Starting /dee2/code/volunteer_pipeline.sh SRR7170613 current disk space = 3093210411008 free memory = 1564197592 SRR7170613 SRAfilesize de2ded71b87afb8078f31fafe8a2eaf0 SRR7170613.sra SRR7170613.sra file validated SRR7170613 is paired end SRR7170613 is conventional basespace SRR7170613 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170613_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.955 27.0 18.0 32.0 18.0 33.0 2 31.10775 31.0 30.0 33.0 27.0 33.0 3 31.938 33.0 31.0 33.0 29.0 33.0 4 32.68675 33.0 33.0 33.0 32.0 34.0 5 33.07075 33.0 33.0 34.0 33.0 34.0 6 37.265 38.0 38.0 38.0 36.0 38.0 7 37.43625 38.0 38.0 38.0 37.0 38.0 8 37.4785 38.0 38.0 38.0 37.0 38.0 9 37.4875 38.0 38.0 38.0 37.0 38.0 10-14 37.46205 38.0 38.0 38.0 37.4 38.0 15-19 37.41035 38.0 38.0 38.0 37.0 38.0 20-24 37.50725 38.0 38.0 38.0 37.4 38.0 25-29 37.534349999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.4853 38.0 38.0 38.0 38.0 38.0 35-39 37.477050000000006 38.0 38.0 38.0 37.4 38.0 40-44 37.43585 38.0 38.0 38.0 37.0 38.0 45-49 37.42645 38.0 38.0 38.0 37.0 38.0 50-54 37.31505 38.0 38.0 38.0 37.0 38.0 55-59 37.218900000000005 38.0 38.0 38.0 36.4 38.0 60-64 37.1742 38.0 38.0 38.0 36.2 38.0 65-69 37.1226 38.0 38.0 38.0 36.0 38.0 70-74 37.084250000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.94305 38.0 38.0 38.0 35.8 38.0 80-84 36.8572 38.0 38.0 38.0 35.4 38.0 85-89 36.771950000000004 38.0 38.0 38.0 35.2 38.0 90-94 36.661750000000005 38.0 38.0 38.0 34.6 38.0 95-99 36.4692 38.0 38.0 38.0 34.0 38.0 100-104 36.335800000000006 38.0 37.8 38.0 33.8 38.0 105-109 36.14505 38.0 37.0 38.0 33.4 38.0 110-114 36.0362 38.0 37.0 38.0 33.2 38.0 115-119 35.716699999999996 38.0 37.0 38.0 31.4 38.0 120-124 35.582100000000004 38.0 36.4 38.0 31.2 38.0 125-129 35.5013 38.0 36.0 38.0 31.0 38.0 130-134 35.32965 38.0 36.0 38.0 30.4 38.0 135-139 34.7726 38.0 34.6 38.0 28.2 38.0 140-144 34.0538 38.0 33.8 38.0 24.2 38.0 145-149 33.57565 38.0 33.0 38.0 23.0 38.0 150-151 29.287125 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 4.0 17 1.0 18 5.0 19 10.0 20 5.0 21 4.0 22 5.0 23 4.0 24 6.0 25 8.0 26 13.0 27 16.0 28 20.0 29 16.0 30 44.0 31 48.0 32 82.0 33 97.0 34 165.0 35 324.0 36 869.0 37 2248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.0305576776165 19.786096256684495 13.01247771836007 27.170868347338935 2 20.5 24.55 34.150000000000006 20.8 3 16.025 32.35 29.9 21.725 4 18.9 36.375 24.6 20.125 5 19.844844844844843 36.06106106106106 23.723723723723726 20.37037037037037 6 17.9 33.95 26.075 22.075 7 14.2 20.200000000000003 44.275 21.325 8 18.099999999999998 22.075 27.800000000000004 32.025 9 17.299999999999997 23.1 29.925 29.675 10-14 20.155 29.765000000000004 26.135 23.945 15-19 19.54 28.645 27.18 24.635 20-24 20.150000000000002 29.025000000000002 26.974999999999998 23.849999999999998 25-29 19.97 29.165000000000003 27.650000000000002 23.215 30-34 19.869999999999997 29.165000000000003 27.46 23.505000000000003 35-39 20.044999999999998 28.595 27.175 24.185000000000002 40-44 20.23 28.46 27.57 23.74 45-49 19.81 28.48 27.42 24.29 50-54 20.075000000000003 28.65 27.355 23.919999999999998 55-59 20.155 28.705000000000002 27.55 23.59 60-64 20.31 28.23 27.715 23.745 65-69 20.255000000000003 28.38 27.975 23.39 70-74 20.24 28.725 27.245 23.79 75-79 20.330000000000002 28.965000000000003 26.86 23.845 80-84 20.47 28.18 27.445000000000004 23.905 85-89 21.195 28.68 27.005000000000003 23.119999999999997 90-94 20.49 27.74 28.055000000000003 23.715 95-99 20.36 28.065 27.765 23.810000000000002 100-104 20.880000000000003 28.38 26.384999999999998 24.355 105-109 20.974999999999998 27.82 27.565 23.64 110-114 20.665 28.015 28.205000000000002 23.115 115-119 21.3 28.605000000000004 26.33 23.765 120-124 20.919999999999998 28.439999999999998 26.935 23.705000000000002 125-129 20.565 27.889999999999997 27.255000000000003 24.29 130-134 20.775 27.805000000000003 27.384999999999998 24.035 135-139 20.674999999999997 28.185 27.33 23.810000000000002 140-144 21.505 27.505000000000003 26.845000000000002 24.145 145-149 21.395 27.48 27.229999999999997 23.895 150-151 21.0375 28.499999999999996 26.325 24.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 1.0 25 2.5 26 6.5 27 10.5 28 13.0 29 16.5 30 18.5 31 27.5 32 40.0 33 56.0 34 65.5 35 68.5 36 96.0 37 112.5 38 130.5 39 164.0 40 187.0 41 203.5 42 216.5 43 234.5 44 237.0 45 248.5 46 270.0 47 261.5 48 242.5 49 218.5 50 187.0 51 159.0 52 123.0 53 92.5 54 75.5 55 53.5 56 37.5 57 33.5 58 28.0 59 22.5 60 15.0 61 7.5 62 5.0 63 2.5 64 1.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7789366573391 97.075 2 0.9666751462732129 1.9 3 0.2035105571101501 0.6 4 0.0 0.0 5 0.0 0.0 6 0.02543881963876876 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02543881963876876 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 19 (97% over 38bp) GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.1375 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.6 0.0 0.0 0.0 0.0 128-129 2.75 0.0 0.0 0.0 0.0 130-131 2.95 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAGCCA 10 0.006830828 145.0 3 ACTTCCT 10 0.006830828 145.0 145 ATTGCTC 10 0.006830828 145.0 9 CCTTTTG 10 0.006830828 145.0 7 TTAAGCC 10 0.006830828 145.0 2 TGGATCA 10 0.006830828 145.0 4 GCCATTG 10 0.006830828 145.0 6 TTGGATC 10 0.006830828 145.0 3 >>END_MODULE SRR7170613 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170613_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84825 33.0 33.0 34.0 32.0 34.0 2 32.95 33.0 33.0 34.0 32.0 34.0 3 32.9965 34.0 33.0 34.0 32.0 34.0 4 32.836 34.0 33.0 34.0 32.0 34.0 5 32.942 34.0 33.0 34.0 32.0 34.0 6 37.086 38.0 38.0 38.0 37.0 38.0 7 37.14925 38.0 38.0 38.0 37.0 38.0 8 37.17675 38.0 38.0 38.0 37.0 38.0 9 37.05775 38.0 38.0 38.0 37.0 38.0 10-14 37.07815 38.0 38.0 38.0 37.0 38.0 15-19 37.08335 38.0 38.0 38.0 37.0 38.0 20-24 37.02505 38.0 38.0 38.0 37.0 38.0 25-29 37.01405 38.0 38.0 38.0 37.0 38.0 30-34 36.9865 38.0 38.0 38.0 37.0 38.0 35-39 37.002300000000005 38.0 38.0 38.0 37.0 38.0 40-44 36.9627 38.0 38.0 38.0 36.8 38.0 45-49 36.93905 38.0 38.0 38.0 36.4 38.0 50-54 36.83795 38.0 38.0 38.0 36.0 38.0 55-59 36.841150000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.74745 38.0 38.0 38.0 36.0 38.0 65-69 36.73685 38.0 38.0 38.0 35.8 38.0 70-74 36.70035 38.0 38.0 38.0 36.0 38.0 75-79 36.65769999999999 38.0 38.0 38.0 35.6 38.0 80-84 36.48479999999999 38.0 38.0 38.0 35.0 38.0 85-89 36.40385 38.0 38.0 38.0 34.6 38.0 90-94 36.32745 38.0 38.0 38.0 34.6 38.0 95-99 36.1537 38.0 38.0 38.0 34.0 38.0 100-104 36.00165 38.0 38.0 38.0 33.6 38.0 105-109 35.9452 38.0 38.0 38.0 33.4 38.0 110-114 35.72565 38.0 37.2 38.0 32.4 38.0 115-119 35.494150000000005 38.0 37.0 38.0 31.0 38.0 120-124 35.43775000000001 38.0 37.0 38.0 31.0 38.0 125-129 35.17810000000001 38.0 36.4 38.0 30.4 38.0 130-134 34.621849999999995 38.0 35.4 38.0 27.4 38.0 135-139 34.2996 38.0 34.4 38.0 26.6 38.0 140-144 33.61925000000001 38.0 33.0 38.0 22.2 38.0 145-149 32.723499999999994 38.0 33.0 38.0 13.4 38.0 150-151 27.303 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 11.0 4 3.0 5 1.0 6 1.0 7 0.0 8 0.0 9 5.0 10 2.0 11 2.0 12 2.0 13 3.0 14 6.0 15 4.0 16 2.0 17 3.0 18 9.0 19 12.0 20 10.0 21 4.0 22 7.0 23 8.0 24 12.0 25 15.0 26 11.0 27 25.0 28 17.0 29 32.0 30 45.0 31 46.0 32 70.0 33 93.0 34 139.0 35 243.0 36 663.0 37 2483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.6 18.224999999999998 14.475 23.7 2 25.775 22.15 31.674999999999997 20.4 3 20.849999999999998 24.775 32.574999999999996 21.8 4 22.025 35.05 21.775 21.15 5 23.200000000000003 37.875 21.05 17.875 6 19.125 38.175 22.025 20.674999999999997 7 17.599999999999998 16.45 44.175 21.775 8 21.8 22.525000000000002 25.424999999999997 30.25 9 22.48062015503876 24.681170292573142 27.25681420355089 25.581395348837212 10-14 22.48 27.97 27.310000000000002 22.24 15-19 22.57 27.62 28.175 21.634999999999998 20-24 22.955000000000002 28.105000000000004 27.994999999999997 20.945 25-29 23.13 27.765 28.050000000000004 21.055 30-34 23.615 26.840000000000003 28.12 21.425 35-39 23.187318731873187 27.4977497749775 27.82278227822782 21.49214921492149 40-44 22.872287228722872 27.69276927692769 28.14281428142814 21.292129212921292 45-49 23.04 26.740000000000002 28.660000000000004 21.560000000000002 50-54 22.5 27.24 28.33 21.93 55-59 23.595 27.07 28.16 21.175 60-64 23.215 27.650000000000002 27.525 21.61 65-69 23.064999999999998 27.560000000000002 27.889999999999997 21.485000000000003 70-74 23.549999999999997 27.689999999999998 27.61 21.15 75-79 23.35116755837792 27.541377068853446 27.536376818840942 21.5710785539277 80-84 23.06 27.505000000000003 27.72 21.715 85-89 23.044999999999998 27.744999999999997 27.415 21.795 90-94 23.505000000000003 28.144999999999996 27.169999999999998 21.18 95-99 22.705000000000002 28.83 26.979999999999997 21.485000000000003 100-104 23.39 28.194999999999997 27.229999999999997 21.185000000000002 105-109 23.56 27.634999999999998 27.750000000000004 21.055 110-114 23.645 28.13 27.29 20.935000000000002 115-119 23.794999999999998 27.32 27.295 21.59 120-124 24.33 27.875 27.04 20.755000000000003 125-129 24.035 27.36 27.92 20.685000000000002 130-134 24.665 27.68 27.21 20.445 135-139 23.96 27.584999999999997 27.54 20.915 140-144 24.14 27.405 27.99 20.465 145-149 23.880000000000003 27.725 27.529999999999998 20.865000000000002 150-151 23.35 28.1375 28.512500000000003 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 1.5 24 1.0 25 4.5 26 6.0 27 7.0 28 11.0 29 12.5 30 14.5 31 19.5 32 30.5 33 38.0 34 46.5 35 62.5 36 74.0 37 96.5 38 117.0 39 139.0 40 177.0 41 201.0 42 227.5 43 242.0 44 249.0 45 266.0 46 268.0 47 251.0 48 227.5 49 208.0 50 185.5 51 156.0 52 125.0 53 104.0 54 99.5 55 85.0 56 60.5 57 49.0 58 41.5 59 33.5 60 20.0 61 11.5 62 9.0 63 6.0 64 2.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.9902087090956 95.075 2 1.4171605256377222 2.75 3 0.36073177016232927 1.05 4 0.12883277505797475 0.5 5 0.07729966503478485 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02576655501159495 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 10 0.25 Illumina Single End PCR Primer 1 (97% over 34bp) GTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGC 5 0.125 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 5 0.125 No Hit GGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.5499999999999998 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.8250000000000002 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.1375 0.0 0.0 0.0 0.0 124-125 2.325 0.0 0.0 0.0 0.0 126-127 2.5875 0.0 0.0 0.0 0.0 128-129 2.75 0.0 0.0 0.0 0.0 130-131 2.925 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.575 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCAAA 10 0.006830828 145.0 6 >>END_MODULE Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725515 spots for SRR7170613.sra Written 725515 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra Read 725509 spots for SRR7170613.sra Written 725509 spots for SRR7170613.sra SRR ids: ['SRR7170613.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4c6bof1y SRR7170613.sra spots: 14510186 blocks: [[1, 725509], [725510, 1451018], [1451019, 2176527], [2176528, 2902036], [2902037, 3627545], [3627546, 4353054], [4353055, 5078563], [5078564, 5804072], [5804073, 6529581], [6529582, 7255090], [7255091, 7980599], [7980600, 8706108], [8706109, 9431617], [9431618, 10157126], [10157127, 10882635], [10882636, 11608144], [11608145, 12333653], [12333654, 13059162], [13059163, 13784671], [13784672, 14510186]] SRR7170613 file size 4895325 SRR7170613 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170613 SRR7170613_1.fastq SRR7170613_2.fastq Input file: SRR7170613_1.fastq Paired file: SRR7170613_2.fastq trimmed: SRR7170613-trimmed-pair1.fastq, SRR7170613-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:07:11 2025 >> started Thu Feb 13 11:07:26 2025 >> done (15.237s) 14510186 read pairs processed; of these: 24503 ( 0.17%) short read pairs filtered out after trimming by size control 51695 ( 0.36%) empty read pairs filtered out after trimming by size control 14433988 (99.47%) read pairs available; of these: 7566543 (52.42%) trimmed read pairs available after processing 6867445 (47.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 9 0.00% 20 10 0.00% 21 5 0.00% 22 10 0.00% 23 16 0.00% 24 15 0.00% 25 13 0.00% 26 15 0.00% 27 14 0.00% 28 16 0.00% 29 17 0.00% 30 11 0.00% 31 14 0.00% 32 9 0.00% 33 14 0.00% 34 18 0.00% 35 15 0.00% 36 20 0.00% 37 25 0.00% 38 24 0.00% 39 18 0.00% 40 32 0.00% 41 23 0.00% 42 38 0.00% 43 39 0.00% 44 32 0.00% 45 55 0.00% 46 52 0.00% 47 63 0.00% 48 72 0.00% 49 69 0.00% 50 79 0.00% 51 110 0.00% 52 98 0.00% 53 100 0.00% 54 125 0.00% 55 132 0.00% 56 125 0.00% 57 129 0.00% 58 188 0.00% 59 188 0.00% 60 239 0.00% 61 260 0.00% 62 297 0.00% 63 345 0.00% 64 363 0.00% 65 431 0.00% 66 398 0.00% 67 456 0.00% 68 467 0.00% 69 560 0.00% 70 697 0.00% 71 738 0.01% 72 927 0.01% 73 978 0.01% 74 1179 0.01% 75 1436 0.01% 76 2010 0.01% 77 2062 0.01% 78 1648 0.01% 79 1866 0.01% 80 2004 0.01% 81 2222 0.02% 82 2649 0.02% 83 2864 0.02% 84 4397 0.03% 85 5082 0.04% 86 5206 0.04% 87 5556 0.04% 88 5579 0.04% 89 5984 0.04% 90 6092 0.04% 91 6570 0.05% 92 6875 0.05% 93 7145 0.05% 94 7563 0.05% 95 8038 0.06% 96 8355 0.06% 97 8557 0.06% 98 8728 0.06% 99 9159 0.06% 100 9775 0.07% 101 10176 0.07% 102 10631 0.07% 103 11473 0.08% 104 11944 0.08% 105 12432 0.09% 106 12803 0.09% 107 13313 0.09% 108 13599 0.09% 109 14301 0.10% 110 14863 0.10% 111 15384 0.11% 112 16056 0.11% 113 16933 0.12% 114 17609 0.12% 115 18208 0.13% 116 18859 0.13% 117 19505 0.14% 118 19672 0.14% 119 20448 0.14% 120 20967 0.15% 121 21380 0.15% 122 22584 0.16% 123 24768 0.17% 124 25527 0.18% 125 26424 0.18% 126 27582 0.19% 127 28608 0.20% 128 30149 0.21% 129 31741 0.22% 130 33083 0.23% 131 34622 0.24% 132 37062 0.26% 133 39502 0.27% 134 42276 0.29% 135 45333 0.31% 136 49214 0.34% 137 53760 0.37% 138 57957 0.40% 139 64321 0.45% 140 71435 0.49% 141 80612 0.56% 142 91319 0.63% 143 106074 0.73% 144 127308 0.88% 145 159557 1.11% 146 203146 1.41% 147 283788 1.97% 148 448678 3.11% 149 912294 6.32% 150 3929436 27.22% 151 6867445 47.58% 14433988 reads passed initial QC criterion=sequence-density sequence-density=1.17 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=21 prefix-density=1.16 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=9.93 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=3.0 sequence=AGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAAT criterion=sequence-density sequence-density=1.39 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=17 prefix-density=1.36 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=20 fanout-score=87.44 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTTGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCTAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGT SRR7170613 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:08:08 Started mapping on | Feb 13 11:08:08 Finished on | Feb 13 11:09:57 Mapping speed, Million of reads per hour | 476.72 Number of input reads | 14433988 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13458130 Uniquely mapped reads % | 93.24% Average mapped length | 294.78 Number of splices: Total | 13516544 Number of splices: Annotated (sjdb) | 13229523 Number of splices: GT/AG | 13243450 Number of splices: GC/AG | 230457 Number of splices: AT/AC | 8107 Number of splices: Non-canonical | 34530 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 371310 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 27100 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.92% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 627609 627609 627609 N_multimapping 371310 371310 371310 N_noFeature 438278 13231748 503519 N_ambiguous 277828 739 116247 UnstrandedReadsAssigned:12742024 PositiveStrandReadsAssigned:225643 NegativeStrandReadsAssigned:12838364 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170613 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170613-trimmed-pair1.fastq SRR7170613-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,433,988 reads, 12,794,782 reads pseudoaligned [quant] estimated average fragment length: 280.652 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR7170613.ke.tsv 34699 SRR7170613.se.tsv 87100 total ==> SRR7170613.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.35 426 15.4807 Potri.005G024800.1.v4.1 1035 755.348 87 7.27593 Potri.004G059700.1.v4.1 961 681.452 17 1.57591 Potri.007G009000.2.v4.1 1416 1136.35 0 0 Potri.003G141000.2.v4.1 2943 2663.35 457.948 10.8619 Potri.016G087400.1.v4.1 270 72.7443 1008 875.343 Potri.015G069301.1.v4.1 564 295.177 0 0 Potri.010G195200.1.v4.1 1773 1493.35 1 0.0423015 Potri.012G127500.1.v4.1 977 697.411 271 24.5469 ==> SRR7170613.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 185 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 375 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 361 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170613 completed mapping pipeline successfully