Starting /dee2/code/volunteer_pipeline.sh SRR7170614 current disk space = 3092648239104 free memory = 1573001780 SRR7170614 SRAfilesize e1c119a0ab33813ec4f6ab949b5d1ccd SRR7170614.sra SRR7170614.sra file validated SRR7170614 is paired end SRR7170614 is conventional basespace SRR7170614 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170614_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.9805 30.0 18.0 32.0 18.0 33.0 2 30.7835 31.0 29.0 33.0 27.0 33.0 3 31.62425 33.0 31.0 33.0 28.0 34.0 4 31.4695 33.0 31.0 33.0 29.0 34.0 5 32.3675 33.0 33.0 33.0 32.0 34.0 6 36.22875 38.0 36.0 38.0 33.0 38.0 7 36.7875 38.0 37.0 38.0 35.0 38.0 8 36.912 38.0 38.0 38.0 35.0 38.0 9 37.11575 38.0 38.0 38.0 36.0 38.0 10-14 37.0889 38.0 38.0 38.0 36.0 38.0 15-19 37.0945 38.0 38.0 38.0 36.0 38.0 20-24 37.01335 38.0 38.0 38.0 36.0 38.0 25-29 37.042899999999996 38.0 38.0 38.0 36.0 38.0 30-34 37.05295 38.0 38.0 38.0 36.0 38.0 35-39 37.1003 38.0 38.0 38.0 36.4 38.0 40-44 36.987649999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.938 38.0 38.0 38.0 36.0 38.0 50-54 36.76745 38.0 38.0 38.0 35.2 38.0 55-59 36.5889 38.0 38.0 38.0 34.8 38.0 60-64 36.6145 38.0 38.0 38.0 34.4 38.0 65-69 36.519349999999996 38.0 38.0 38.0 34.4 38.0 70-74 36.417950000000005 38.0 38.0 38.0 34.0 38.0 75-79 36.115050000000004 38.0 37.6 38.0 33.2 38.0 80-84 35.961850000000005 38.0 37.0 38.0 32.6 38.0 85-89 35.87429999999999 38.0 37.0 38.0 32.6 38.0 90-94 35.5741 38.0 37.0 38.0 30.0 38.0 95-99 35.547250000000005 38.0 36.8 38.0 30.2 38.0 100-104 35.33055 38.0 36.6 38.0 29.0 38.0 105-109 35.17105 38.0 36.0 38.0 28.6 38.0 110-114 35.021699999999996 38.0 36.0 38.0 28.2 38.0 115-119 34.8585 38.0 35.4 38.0 27.6 38.0 120-124 34.5201 38.0 35.0 38.0 25.8 38.0 125-129 34.1318 38.0 34.6 38.0 24.0 38.0 130-134 33.9428 38.0 33.8 38.0 23.2 38.0 135-139 33.1586 38.0 32.8 38.0 17.8 38.0 140-144 32.54395000000001 38.0 32.4 38.0 15.2 38.0 145-149 31.0597 37.4 30.8 38.0 8.2 38.0 150-151 24.7805 32.0 14.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 1.0 5 0.0 6 1.0 7 2.0 8 0.0 9 0.0 10 2.0 11 1.0 12 1.0 13 1.0 14 4.0 15 1.0 16 1.0 17 6.0 18 7.0 19 21.0 20 3.0 21 6.0 22 9.0 23 10.0 24 15.0 25 18.0 26 27.0 27 35.0 28 46.0 29 50.0 30 63.0 31 103.0 32 120.0 33 162.0 34 259.0 35 395.0 36 972.0 37 1648.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.662712738525016 17.973182052604436 15.265600825167613 31.09850438370294 2 17.925 24.925 38.275 18.875 3 14.649999999999999 32.125 30.599999999999998 22.625 4 20.075000000000003 34.775 25.025 20.125 5 18.725 37.45 25.05 18.775 6 16.400000000000002 36.475 25.650000000000002 21.475 7 12.0 20.7 46.225 21.075 8 16.25 22.225 29.599999999999998 31.924999999999997 9 17.175 23.325000000000003 31.324999999999996 28.175 10-14 18.96 31.2 26.105 23.735 15-19 19.275000000000002 29.89 26.945000000000004 23.89 20-24 18.785 30.29 27.01 23.915 25-29 18.634999999999998 30.154999999999998 27.435 23.775 30-34 18.955 30.325000000000003 27.250000000000004 23.47 35-39 19.040000000000003 29.475 27.485 24.0 40-44 19.439999999999998 30.095 26.810000000000002 23.655 45-49 19.585 29.494999999999997 26.740000000000002 24.18 50-54 19.175 29.044999999999998 27.58 24.2 55-59 19.03 29.595 26.85 24.525 60-64 19.605 29.04 27.765 23.59 65-69 19.505 29.805 27.0 23.69 70-74 19.64 29.759999999999998 26.345000000000002 24.255 75-79 19.134999999999998 29.32 27.034999999999997 24.51 80-84 19.64 28.744999999999997 26.705000000000002 24.91 85-89 19.805 28.845 26.974999999999998 24.375 90-94 20.205000000000002 28.74 27.46 23.595 95-99 20.21 29.465000000000003 26.810000000000002 23.515 100-104 20.200000000000003 28.555000000000003 27.26 23.985 105-109 20.555 28.42 26.8 24.224999999999998 110-114 20.135 28.705000000000002 27.229999999999997 23.93 115-119 20.39 28.225 27.255000000000003 24.13 120-124 21.029999999999998 28.33 26.700000000000003 23.94 125-129 20.53 29.005 26.455000000000002 24.01 130-134 20.24 28.49 26.69 24.58 135-139 20.735 27.495000000000005 26.889999999999997 24.88 140-144 20.73 28.055000000000003 26.43 24.785 145-149 20.355 27.884999999999998 27.05 24.709999999999997 150-151 21.9375 27.462500000000002 25.887500000000003 24.712500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 2.0 20 3.0 21 4.0 22 4.0 23 5.5 24 5.5 25 6.5 26 12.0 27 13.0 28 17.5 29 27.5 30 35.0 31 44.5 32 55.0 33 70.5 34 99.5 35 122.0 36 131.5 37 140.0 38 145.0 39 156.5 40 176.5 41 195.0 42 205.5 43 211.5 44 217.5 45 221.0 46 211.0 47 189.5 48 192.5 49 191.0 50 169.5 51 139.5 52 104.5 53 94.0 54 94.0 55 85.0 56 58.5 57 40.0 58 34.5 59 27.5 60 17.5 61 9.5 62 6.5 63 1.5 64 0.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.25 #Duplication Level Percentage of deduplicated Percentage of total 1 97.35064935064935 93.7 2 2.0 3.85 3 0.4675324675324675 1.35 4 0.1038961038961039 0.4 5 0.0 0.0 6 0.025974025974025976 0.15 7 0.025974025974025976 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025974025974025976 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 15 0.375 TruSeq Adapter, Index 8 (97% over 36bp) GTTCGATTCAGCATCCGAATCCAGAAAGCAAAAACAAAGTAGAATATTGA 7 0.17500000000000002 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3625 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.0250000000000004 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.7750000000000004 0.0 0.0 0.0 0.0 120-121 3.0250000000000004 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.7249999999999996 0.0 0.0 0.0 0.0 126-127 4.0375 0.0 0.0 0.0 0.0 128-129 4.362500000000001 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 5.0 0.0 0.0 0.0 0.0 134-135 5.512499999999999 0.0 0.0 0.0 0.0 136-137 5.8875 0.0 0.0 0.0 0.0 138-139 6.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170614 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170614_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5365 33.0 33.0 34.0 32.0 34.0 2 32.63025 33.0 33.0 34.0 32.0 34.0 3 32.6685 33.0 33.0 34.0 32.0 34.0 4 32.55025 33.0 33.0 34.0 32.0 34.0 5 32.57575 33.0 33.0 34.0 32.0 34.0 6 36.8365 38.0 38.0 38.0 35.0 38.0 7 36.8655 38.0 38.0 38.0 36.0 38.0 8 36.84825 38.0 38.0 38.0 36.0 38.0 9 36.82225 38.0 38.0 38.0 36.0 38.0 10-14 36.7755 38.0 38.0 38.0 35.8 38.0 15-19 36.627449999999996 38.0 38.0 38.0 35.4 38.0 20-24 36.646699999999996 38.0 38.0 38.0 35.6 38.0 25-29 36.553650000000005 38.0 38.0 38.0 35.2 38.0 30-34 36.62385 38.0 38.0 38.0 35.6 38.0 35-39 36.4174 38.0 38.0 38.0 34.6 38.0 40-44 36.499 38.0 38.0 38.0 35.0 38.0 45-49 36.37415 38.0 38.0 38.0 34.4 38.0 50-54 36.24455 38.0 38.0 38.0 34.0 38.0 55-59 36.29265 38.0 38.0 38.0 34.4 38.0 60-64 36.175599999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.1705 38.0 38.0 38.0 34.0 38.0 70-74 36.126999999999995 38.0 38.0 38.0 34.0 38.0 75-79 36.07405 38.0 38.0 38.0 33.8 38.0 80-84 35.89829999999999 38.0 38.0 38.0 33.4 38.0 85-89 35.72485 38.0 37.6 38.0 32.2 38.0 90-94 35.56895 38.0 37.0 38.0 31.4 38.0 95-99 35.43645 38.0 37.0 38.0 30.2 38.0 100-104 35.359500000000004 38.0 36.8 38.0 30.2 38.0 105-109 35.1817 38.0 36.8 38.0 28.8 38.0 110-114 34.950599999999994 38.0 36.0 38.0 28.4 38.0 115-119 34.616099999999996 38.0 35.6 38.0 25.8 38.0 120-124 34.31895 38.0 34.8 38.0 24.4 38.0 125-129 33.8693 38.0 33.6 38.0 22.0 38.0 130-134 33.496500000000005 38.0 33.0 38.0 20.0 38.0 135-139 32.89165 38.0 33.0 38.0 15.6 38.0 140-144 32.0692 38.0 32.4 38.0 13.0 38.0 145-149 30.847549999999995 38.0 30.6 38.0 5.8 38.0 150-151 24.784625 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 8.0 4 9.0 5 5.0 6 5.0 7 2.0 8 5.0 9 4.0 10 4.0 11 0.0 12 1.0 13 2.0 14 1.0 15 1.0 16 8.0 17 7.0 18 7.0 19 8.0 20 9.0 21 10.0 22 7.0 23 19.0 24 20.0 25 24.0 26 29.0 27 33.0 28 39.0 29 48.0 30 60.0 31 85.0 32 100.0 33 160.0 34 202.0 35 341.0 36 761.0 37 1958.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.725 18.125 13.925 27.224999999999998 2 25.775 24.099999999999998 32.65 17.474999999999998 3 20.849999999999998 28.549999999999997 31.2 19.400000000000002 4 24.3 35.8 20.75 19.15 5 25.7 37.4 19.35 17.549999999999997 6 19.675 38.175 22.55 19.6 7 18.575 16.325 43.05 22.05 8 22.25 22.45 26.025 29.275000000000002 9 22.6 24.175 26.1 27.125 10-14 23.665 28.63 25.679999999999996 22.025 15-19 24.285 27.825 26.695 21.195 20-24 23.685000000000002 28.24 26.755000000000003 21.32 25-29 23.635 28.389999999999997 27.24 20.735 30-34 23.845 26.845000000000002 27.889999999999997 21.42 35-39 24.79 27.445000000000004 27.18 20.585 40-44 23.880000000000003 27.925 27.125 21.07 45-49 24.135 27.965 26.875 21.025 50-54 24.18 27.315 26.965 21.54 55-59 24.04 27.334999999999997 27.49 21.135 60-64 24.185000000000002 27.139999999999997 27.43 21.245 65-69 24.01 27.445000000000004 27.365000000000002 21.18 70-74 23.810000000000002 27.93 27.279999999999998 20.979999999999997 75-79 24.455 27.034999999999997 27.47 21.04 80-84 23.74 28.01 27.165 21.085 85-89 24.675 27.115000000000002 27.315 20.895 90-94 24.63 27.384999999999998 27.85 20.135 95-99 24.07 27.955000000000002 27.450000000000003 20.525 100-104 24.59 27.229999999999997 27.555000000000003 20.625 105-109 24.26 27.744999999999997 27.565 20.43 110-114 25.019999999999996 27.57 27.534999999999997 19.875 115-119 24.62 27.655 27.839999999999996 19.885 120-124 24.725 27.095000000000002 28.08 20.1 125-129 23.89 28.48 27.47 20.16 130-134 24.795 27.515 27.894999999999996 19.794999999999998 135-139 24.925 27.715 27.755000000000003 19.605 140-144 25.224999999999998 27.71 27.965 19.1 145-149 25.590000000000003 27.389999999999997 27.62 19.400000000000002 150-151 26.1125 28.012500000000003 27.275 18.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 1.5 19 1.5 20 0.0 21 1.5 22 3.0 23 3.0 24 3.0 25 2.5 26 3.0 27 6.0 28 7.0 29 9.5 30 17.0 31 21.5 32 24.5 33 30.0 34 41.0 35 54.5 36 67.0 37 86.0 38 113.5 39 141.5 40 152.5 41 175.5 42 211.5 43 243.5 44 246.5 45 249.0 46 260.0 47 243.0 48 232.5 49 214.0 50 198.0 51 170.5 52 133.5 53 125.5 54 120.5 55 97.0 56 77.5 57 60.5 58 40.5 59 34.0 60 29.0 61 19.5 62 10.5 63 4.5 64 2.0 65 2.0 66 1.5 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.62396694214877 94.5 2 1.9111570247933882 3.6999999999999997 3 0.2582644628099174 0.75 4 0.1291322314049587 0.5 5 0.025826446280991736 0.125 6 0.025826446280991736 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025826446280991736 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 11 0.27499999999999997 Illumina Single End PCR Primer 1 (96% over 32bp) CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 6 0.15 No Hit AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.8375 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.4125 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.075 0.0 0.0 0.0 0.0 128-129 4.4375 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.1 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTGAG 10 0.006830828 145.0 5 GCTGAGT 10 0.006830828 145.0 6 AAATGAG 10 0.006830828 145.0 5 TGGCTGA 10 0.006830828 145.0 4 GTGCTCG 10 0.006830828 145.0 7 AAAATGG 20 3.5877043E-4 108.75 3 >>END_MODULE Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra Read 642222 spots for SRR7170614.sra Written 642222 spots for SRR7170614.sra Read 642215 spots for SRR7170614.sra Written 642215 spots for SRR7170614.sra SRR ids: ['SRR7170614.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9q04o5bv SRR7170614.sra spots: 12844307 blocks: [[1, 642215], [642216, 1284430], [1284431, 1926645], [1926646, 2568860], [2568861, 3211075], [3211076, 3853290], [3853291, 4495505], [4495506, 5137720], [5137721, 5779935], [5779936, 6422150], [6422151, 7064365], [7064366, 7706580], [7706581, 8348795], [8348796, 8991010], [8991011, 9633225], [9633226, 10275440], [10275441, 10917655], [10917656, 11559870], [11559871, 12202085], [12202086, 12844307]] SRR7170614 file size 4330813 SRR7170614 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170614 SRR7170614_1.fastq SRR7170614_2.fastq Input file: SRR7170614_1.fastq Paired file: SRR7170614_2.fastq trimmed: SRR7170614-trimmed-pair1.fastq, SRR7170614-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:12:24 2025 >> started Thu Feb 13 12:12:38 2025 >> done (14.109s) 12844307 read pairs processed; of these: 23368 ( 0.18%) short read pairs filtered out after trimming by size control 98810 ( 0.77%) empty read pairs filtered out after trimming by size control 12722129 (99.05%) read pairs available; of these: 7861361 (61.79%) trimmed read pairs available after processing 4860768 (38.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 9 0.00% 21 8 0.00% 22 8 0.00% 23 12 0.00% 24 20 0.00% 25 18 0.00% 26 13 0.00% 27 19 0.00% 28 17 0.00% 29 16 0.00% 30 17 0.00% 31 15 0.00% 32 20 0.00% 33 28 0.00% 34 21 0.00% 35 19 0.00% 36 17 0.00% 37 36 0.00% 38 32 0.00% 39 33 0.00% 40 46 0.00% 41 37 0.00% 42 42 0.00% 43 48 0.00% 44 52 0.00% 45 70 0.00% 46 87 0.00% 47 97 0.00% 48 98 0.00% 49 94 0.00% 50 129 0.00% 51 123 0.00% 52 170 0.00% 53 149 0.00% 54 190 0.00% 55 188 0.00% 56 225 0.00% 57 232 0.00% 58 247 0.00% 59 258 0.00% 60 303 0.00% 61 374 0.00% 62 369 0.00% 63 428 0.00% 64 461 0.00% 65 485 0.00% 66 517 0.00% 67 584 0.00% 68 630 0.00% 69 712 0.01% 70 783 0.01% 71 944 0.01% 72 1064 0.01% 73 1234 0.01% 74 1459 0.01% 75 1623 0.01% 76 2141 0.02% 77 2391 0.02% 78 2074 0.02% 79 2306 0.02% 80 2271 0.02% 81 2748 0.02% 82 3150 0.02% 83 3720 0.03% 84 5207 0.04% 85 5765 0.05% 86 6092 0.05% 87 6138 0.05% 88 6321 0.05% 89 6485 0.05% 90 7147 0.06% 91 7640 0.06% 92 8118 0.06% 93 8833 0.07% 94 9455 0.07% 95 10129 0.08% 96 10550 0.08% 97 10796 0.08% 98 11073 0.09% 99 11663 0.09% 100 12370 0.10% 101 13058 0.10% 102 14379 0.11% 103 15202 0.12% 104 16209 0.13% 105 17072 0.13% 106 17494 0.14% 107 17737 0.14% 108 18398 0.14% 109 19331 0.15% 110 19703 0.15% 111 20229 0.16% 112 22030 0.17% 113 23876 0.19% 114 24294 0.19% 115 24974 0.20% 116 25591 0.20% 117 26241 0.21% 118 26998 0.21% 119 27716 0.22% 120 28649 0.23% 121 29309 0.23% 122 31275 0.25% 123 33511 0.26% 124 34752 0.27% 125 35618 0.28% 126 37467 0.29% 127 38636 0.30% 128 40627 0.32% 129 42234 0.33% 130 44117 0.35% 131 46222 0.36% 132 49391 0.39% 133 53218 0.42% 134 56568 0.44% 135 61391 0.48% 136 66179 0.52% 137 71703 0.56% 138 77298 0.61% 139 84391 0.66% 140 92432 0.73% 141 104126 0.82% 142 116882 0.92% 143 136119 1.07% 144 159723 1.26% 145 193372 1.52% 146 247907 1.95% 147 331287 2.60% 148 508988 4.00% 149 981148 7.71% 150 3456760 27.17% 151 4860768 38.21% 12722129 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=28 prefix-density=1.37 prefix-fanout=1.0 sequence=TGCACTTGACGCGTGTTGTCGAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=73.68 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=6.0 sequence=TCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGAT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=33 prefix-density=0.59 prefix-fanout=2.2 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=24.69 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.1 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCT SRR7170614 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:13:21 Started mapping on | Feb 13 12:13:21 Finished on | Feb 13 12:15:13 Mapping speed, Million of reads per hour | 408.93 Number of input reads | 12722129 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11584726 Uniquely mapped reads % | 91.06% Average mapped length | 292.21 Number of splices: Total | 10198463 Number of splices: Annotated (sjdb) | 9984679 Number of splices: GT/AG | 9996052 Number of splices: GC/AG | 165471 Number of splices: AT/AC | 12643 Number of splices: Non-canonical | 24297 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307810 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 25353 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.23% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 849139 849139 849139 N_multimapping 307810 307810 307810 N_noFeature 261850 11288915 312462 N_ambiguous 376593 694 131059 UnstrandedReadsAssigned:10946283 PositiveStrandReadsAssigned:295117 NegativeStrandReadsAssigned:11141205 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170614 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170614-trimmed-pair1.fastq SRR7170614-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,722,129 reads, 11,073,116 reads pseudoaligned [quant] estimated average fragment length: 244.467 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7170614.ke.tsv 34699 SRR7170614.se.tsv 87100 total ==> SRR7170614.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.53 205 6.56515 Potri.005G024800.1.v4.1 1035 791.533 258 18.5236 Potri.004G059700.1.v4.1 961 717.558 23 1.82157 Potri.007G009000.2.v4.1 1416 1172.53 1 0.0484674 Potri.003G141000.2.v4.1 2943 2699.53 235 4.94714 Potri.016G087400.1.v4.1 270 78.2989 721 523.305 Potri.015G069301.1.v4.1 564 323.905 0 0 Potri.010G195200.1.v4.1 1773 1529.53 0 0 Potri.012G127500.1.v4.1 977 733.552 116 8.98674 ==> SRR7170614.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 27 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 500 Potri.001G212900.v4.1 23 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 143 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170614 completed mapping pipeline successfully