.0 20-24 37.082100000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.05499999999999 38.0 38.0 38.0 37.0 38.0 30-34 36.9775 38.0 38.0 38.0 36.2 38.0 35-39 37.061949999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.026599999999995 38.0 38.0 38.0 36.8 38.0 45-49 37.001549999999995 38.0 38.0 38.0 36.4 38.0 50-54 36.9248 38.0 38.0 38.0 36.0 38.0 55-59 36.802299999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.7714 38.0 38.0 38.0 36.0 38.0 65-69 36.7926 38.0 38.0 38.0 36.0 38.0 70-74 36.735099999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.7054 38.0 38.0 38.0 35.4 38.0 80-84 36.52485 38.0 38.0 38.0 35.0 38.0 85-89 36.433 38.0 38.0 38.0 34.6 38.0 90-94 36.34425 38.0 38.0 38.0 34.2 38.0 95-99 36.16265 38.0 38.0 38.0 33.8 38.0 100-104 36.0689 38.0 38.0 38.0 34.0 38.0 105-109 36.0403 38.0 38.0 38.0 33.8 38.0 110-114 35.8035 38.0 37.4 38.0 32.8 38.0 115-119 35.52175 38.0 36.8 38.0 31.2 38.0 120-124 35.5334 38.0 36.8 38.0 31.0 38.0 125-129 35.17035 38.0 36.0 38.0 30.0 38.0 130-134 34.8213 38.0 36.0 38.0 28.4 38.0 135-139 34.476600000000005 38.0 35.2 38.0 27.4 38.0 140-144 34.0831 38.0 33.4 38.0 25.8 38.0 145-149 32.99055 38.0 33.0 38.0 18.4 38.0 150-151 27.619 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 7.0 4 2.0 5 3.0 6 2.0 7 1.0 8 1.0 9 2.0 10 2.0 11 0.0 12 4.0 13 3.0 14 5.0 15 1.0 16 5.0 17 6.0 18 5.0 19 9.0 20 11.0 21 6.0 22 11.0 23 7.0 24 12.0 25 13.0 26 17.0 27 20.0 28 15.0 29 22.0 30 38.0 31 50.0 32 68.0 33 97.0 34 152.0 35 301.0 36 639.0 37 2457.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.775 17.375 14.7 29.15 2 22.35 25.2 35.55 16.900000000000002 3 19.025 26.700000000000003 33.575 20.7 4 23.200000000000003 34.625 21.95 20.225 5 22.875 38.074999999999996 20.775 18.275 6 18.509254627313656 37.81890945472736 23.686843421710854 19.984992496248125 7 17.333666833416707 16.683341670835418 42.94647323661831 23.036518259129565 8 20.535267633816908 24.062031015507753 26.338169084542272 29.064532266133064 9 22.811405702851424 23.56178089044522 28.039019509754876 25.587793896948476 10-14 22.38395358143257 29.00660264105642 26.375550220088034 22.233893557422967 15-19 22.74182254676403 28.15844753426028 27.573271981594477 21.526457937381213 20-24 22.812984544590606 28.474966238183363 27.63967388586005 21.07237533136598 25-29 22.722953033561748 28.630020507177512 27.734707147501624 20.912319311759113 30-34 22.342819986995448 28.439953983894362 27.724703646276193 21.492522382833993 35-39 23.14657328664332 28.4392196098049 27.348674337168582 21.065532766383193 40-44 22.79639819909955 27.968984492246125 27.968984492246125 21.265632816408203 45-49 22.483993597438975 28.11124449779912 27.751100440176067 21.653661464585834 50-54 23.048066823388186 27.104486570299606 27.689691391987196 22.157755214325014 55-59 23.08654327163582 27.503751875937972 27.85892946473237 21.550775387693847 60-64 23.35434173669468 26.98579431772709 27.305922368947577 22.35394157663065 65-69 23.352005601680503 27.183154946483945 27.198159447834353 22.2666800040012 70-74 23.018452767915186 27.98419762964445 27.00405060759114 21.993298994849226 75-79 23.730932733183295 27.79194798699675 27.14678669667417 21.330332583145786 80-84 23.440860215053764 27.526881720430108 27.03675918979745 21.99549887471868 85-89 23.300825206301575 27.771942985746435 27.421855463865967 21.50537634408602 90-94 23.86357953693054 27.889183377506626 27.56413462019303 20.683102465369803 95-99 23.68118405920296 28.056402820141006 26.686334316715836 21.576078803940195 100-104 24.341217060853044 28.286414320716034 26.451322566128304 20.921046052302618 105-109 24.027208162448733 27.30319095728719 27.80334100230069 20.86625987796339 110-114 24.090840878395277 27.822520134060326 27.152218498324242 20.934420489220148 115-119 23.76450580232093 28.396358543417367 26.91076430572229 20.928371348539414 120-124 24.79119779944986 27.516879219804952 26.81670417604401 20.875218804701177 125-129 24.027208162448733 28.65859757927378 26.803040912273683 20.511153346003802 130-134 24.191047761940485 27.806951737934483 26.976744186046513 21.02525631407852 135-139 24.032016008004 27.903951975987994 27.283641820910454 20.78039019509755 140-144 23.80190095047524 27.988994497248626 27.55377688844422 20.655327663831915 145-149 24.7862393119656 28.006400320016 27.396369818490925 19.810990549527478 150-151 25.825 27.825 27.125 19.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 2.0 23 2.0 24 2.5 25 5.5 26 6.5 27 6.5 28 10.5 29 11.5 30 14.0 31 20.0 32 30.0 33 41.5 34 49.0 35 61.5 36 79.5 37 105.0 38 119.5 39 146.5 40 174.5 41 196.0 42 217.0 43 224.0 44 243.0 45 271.5 46 280.0 47 251.5 48 225.0 49 220.5 50 183.5 51 146.5 52 123.5 53 105.0 54 98.5 55 84.0 56 72.0 57 51.0 58 35.5 59 25.5 60 20.0 61 15.5 62 8.0 63 2.0 64 0.5 65 1.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.04 15-19 0.03 20-24 0.034999999999999996 25-29 0.034999999999999996 30-34 0.034999999999999996 35-39 0.05 40-44 0.05 45-49 0.04 50-54 0.034999999999999996 55-59 0.05 60-64 0.04 65-69 0.03 70-74 0.015 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.015 95-99 0.005 100-104 0.005 105-109 0.03 110-114 0.045 115-119 0.04 120-124 0.025 125-129 0.03 130-134 0.025 135-139 0.05 140-144 0.05 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.74377593360995 94.22500000000001 2 1.5300829875518671 2.9499999999999997 3 0.4927385892116182 1.425 4 0.1037344398340249 0.4 5 0.05186721991701245 0.25 6 0.025933609958506226 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05186721991701245 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 14 0.35000000000000003 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 10 0.25 Illumina Single End PCR Primer 1 (96% over 32bp) CATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 6 0.15 No Hit CATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit GTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9874999999999999 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.8875000000000002 0.0 0.0 0.0 0.0 118-119 2.275 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.65 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.2375 0.0 0.0 0.0 0.0 134-135 4.425 0.0 0.0 0.0 0.0 136-137 4.7375 0.0 0.0 0.0 0.0 138-139 5.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTGAC 10 0.006830828 145.0 8 >>END_MODULE Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825622 spots for SRR7170612.sra Written 825622 spots for SRR7170612.sra Read 825637 spots for SRR7170612.sra Written 825637 spots for SRR7170612.sra SRR ids: ['SRR7170612.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xr8vp5nf SRR7170612.sra spots: 16512455 blocks: [[1, 825622], [825623, 1651244], [1651245, 2476866], [2476867, 3302488], [3302489, 4128110], [4128111, 4953732], [4953733, 5779354], [5779355, 6604976], [6604977, 7430598], [7430599, 8256220], [8256221, 9081842], [9081843, 9907464], [9907465, 10733086], [10733087, 11558708], [11558709, 12384330], [12384331, 13209952], [13209953, 14035574], [14035575, 14861196], [14861197, 15686818], [15686819, 16512455]] SRR7170612 file size 5573828 SRR7170612 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170612 SRR7170612_1.fastq SRR7170612_2.fastq Input file: SRR7170612_1.fastq Paired file: SRR7170612_2.fastq trimmed: SRR7170612-trimmed-pair1.fastq, SRR7170612-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:07:09 2025 >> started Thu Feb 13 11:07:26 2025 >> done (16.744s) 16512455 read pairs processed; of these: 12378 ( 0.07%) short read pairs filtered out after trimming by size control 44180 ( 0.27%) empty read pairs filtered out after trimming by size control 16455897 (99.66%) read pairs available; of these: 8281681 (50.33%) trimmed read pairs available after processing 8174216 (49.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 5 0.00% 21 4 0.00% 22 13 0.00% 23 15 0.00% 24 13 0.00% 25 8 0.00% 26 10 0.00% 27 10 0.00% 28 4 0.00% 29 14 0.00% 30 9 0.00% 31 5 0.00% 32 8 0.00% 33 20 0.00% 34 22 0.00% 35 19 0.00% 36 19 0.00% 37 18 0.00% 38 21 0.00% 39 29 0.00% 40 30 0.00% 41 42 0.00% 42 48 0.00% 43 49 0.00% 44 35 0.00% 45 54 0.00% 46 51 0.00% 47 67 0.00% 48 67 0.00% 49 75 0.00% 50 99 0.00% 51 139 0.00% 52 118 0.00% 53 131 0.00% 54 140 0.00% 55 147 0.00% 56 154 0.00% 57 175 0.00% 58 223 0.00% 59 267 0.00% 60 288 0.00% 61 307 0.00% 62 360 0.00% 63 423 0.00% 64 423 0.00% 65 471 0.00% 66 518 0.00% 67 536 0.00% 68 626 0.00% 69 691 0.00% 70 840 0.01% 71 877 0.01% 72 1077 0.01% 73 1178 0.01% 74 1245 0.01% 75 1500 0.01% 76 1872 0.01% 77 2229 0.01% 78 1824 0.01% 79 2096 0.01% 80 2170 0.01% 81 2602 0.02% 82 2951 0.02% 83 3321 0.02% 84 4363 0.03% 85 4897 0.03% 86 5198 0.03% 87 5518 0.03% 88 5787 0.04% 89 6177 0.04% 90 6425 0.04% 91 6943 0.04% 92 7399 0.04% 93 8155 0.05% 94 8629 0.05% 95 9038 0.05% 96 9498 0.06% 97 9485 0.06% 98 9936 0.06% 99 10336 0.06% 100 11110 0.07% 101 11643 0.07% 102 12487 0.08% 103 13466 0.08% 104 13631 0.08% 105 14783 0.09% 106 15254 0.09% 107 15367 0.09% 108 16208 0.10% 109 16194 0.10% 110 17034 0.10% 111 17860 0.11% 112 18702 0.11% 113 20232 0.12% 114 20888 0.13% 115 21371 0.13% 116 22307 0.14% 117 22429 0.14% 118 23095 0.14% 119 23438 0.14% 120 24241 0.15% 121 24955 0.15% 122 26099 0.16% 123 27792 0.17% 124 29293 0.18% 125 30011 0.18% 126 31868 0.19% 127 32453 0.20% 128 33483 0.20% 129 35147 0.21% 130 36433 0.22% 131 38143 0.23% 132 39783 0.24% 133 42832 0.26% 134 45751 0.28% 135 48948 0.30% 136 53305 0.32% 137 57094 0.35% 138 62072 0.38% 139 68031 0.41% 140 73999 0.45% 141 84819 0.52% 142 97652 0.59% 143 112913 0.69% 144 131697 0.80% 145 165579 1.01% 146 215973 1.31% 147 310910 1.89% 148 473844 2.88% 149 939382 5.71% 150 4389083 26.67% 151 8174216 49.67% 16455897 reads passed initial QC criterion=sequence-density sequence-density=1.96 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=1.78 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=54.23 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.5 sequence=TAAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGG criterion=sequence-density sequence-density=1.61 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=1.62 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=22.32 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.3 sequence=CAGCATCCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR7170612 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:08:10 Started mapping on | Feb 13 11:08:10 Finished on | Feb 13 11:22:17 Mapping speed, Million of reads per hour | 69.94 Number of input reads | 16455897 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15141044 Uniquely mapped reads % | 92.01% Average mapped length | 294.99 Number of splices: Total | 15998443 Number of splices: Annotated (sjdb) | 15698262 Number of splices: GT/AG | 15714225 Number of splices: GC/AG | 235610 Number of splices: AT/AC | 9740 Number of splices: Non-canonical | 38868 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 441182 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 46814 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.96% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 886995 886995 886995 N_multimapping 441182 441182 441182 N_noFeature 422100 14715057 493153 N_ambiguous 464090 673 108764 UnstrandedReadsAssigned:14254854 PositiveStrandReadsAssigned:425314 NegativeStrandReadsAssigned:14539127 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170612 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170612-trimmed-pair1.fastq SRR7170612-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,455,897 reads, 14,331,859 reads pseudoaligned [quant] estimated average fragment length: 274.639 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,017 rounds 52401 SRR7170612.ke.tsv 34699 SRR7170612.se.tsv 87100 total ==> SRR7170612.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.36 386 8.85884 Potri.005G024800.1.v4.1 1035 761.361 220 11.568 Potri.004G059700.1.v4.1 961 687.45 23 1.33941 Potri.007G009000.2.v4.1 1416 1142.36 0 0 Potri.003G141000.2.v4.1 2943 2669.36 331 4.96417 Potri.016G087400.1.v4.1 270 73.763 1196 649.11 Potri.015G069301.1.v4.1 564 299.352 0 0 Potri.010G195200.1.v4.1 1773 1499.36 4 0.106802 Potri.012G127500.1.v4.1 977 703.396 252 14.3426 ==> SRR7170612.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 535 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 422 Potri.001G212900.v4.1 145 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170612 completed mapping pipeline successfully