Starting /dee2/code/volunteer_pipeline.sh SRR7170615 current disk space = 3092430884864 free memory = 1576571364 SRR7170615 SRAfilesize 1d05eb8f6dbcd29461dc70c8590d9872 SRR7170615.sra SRR7170615.sra file validated SRR7170615 is paired end SRR7170615 is conventional basespace SRR7170615 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170615_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.9735 30.0 18.0 32.0 18.0 33.0 2 31.212 33.0 31.0 33.0 27.0 33.0 3 31.86225 33.0 31.0 33.0 29.0 34.0 4 31.79375 33.0 31.0 33.0 29.0 34.0 5 32.5125 33.0 33.0 34.0 32.0 34.0 6 36.31275 38.0 37.0 38.0 34.0 38.0 7 36.9 38.0 38.0 38.0 35.0 38.0 8 37.1005 38.0 38.0 38.0 36.0 38.0 9 37.237 38.0 38.0 38.0 36.0 38.0 10-14 37.1759 38.0 38.0 38.0 36.6 38.0 15-19 37.11735 38.0 38.0 38.0 36.2 38.0 20-24 37.06115 38.0 38.0 38.0 36.2 38.0 25-29 37.09295 38.0 38.0 38.0 36.4 38.0 30-34 37.100049999999996 38.0 38.0 38.0 36.2 38.0 35-39 37.108 38.0 38.0 38.0 36.6 38.0 40-44 37.00815 38.0 38.0 38.0 36.2 38.0 45-49 37.0497 38.0 38.0 38.0 36.2 38.0 50-54 36.8337 38.0 38.0 38.0 35.8 38.0 55-59 36.7358 38.0 38.0 38.0 35.0 38.0 60-64 36.703500000000005 38.0 38.0 38.0 35.0 38.0 65-69 36.641 38.0 38.0 38.0 34.8 38.0 70-74 36.583000000000006 38.0 38.0 38.0 34.4 38.0 75-79 36.393 38.0 38.0 38.0 34.0 38.0 80-84 36.1976 38.0 37.6 38.0 33.6 38.0 85-89 36.1309 38.0 37.6 38.0 33.2 38.0 90-94 35.824799999999996 38.0 37.0 38.0 31.4 38.0 95-99 35.77225 38.0 37.0 38.0 31.6 38.0 100-104 35.60765 38.0 37.0 38.0 31.0 38.0 105-109 35.409 38.0 36.6 38.0 29.8 38.0 110-114 35.363150000000005 38.0 36.2 38.0 29.4 38.0 115-119 35.17725 38.0 36.0 38.0 28.8 38.0 120-124 34.698699999999995 38.0 35.2 38.0 26.8 38.0 125-129 34.36315 38.0 35.0 38.0 24.6 38.0 130-134 34.28525 38.0 34.8 38.0 23.6 38.0 135-139 33.538599999999995 38.0 33.0 38.0 20.8 38.0 140-144 32.86 38.0 33.0 38.0 15.6 38.0 145-149 31.69475 38.0 31.8 38.0 8.4 38.0 150-151 25.451 32.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 2.0 5 3.0 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 3.0 14 1.0 15 3.0 16 2.0 17 5.0 18 4.0 19 11.0 20 3.0 21 6.0 22 6.0 23 12.0 24 14.0 25 19.0 26 26.0 27 30.0 28 39.0 29 52.0 30 66.0 31 85.0 32 111.0 33 159.0 34 214.0 35 393.0 36 870.0 37 1850.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.32032854209446 19.224845995893226 15.015400410677618 28.439425051334705 2 20.424999999999997 24.975 35.275 19.325 3 15.725 32.35 28.349999999999998 23.575 4 19.2 36.725 24.325 19.75 5 18.725 38.925 23.075000000000003 19.275000000000002 6 15.4 37.95 25.3 21.349999999999998 7 13.65 20.625 45.225 20.5 8 16.075 23.474999999999998 28.449999999999996 32.0 9 17.549999999999997 23.35 30.55 28.549999999999997 10-14 18.404999999999998 31.78 26.135 23.68 15-19 18.69 30.159999999999997 27.715 23.435 20-24 18.990000000000002 30.15 28.08 22.78 25-29 18.785 30.709999999999997 27.584999999999997 22.919999999999998 30-34 19.005 30.475 27.284999999999997 23.235 35-39 19.53 29.81 27.22 23.44 40-44 19.650000000000002 30.56 26.685 23.105 45-49 19.645000000000003 29.65 27.355 23.35 50-54 19.275000000000002 29.909999999999997 27.38 23.435 55-59 19.285 30.264999999999997 27.015 23.435 60-64 19.265 29.335 28.04 23.36 65-69 19.009999999999998 29.5 27.875 23.615 70-74 19.925 29.485 27.12 23.47 75-79 19.39 29.654999999999998 27.105 23.849999999999998 80-84 19.900000000000002 29.595 27.02 23.485 85-89 19.439999999999998 29.03 27.894999999999996 23.635 90-94 19.405 29.304999999999996 27.29 24.0 95-99 19.835 28.925 27.650000000000002 23.59 100-104 20.13 29.205 26.88 23.785 105-109 20.53 28.494999999999997 27.955000000000002 23.02 110-114 20.235 28.860000000000003 26.895000000000003 24.01 115-119 20.424999999999997 29.28 26.815 23.48 120-124 20.52 29.080000000000002 27.235 23.165 125-129 20.805 28.505000000000003 26.619999999999997 24.07 130-134 20.555 28.810000000000002 26.415 24.22 135-139 20.43 28.694999999999997 26.87 24.005000000000003 140-144 20.715 28.665000000000003 26.99 23.630000000000003 145-149 20.865000000000002 28.625 26.68 23.830000000000002 150-151 21.075 28.0625 26.5 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 1.0 13 1.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 4.0 24 7.5 25 8.5 26 11.0 27 16.5 28 26.0 29 35.5 30 42.0 31 53.5 32 70.5 33 89.5 34 106.0 35 127.5 36 140.0 37 139.5 38 162.5 39 172.0 40 179.5 41 207.5 42 211.5 43 199.0 44 195.0 45 207.0 46 197.5 47 193.5 48 200.5 49 182.5 50 158.0 51 135.5 52 115.0 53 94.0 54 80.5 55 65.5 56 47.5 57 32.0 58 25.0 59 19.5 60 10.5 61 5.5 62 4.5 63 5.0 64 3.0 65 1.0 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.42038216560509 96.575 2 1.3757961783439492 2.7 3 0.12738853503184713 0.375 4 0.025477707006369425 0.1 5 0.05095541401273885 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 5 0.125 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.925 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.725 0.0 0.0 0.0 0.0 124-125 4.0125 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 4.7 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.5 0.0 0.0 0.0 0.0 134-135 5.7875 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGCAT 10 0.006832588 144.9875 7 TTTTTTT 30 0.0014445208 24.470467 1 >>END_MODULE SRR7170615 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170615_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.629 33.0 33.0 34.0 32.0 34.0 2 32.70225 33.0 33.0 34.0 32.0 34.0 3 32.7045 33.0 33.0 34.0 32.0 34.0 4 32.59975 33.0 33.0 34.0 32.0 34.0 5 32.57475 33.0 33.0 34.0 32.0 34.0 6 36.70375 38.0 38.0 38.0 35.0 38.0 7 36.78575 38.0 38.0 38.0 36.0 38.0 8 36.6835 38.0 38.0 38.0 35.0 38.0 9 36.79375 38.0 38.0 38.0 36.0 38.0 10-14 36.74265 38.0 38.0 38.0 35.6 38.0 15-19 36.68795 38.0 38.0 38.0 35.6 38.0 20-24 36.68785 38.0 38.0 38.0 36.0 38.0 25-29 36.66265 38.0 38.0 38.0 35.8 38.0 30-34 36.68249999999999 38.0 38.0 38.0 35.8 38.0 35-39 36.57645 38.0 38.0 38.0 35.2 38.0 40-44 36.582550000000005 38.0 38.0 38.0 35.4 38.0 45-49 36.40615 38.0 38.0 38.0 34.8 38.0 50-54 36.371950000000005 38.0 38.0 38.0 34.4 38.0 55-59 36.43325 38.0 38.0 38.0 34.8 38.0 60-64 36.2873 38.0 38.0 38.0 34.0 38.0 65-69 36.30145 38.0 38.0 38.0 34.0 38.0 70-74 36.22755 38.0 38.0 38.0 34.0 38.0 75-79 36.1532 38.0 38.0 38.0 34.0 38.0 80-84 36.08295 38.0 38.0 38.0 34.0 38.0 85-89 35.9517 38.0 38.0 38.0 33.4 38.0 90-94 35.72410000000001 38.0 37.4 38.0 32.6 38.0 95-99 35.5888 38.0 37.0 38.0 32.0 38.0 100-104 35.43855 38.0 37.0 38.0 30.6 38.0 105-109 35.27945 38.0 37.0 38.0 30.2 38.0 110-114 35.1552 38.0 36.6 38.0 29.4 38.0 115-119 34.7944 38.0 36.0 38.0 27.6 38.0 120-124 34.622749999999996 38.0 35.6 38.0 26.6 38.0 125-129 34.138999999999996 38.0 34.2 38.0 24.2 38.0 130-134 33.713350000000005 38.0 33.0 38.0 22.2 38.0 135-139 33.153650000000006 38.0 33.0 38.0 16.6 38.0 140-144 32.28235 38.0 32.6 38.0 13.2 38.0 145-149 31.2683 38.0 31.0 38.0 7.8 38.0 150-151 25.711 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 6.0 4 7.0 5 6.0 6 4.0 7 4.0 8 5.0 9 3.0 10 2.0 11 3.0 12 1.0 13 6.0 14 6.0 15 8.0 16 6.0 17 6.0 18 10.0 19 3.0 20 5.0 21 8.0 22 5.0 23 10.0 24 18.0 25 21.0 26 16.0 27 24.0 28 37.0 29 53.0 30 43.0 31 66.0 32 116.0 33 154.0 34 206.0 35 350.0 36 740.0 37 2025.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.95 17.125 14.7 25.224999999999998 2 26.1 22.275 33.6 18.025 3 21.875 25.0 33.125 20.0 4 24.4 34.8 22.125 18.675 5 22.375 38.800000000000004 21.325 17.5 6 20.1 36.35 23.45 20.1 7 18.85 16.950000000000003 41.9 22.3 8 21.349999999999998 22.6 25.525 30.525000000000002 9 22.075 24.9 26.900000000000002 26.125 10-14 23.685000000000002 28.465 26.200000000000003 21.65 15-19 24.095 27.894999999999996 27.195000000000004 20.815 20-24 23.785 28.595 27.02 20.599999999999998 25-29 24.21 28.485 26.71 20.595 30-34 23.98 28.26 27.16 20.599999999999998 35-39 24.445 27.29 27.22 21.044999999999998 40-44 23.515 28.24 27.694999999999997 20.549999999999997 45-49 23.805 27.439999999999998 28.29 20.465 50-54 23.645 27.425 28.51 20.419999999999998 55-59 24.529999999999998 27.41 27.435 20.625 60-64 23.805 27.400000000000002 27.875 20.919999999999998 65-69 24.14 26.895000000000003 28.345 20.62 70-74 23.294999999999998 27.584999999999997 27.87 21.25 75-79 23.080000000000002 27.400000000000002 28.435 21.085 80-84 24.015 27.82 28.044999999999998 20.119999999999997 85-89 23.79 27.91 27.775 20.525 90-94 23.86 27.76 28.095 20.285 95-99 23.41 27.51 28.405 20.674999999999997 100-104 23.885 27.67 28.08 20.365 105-109 23.905 28.325 27.555000000000003 20.215 110-114 23.72 28.265 27.825 20.19 115-119 24.19 28.115000000000002 27.825 19.869999999999997 120-124 24.055 28.595 27.544999999999998 19.805 125-129 24.6 28.305000000000003 27.85 19.245 130-134 24.560000000000002 27.51 28.199999999999996 19.73 135-139 24.82 26.424999999999997 28.785 19.97 140-144 25.085 27.805000000000003 27.805000000000003 19.305 145-149 24.75 27.765 28.349999999999998 19.134999999999998 150-151 24.575 28.275 28.275 18.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.0 22 2.5 23 4.5 24 4.0 25 2.5 26 5.5 27 8.5 28 11.5 29 17.0 30 22.0 31 23.5 32 29.5 33 43.5 34 50.0 35 61.0 36 82.0 37 101.5 38 116.0 39 146.0 40 178.0 41 199.0 42 218.5 43 231.0 44 244.0 45 238.5 46 222.5 47 231.5 48 234.5 49 209.5 50 190.0 51 160.0 52 144.0 53 128.0 54 105.0 55 98.5 56 69.0 57 42.5 58 39.0 59 31.0 60 17.0 61 11.0 62 8.5 63 5.5 64 3.0 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5485103132162 96.75 2 1.2987012987012987 2.55 3 0.07639419404125286 0.22499999999999998 4 0.025464731347084286 0.1 5 0.025464731347084286 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025464731347084286 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 10 0.25 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.4875 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.387499999999999 0.0 0.0 0.0 0.0 128-129 4.6125 0.0 0.0 0.0 0.0 130-131 4.925 0.0 0.0 0.0 0.0 132-133 5.387499999999999 0.0 0.0 0.0 0.0 134-135 5.6625 0.0 0.0 0.0 0.0 136-137 5.9375 0.0 0.0 0.0 0.0 138-139 6.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGCCA 10 0.006830828 145.0 3 CTCAGAT 10 0.006830828 145.0 1 AATTGCC 10 0.006830828 145.0 2 >>END_MODULE Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589263 spots for SRR7170615.sra Written 589263 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra Read 589253 spots for SRR7170615.sra Written 589253 spots for SRR7170615.sra SRR ids: ['SRR7170615.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lvt868l4 SRR7170615.sra spots: 11785070 blocks: [[1, 589253], [589254, 1178506], [1178507, 1767759], [1767760, 2357012], [2357013, 2946265], [2946266, 3535518], [3535519, 4124771], [4124772, 4714024], [4714025, 5303277], [5303278, 5892530], [5892531, 6481783], [6481784, 7071036], [7071037, 7660289], [7660290, 8249542], [8249543, 8838795], [8838796, 9428048], [9428049, 10017301], [10017302, 10606554], [10606555, 11195807], [11195808, 11785070]] SRR7170615 file size 3971873 SRR7170615 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170615 SRR7170615_1.fastq SRR7170615_2.fastq Input file: SRR7170615_1.fastq Paired file: SRR7170615_2.fastq trimmed: SRR7170615-trimmed-pair1.fastq, SRR7170615-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:20:06 2025 >> started Thu Feb 13 12:20:19 2025 >> done (12.750s) 11785070 read pairs processed; of these: 27784 ( 0.24%) short read pairs filtered out after trimming by size control 38857 ( 0.33%) empty read pairs filtered out after trimming by size control 11718429 (99.43%) read pairs available; of these: 7157491 (61.08%) trimmed read pairs available after processing 4560938 (38.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 11 0.00% 20 15 0.00% 21 13 0.00% 22 16 0.00% 23 18 0.00% 24 31 0.00% 25 34 0.00% 26 18 0.00% 27 22 0.00% 28 29 0.00% 29 21 0.00% 30 18 0.00% 31 14 0.00% 32 18 0.00% 33 13 0.00% 34 13 0.00% 35 21 0.00% 36 17 0.00% 37 22 0.00% 38 30 0.00% 39 26 0.00% 40 21 0.00% 41 26 0.00% 42 49 0.00% 43 35 0.00% 44 49 0.00% 45 37 0.00% 46 63 0.00% 47 71 0.00% 48 80 0.00% 49 74 0.00% 50 113 0.00% 51 114 0.00% 52 122 0.00% 53 138 0.00% 54 147 0.00% 55 151 0.00% 56 160 0.00% 57 180 0.00% 58 221 0.00% 59 213 0.00% 60 218 0.00% 61 313 0.00% 62 329 0.00% 63 405 0.00% 64 395 0.00% 65 423 0.00% 66 463 0.00% 67 523 0.00% 68 592 0.01% 69 667 0.01% 70 806 0.01% 71 837 0.01% 72 1113 0.01% 73 1134 0.01% 74 1344 0.01% 75 1428 0.01% 76 1662 0.01% 77 1838 0.02% 78 1886 0.02% 79 2198 0.02% 80 2366 0.02% 81 2806 0.02% 82 3264 0.03% 83 3715 0.03% 84 5499 0.05% 85 6089 0.05% 86 6367 0.05% 87 6331 0.05% 88 6712 0.06% 89 6917 0.06% 90 7251 0.06% 91 7661 0.07% 92 7991 0.07% 93 9019 0.08% 94 9275 0.08% 95 9844 0.08% 96 10440 0.09% 97 10529 0.09% 98 11085 0.09% 99 11663 0.10% 100 12152 0.10% 101 12663 0.11% 102 14057 0.12% 103 14567 0.12% 104 15374 0.13% 105 16208 0.14% 106 16605 0.14% 107 17146 0.15% 108 17641 0.15% 109 18582 0.16% 110 18991 0.16% 111 19471 0.17% 112 20876 0.18% 113 22436 0.19% 114 22452 0.19% 115 23039 0.20% 116 23640 0.20% 117 24529 0.21% 118 25157 0.21% 119 26033 0.22% 120 26844 0.23% 121 27495 0.23% 122 28734 0.25% 123 30630 0.26% 124 31991 0.27% 125 33040 0.28% 126 34601 0.30% 127 35671 0.30% 128 37309 0.32% 129 39010 0.33% 130 41013 0.35% 131 42556 0.36% 132 45291 0.39% 133 48508 0.41% 134 51692 0.44% 135 55390 0.47% 136 60234 0.51% 137 64529 0.55% 138 69720 0.59% 139 76200 0.65% 140 83710 0.71% 141 94336 0.81% 142 105785 0.90% 143 122327 1.04% 144 142073 1.21% 145 170744 1.46% 146 217472 1.86% 147 289561 2.47% 148 443255 3.78% 149 859112 7.33% 150 3201149 27.32% 151 4560938 38.92% 11718429 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=42 prefix-density=0.41 prefix-fanout=1.9 sequence=GTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=291.29 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=15.7 sequence=ATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=30 prefix-density=0.68 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=66.68 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=1.2 sequence=TTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7170615 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:21:04 Started mapping on | Feb 13 12:21:04 Finished on | Feb 13 12:23:45 Mapping speed, Million of reads per hour | 262.03 Number of input reads | 11718429 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10245446 Uniquely mapped reads % | 87.43% Average mapped length | 291.84 Number of splices: Total | 8872165 Number of splices: Annotated (sjdb) | 8673455 Number of splices: GT/AG | 8700647 Number of splices: GC/AG | 136476 Number of splices: AT/AC | 9042 Number of splices: Non-canonical | 26000 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341137 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 42229 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.19% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1154142 1154142 1154142 N_multimapping 341137 341137 341137 N_noFeature 294565 10023264 340778 N_ambiguous 268346 563 92195 UnstrandedReadsAssigned:9682535 PositiveStrandReadsAssigned:221619 NegativeStrandReadsAssigned:9812473 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170615 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170615-trimmed-pair1.fastq SRR7170615-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,718,429 reads, 9,851,241 reads pseudoaligned [quant] estimated average fragment length: 242.043 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR7170615.ke.tsv 34699 SRR7170615.se.tsv 87100 total ==> SRR7170615.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.96 302 11.9829 Potri.005G024800.1.v4.1 1035 793.957 214 19.0041 Potri.004G059700.1.v4.1 961 719.989 20 1.95855 Potri.007G009000.2.v4.1 1416 1174.96 0 0 Potri.003G141000.2.v4.1 2943 2701.96 317 8.27201 Potri.016G087400.1.v4.1 270 80.0345 679 598.167 Potri.015G069301.1.v4.1 564 326.637 0 0 Potri.010G195200.1.v4.1 1773 1531.96 6 0.276144 Potri.012G127500.1.v4.1 977 735.962 778 74.5339 ==> SRR7170615.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 94 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 468 Potri.001G212900.v4.1 141 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 131 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7170615 completed mapping pipeline successfully