Starting /dee2/code/volunteer_pipeline.sh SRR7170616 current disk space = 3092464570368 free memory = 1582807676 SRR7170616 SRAfilesize 958167cbc168297e6b19926d8b454eda SRR7170616.sra SRR7170616.sra file validated SRR7170616 is paired end SRR7170616 is conventional basespace SRR7170616 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170616_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.8405 25.0 18.0 31.0 18.0 33.0 2 30.261 31.0 29.0 33.0 27.0 33.0 3 31.21125 33.0 31.0 33.0 28.0 33.0 4 32.0345 33.0 33.0 33.0 29.0 34.0 5 32.78525 33.0 33.0 34.0 32.0 34.0 6 36.96875 38.0 37.0 38.0 35.0 38.0 7 37.25475 38.0 38.0 38.0 36.0 38.0 8 37.31975 38.0 38.0 38.0 37.0 38.0 9 37.41625 38.0 38.0 38.0 37.0 38.0 10-14 37.38 38.0 38.0 38.0 37.0 38.0 15-19 37.439949999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.530150000000006 38.0 38.0 38.0 37.8 38.0 25-29 37.48225 38.0 38.0 38.0 37.8 38.0 30-34 37.512649999999994 38.0 38.0 38.0 37.8 38.0 35-39 37.51685 38.0 38.0 38.0 38.0 38.0 40-44 37.43595 38.0 38.0 38.0 37.0 38.0 45-49 37.443650000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.26540000000001 38.0 38.0 38.0 36.6 38.0 55-59 37.19445 38.0 38.0 38.0 36.4 38.0 60-64 37.11975 38.0 38.0 38.0 36.0 38.0 65-69 37.1181 38.0 38.0 38.0 36.0 38.0 70-74 37.049400000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.93335 38.0 38.0 38.0 35.6 38.0 80-84 36.940749999999994 38.0 38.0 38.0 35.6 38.0 85-89 36.790749999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.6794 38.0 38.0 38.0 34.4 38.0 95-99 36.49905 38.0 38.0 38.0 34.2 38.0 100-104 36.351150000000004 38.0 37.6 38.0 34.0 38.0 105-109 36.237100000000005 38.0 37.0 38.0 33.6 38.0 110-114 36.044200000000004 38.0 37.0 38.0 33.0 38.0 115-119 35.754900000000006 38.0 37.0 38.0 31.0 38.0 120-124 35.49275 38.0 36.2 38.0 30.2 38.0 125-129 35.36295 38.0 36.0 38.0 29.6 38.0 130-134 35.09085 38.0 35.6 38.0 28.2 38.0 135-139 34.7417 38.0 34.8 38.0 27.6 38.0 140-144 34.325399999999995 38.0 34.6 38.0 25.4 38.0 145-149 33.45605 38.0 33.0 38.0 22.0 38.0 150-151 29.052625 34.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 1.0 16 2.0 17 2.0 18 2.0 19 0.0 20 5.0 21 2.0 22 4.0 23 9.0 24 9.0 25 4.0 26 9.0 27 18.0 28 25.0 29 20.0 30 36.0 31 53.0 32 93.0 33 119.0 34 188.0 35 345.0 36 873.0 37 2175.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.63042368555385 18.657478305257786 12.863705972434916 32.848392036753445 2 19.15 26.950000000000003 37.7 16.2 3 17.125 31.125000000000004 27.224999999999998 24.525 4 19.725 37.475 24.349999999999998 18.45 5 20.99198396793587 35.47094188376754 24.899799599198396 18.637274549098194 6 14.799999999999999 37.125 25.074999999999996 23.0 7 12.425 19.375 47.3 20.9 8 18.3 19.675 28.275 33.75 9 17.599999999999998 21.075 30.7 30.625000000000004 10-14 19.215 29.845 26.76 24.18 15-19 19.615 28.82 27.605 23.96 20-24 19.035 29.095 27.800000000000004 24.07 25-29 19.27 28.994999999999997 27.894999999999996 23.84 30-34 19.225 29.225 27.625 23.925 35-39 19.830000000000002 29.075 28.005000000000003 23.09 40-44 19.195 28.83 28.305000000000003 23.669999999999998 45-49 19.35 29.365000000000002 27.51 23.775 50-54 20.075000000000003 27.950000000000003 28.410000000000004 23.565 55-59 19.650000000000002 28.345 28.544999999999998 23.46 60-64 19.73 29.065 27.685 23.52 65-69 19.835 28.52 27.744999999999997 23.9 70-74 20.61 28.965000000000003 27.395000000000003 23.03 75-79 19.755 29.4 27.485 23.36 80-84 19.759999999999998 29.044999999999998 27.515 23.68 85-89 19.935 28.749999999999996 27.675 23.64 90-94 20.369999999999997 28.84 27.49 23.3 95-99 20.080000000000002 28.384999999999998 28.04 23.494999999999997 100-104 19.945 28.455000000000002 27.91 23.69 105-109 20.27 29.315 27.41 23.005 110-114 20.135 27.825 28.365000000000002 23.674999999999997 115-119 19.794999999999998 28.9 27.975 23.330000000000002 120-124 20.02 28.43 27.555000000000003 23.995 125-129 20.13 28.915000000000003 27.66 23.294999999999998 130-134 19.8 28.720000000000002 27.800000000000004 23.68 135-139 20.21 28.035 28.01 23.745 140-144 20.4 28.16 27.51 23.93 145-149 20.424999999999997 28.345 27.51 23.72 150-151 19.832437163936476 29.28598224334125 27.58534450418907 23.296236088533202 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 1.5 20 2.0 21 1.0 22 2.0 23 3.5 24 5.5 25 6.5 26 6.5 27 8.0 28 10.5 29 14.5 30 22.5 31 33.0 32 43.5 33 53.0 34 58.5 35 67.0 36 101.0 37 122.0 38 139.0 39 176.5 40 215.0 41 242.5 42 251.5 43 253.5 44 267.5 45 280.0 46 250.5 47 236.0 48 225.0 49 197.0 50 167.0 51 131.0 52 103.5 53 77.5 54 62.0 55 46.0 56 35.5 57 26.0 58 14.5 59 11.0 60 9.5 61 8.5 62 3.5 63 1.5 64 1.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.0875 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 2.875 0.0 0.0 0.0 0.0 132-133 3.2625 0.0 0.0 0.0 0.0 134-135 3.5999999999999996 0.0 0.0 0.0 0.0 136-137 3.8125 0.0 0.0 0.0 0.0 138-139 4.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCAAC 10 0.0063364306 148.64102 1 GCCACAC 10 0.0063364306 148.64102 1 ACACCTG 10 0.006585701 146.75949 4 CAGAGCA 10 0.006585701 146.75949 4 AGAGCAA 10 0.006585701 146.75949 5 CCACACC 10 0.006585701 146.75949 2 CCTGCAT 10 0.006841402 144.925 7 ACCTGCA 10 0.006841402 144.925 6 GAGCAAC 10 0.006841402 144.925 6 GGAAGAT 20 0.005950134 28.985 45-49 >>END_MODULE SRR7170616 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170616_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9155 33.0 33.0 34.0 32.0 34.0 2 32.9895 33.0 33.0 34.0 32.0 34.0 3 32.99975 34.0 33.0 34.0 32.0 34.0 4 32.966 34.0 33.0 34.0 32.0 34.0 5 32.952 34.0 33.0 34.0 32.0 34.0 6 37.13525 38.0 38.0 38.0 37.0 38.0 7 37.25 38.0 38.0 38.0 37.0 38.0 8 37.27425 38.0 38.0 38.0 37.0 38.0 9 37.25225 38.0 38.0 38.0 37.0 38.0 10-14 37.273799999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.21595 38.0 38.0 38.0 37.0 38.0 20-24 37.184000000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.13605 38.0 38.0 38.0 37.0 38.0 30-34 37.10475 38.0 38.0 38.0 37.0 38.0 35-39 37.12885 38.0 38.0 38.0 37.0 38.0 40-44 37.125350000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.1058 38.0 38.0 38.0 37.0 38.0 50-54 36.99 38.0 38.0 38.0 36.6 38.0 55-59 36.92205 38.0 38.0 38.0 36.0 38.0 60-64 36.8925 38.0 38.0 38.0 36.0 38.0 65-69 36.92635 38.0 38.0 38.0 36.2 38.0 70-74 36.84505 38.0 38.0 38.0 36.0 38.0 75-79 36.78635 38.0 38.0 38.0 36.0 38.0 80-84 36.6876 38.0 38.0 38.0 35.6 38.0 85-89 36.66755 38.0 38.0 38.0 35.6 38.0 90-94 36.57955 38.0 38.0 38.0 35.0 38.0 95-99 36.46455 38.0 38.0 38.0 34.6 38.0 100-104 36.347300000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.2882 38.0 38.0 38.0 34.0 38.0 110-114 36.05650000000001 38.0 37.8 38.0 33.6 38.0 115-119 35.81445000000001 38.0 37.2 38.0 32.8 38.0 120-124 35.8555 38.0 37.0 38.0 33.0 38.0 125-129 35.48844999999999 38.0 36.4 38.0 31.0 38.0 130-134 35.06415 38.0 36.0 38.0 29.4 38.0 135-139 34.76225 38.0 35.6 38.0 28.4 38.0 140-144 34.3737 38.0 34.8 38.0 27.4 38.0 145-149 33.44455 38.0 33.2 38.0 20.8 38.0 150-151 28.243000000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 2.0 5 1.0 6 1.0 7 1.0 8 2.0 9 2.0 10 5.0 11 3.0 12 2.0 13 3.0 14 2.0 15 1.0 16 6.0 17 1.0 18 6.0 19 2.0 20 3.0 21 5.0 22 6.0 23 8.0 24 6.0 25 8.0 26 16.0 27 18.0 28 23.0 29 26.0 30 50.0 31 44.0 32 46.0 33 101.0 34 153.0 35 234.0 36 595.0 37 2605.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.675 15.775 15.125 30.425 2 23.150000000000002 24.349999999999998 35.725 16.775000000000002 3 18.6 27.250000000000004 32.425 21.725 4 22.95 36.25 21.5 19.3 5 22.2 36.875 22.575 18.35 6 17.75 38.025 24.975 19.25 7 15.85 16.625 45.975 21.55 8 19.675 20.974999999999998 29.875 29.475 9 20.849999999999998 24.224999999999998 28.825 26.1 10-14 22.425 28.53 27.42 21.625 15-19 22.14 28.715000000000003 27.83 21.315 20-24 22.36 29.025000000000002 27.950000000000003 20.665 25-29 22.41 28.365000000000002 28.58 20.645 30-34 22.325 28.435 28.494999999999997 20.745 35-39 22.725 28.03 28.205000000000002 21.04 40-44 22.95 28.115000000000002 28.499999999999996 20.435 45-49 22.85 27.445000000000004 28.33 21.375 50-54 23.41 27.860000000000003 27.97 20.76 55-59 23.21 27.315 28.105000000000004 21.37 60-64 22.53 28.09 28.48 20.9 65-69 22.73 28.43 27.93 20.91 70-74 23.185 28.18 27.975 20.66 75-79 23.265 27.825 28.53 20.380000000000003 80-84 22.655 27.93 28.21 21.205 85-89 23.275000000000002 28.345 28.055000000000003 20.325 90-94 23.380000000000003 28.294999999999998 28.125 20.200000000000003 95-99 23.599999999999998 27.950000000000003 28.110000000000003 20.34 100-104 23.625 28.26 27.99 20.125 105-109 23.799999999999997 28.060000000000002 27.700000000000003 20.44 110-114 22.82 28.299999999999997 27.79 21.09 115-119 23.77 28.249999999999996 27.584999999999997 20.395 120-124 23.435 28.025 28.07 20.47 125-129 23.68 28.299999999999997 27.79 20.23 130-134 23.974999999999998 28.27 27.6 20.155 135-139 23.87 28.38 28.12 19.63 140-144 24.07 28.28 27.325 20.325 145-149 24.075 27.865000000000002 27.939999999999998 20.119999999999997 150-151 24.928116014501814 27.065883235404424 28.653581697712216 19.35241905238155 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 1.0 22 3.0 23 5.0 24 4.5 25 5.0 26 7.5 27 9.0 28 12.0 29 11.0 30 14.0 31 23.5 32 32.0 33 47.5 34 61.0 35 66.5 36 86.0 37 119.0 38 147.5 39 176.0 40 193.5 41 214.5 42 244.0 43 260.0 44 269.5 45 268.5 46 266.5 47 258.5 48 231.0 49 191.5 50 161.0 51 137.0 52 107.5 53 76.5 54 68.0 55 65.5 56 43.0 57 31.0 58 21.5 59 15.5 60 14.0 61 7.5 62 4.5 63 3.0 64 2.5 65 2.0 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37027707808565 98.625 2 0.5541561712846348 1.0999999999999999 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.5499999999999998 0.0 0.0 0.0 0.0 118-119 1.7374999999999998 0.0 0.0 0.0 0.0 120-121 1.8875 0.0 0.0 0.0 0.0 122-123 2.0375 0.0 0.0 0.0 0.0 124-125 2.2875 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.6125 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.2125000000000004 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.75 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCTTT 10 0.006830828 145.0 7 >>END_MODULE Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863285 spots for SRR7170616.sra Written 863285 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra Read 863269 spots for SRR7170616.sra Written 863269 spots for SRR7170616.sra SRR ids: ['SRR7170616.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lw2dojg1 SRR7170616.sra spots: 17265396 blocks: [[1, 863269], [863270, 1726538], [1726539, 2589807], [2589808, 3453076], [3453077, 4316345], [4316346, 5179614], [5179615, 6042883], [6042884, 6906152], [6906153, 7769421], [7769422, 8632690], [8632691, 9495959], [9495960, 10359228], [10359229, 11222497], [11222498, 12085766], [12085767, 12949035], [12949036, 13812304], [13812305, 14675573], [14675574, 15538842], [15538843, 16402111], [16402112, 17265396]] SRR7170616 file size 5828975 SRR7170616 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170616 SRR7170616_1.fastq SRR7170616_2.fastq Input file: SRR7170616_1.fastq Paired file: SRR7170616_2.fastq trimmed: SRR7170616-trimmed-pair1.fastq, SRR7170616-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:19:28 2025 >> started Thu Feb 13 12:19:47 2025 >> done (19.020s) 17265396 read pairs processed; of these: 12805 ( 0.07%) short read pairs filtered out after trimming by size control 13591 ( 0.08%) empty read pairs filtered out after trimming by size control 17239000 (99.85%) read pairs available; of these: 8442284 (48.97%) trimmed read pairs available after processing 8796716 (51.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 9 0.00% 20 6 0.00% 21 6 0.00% 22 11 0.00% 23 12 0.00% 24 7 0.00% 25 12 0.00% 26 6 0.00% 27 6 0.00% 28 8 0.00% 29 8 0.00% 30 11 0.00% 31 14 0.00% 32 10 0.00% 33 13 0.00% 34 7 0.00% 35 14 0.00% 36 13 0.00% 37 19 0.00% 38 15 0.00% 39 17 0.00% 40 23 0.00% 41 28 0.00% 42 29 0.00% 43 33 0.00% 44 24 0.00% 45 28 0.00% 46 29 0.00% 47 46 0.00% 48 44 0.00% 49 46 0.00% 50 58 0.00% 51 64 0.00% 52 57 0.00% 53 103 0.00% 54 78 0.00% 55 92 0.00% 56 114 0.00% 57 107 0.00% 58 133 0.00% 59 154 0.00% 60 185 0.00% 61 179 0.00% 62 198 0.00% 63 246 0.00% 64 263 0.00% 65 291 0.00% 66 284 0.00% 67 316 0.00% 68 401 0.00% 69 434 0.00% 70 548 0.00% 71 563 0.00% 72 654 0.00% 73 747 0.00% 74 803 0.00% 75 878 0.01% 76 1159 0.01% 77 1328 0.01% 78 1278 0.01% 79 1304 0.01% 80 1436 0.01% 81 1707 0.01% 82 2054 0.01% 83 2307 0.01% 84 3084 0.02% 85 3724 0.02% 86 3861 0.02% 87 4169 0.02% 88 4262 0.02% 89 4592 0.03% 90 4952 0.03% 91 5306 0.03% 92 5656 0.03% 93 6294 0.04% 94 6672 0.04% 95 6975 0.04% 96 7339 0.04% 97 7554 0.04% 98 8025 0.05% 99 8488 0.05% 100 9004 0.05% 101 9465 0.05% 102 10083 0.06% 103 10882 0.06% 104 11484 0.07% 105 12151 0.07% 106 12920 0.07% 107 13051 0.08% 108 13221 0.08% 109 14158 0.08% 110 14711 0.09% 111 15488 0.09% 112 16152 0.09% 113 17283 0.10% 114 17867 0.10% 115 18784 0.11% 116 19251 0.11% 117 19897 0.12% 118 20610 0.12% 119 21312 0.12% 120 22192 0.13% 121 23052 0.13% 122 23990 0.14% 123 25495 0.15% 124 26614 0.15% 125 27730 0.16% 126 29188 0.17% 127 29995 0.17% 128 31124 0.18% 129 32617 0.19% 130 34073 0.20% 131 36040 0.21% 132 38298 0.22% 133 40572 0.24% 134 43770 0.25% 135 46669 0.27% 136 50991 0.30% 137 54959 0.32% 138 59406 0.34% 139 65830 0.38% 140 73421 0.43% 141 82024 0.48% 142 94770 0.55% 143 112198 0.65% 144 134663 0.78% 145 165858 0.96% 146 214739 1.25% 147 302094 1.75% 148 479840 2.78% 149 984037 5.71% 150 4646213 26.95% 151 8796716 51.03% 17239000 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=14 prefix-density=0.43 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=42.33 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=11.3 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=9 prefix-density=0.52 prefix-fanout=2.5 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=15.44 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=CAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7170616 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:20:34 Started mapping on | Feb 13 12:20:34 Finished on | Feb 13 12:22:26 Mapping speed, Million of reads per hour | 554.11 Number of input reads | 17239000 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16242442 Uniquely mapped reads % | 94.22% Average mapped length | 295.64 Number of splices: Total | 16232671 Number of splices: Annotated (sjdb) | 15857383 Number of splices: GT/AG | 15929431 Number of splices: GC/AG | 244172 Number of splices: AT/AC | 9348 Number of splices: Non-canonical | 49720 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438208 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 37857 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 572284 572284 572284 N_multimapping 438208 438208 438208 N_noFeature 681897 15979687 774949 N_ambiguous 286036 1357 115539 UnstrandedReadsAssigned:15274509 PositiveStrandReadsAssigned:261398 NegativeStrandReadsAssigned:15351954 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170616 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170616-trimmed-pair1.fastq SRR7170616-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,239,000 reads, 15,217,664 reads pseudoaligned [quant] estimated average fragment length: 285.886 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR7170616.ke.tsv 34699 SRR7170616.se.tsv 87100 total ==> SRR7170616.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.11 677 24.4966 Potri.005G024800.1.v4.1 1035 750.114 285 23.8266 Potri.004G059700.1.v4.1 961 676.254 27 2.50379 Potri.007G009000.2.v4.1 1416 1131.11 0 0 Potri.003G141000.2.v4.1 2943 2658.11 1236.46 29.171 Potri.016G087400.1.v4.1 270 70.9791 744 657.336 Potri.015G069301.1.v4.1 564 291.96 0 0 Potri.010G195200.1.v4.1 1773 1488.11 65 2.73919 Potri.012G127500.1.v4.1 977 692.199 78 7.06656 ==> SRR7170616.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1385 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 3 SRR7170616 completed mapping pipeline successfully