Starting /dee2/code/volunteer_pipeline.sh SRR7170617 current disk space = 2818727919616 free memory = 1457160812 SRR7170617 SRAfilesize d07cbd221446623df467a7c57ec29b53 SRR7170617.sra SRR7170617.sra file validated SRR7170617 is paired end SRR7170617 is conventional basespace SRR7170617 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170617_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.43475 28.0 18.0 32.0 18.0 33.0 2 31.5495 33.0 31.0 33.0 29.0 33.0 3 32.384 33.0 33.0 33.0 31.0 34.0 4 32.32225 33.0 33.0 33.0 31.0 34.0 5 32.73975 33.0 33.0 34.0 32.0 34.0 6 36.6015 38.0 37.0 38.0 34.0 38.0 7 36.84175 38.0 38.0 38.0 35.0 38.0 8 37.2455 38.0 38.0 38.0 36.0 38.0 9 37.31875 38.0 38.0 38.0 37.0 38.0 10-14 37.40135 38.0 38.0 38.0 37.0 38.0 15-19 37.4989 38.0 38.0 38.0 37.2 38.0 20-24 37.53745 38.0 38.0 38.0 38.0 38.0 25-29 37.52755 38.0 38.0 38.0 38.0 38.0 30-34 37.4982 38.0 38.0 38.0 37.8 38.0 35-39 37.4952 38.0 38.0 38.0 38.0 38.0 40-44 37.426249999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.423 38.0 38.0 38.0 37.0 38.0 50-54 37.30115 38.0 38.0 38.0 37.0 38.0 55-59 37.278200000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.25645 38.0 38.0 38.0 36.8 38.0 65-69 37.223800000000004 38.0 38.0 38.0 36.6 38.0 70-74 37.10425 38.0 38.0 38.0 36.0 38.0 75-79 36.70385 38.0 38.0 38.0 35.8 38.0 80-84 36.5309 38.0 38.0 38.0 35.2 38.0 85-89 36.505050000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.37839999999999 38.0 38.0 38.0 34.6 38.0 95-99 36.17075 38.0 38.0 38.0 34.0 38.0 100-104 36.068650000000005 38.0 38.0 38.0 34.0 38.0 105-109 35.984249999999996 38.0 38.0 38.0 33.6 38.0 110-114 35.861999999999995 38.0 37.4 38.0 33.0 38.0 115-119 35.63645 38.0 37.0 38.0 32.0 38.0 120-124 35.469350000000006 38.0 36.8 38.0 31.0 38.0 125-129 35.3711 38.0 36.2 38.0 31.0 38.0 130-134 35.1613 38.0 36.0 38.0 29.2 38.0 135-139 34.88405 38.0 36.0 38.0 28.2 38.0 140-144 34.31165 38.0 34.2 38.0 26.2 38.0 145-149 33.73465 38.0 33.4 38.0 23.6 38.0 150-151 29.95625 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 2.0 14 2.0 15 0.0 16 2.0 17 4.0 18 8.0 19 41.0 20 5.0 21 4.0 22 4.0 23 6.0 24 9.0 25 8.0 26 13.0 27 12.0 28 26.0 29 23.0 30 31.0 31 34.0 32 74.0 33 90.0 34 154.0 35 266.0 36 738.0 37 2442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.15189873417721 16.17721518987342 15.746835443037973 31.924050632911396 2 19.525000000000002 25.724999999999998 36.675000000000004 18.075 3 16.475 31.3 29.15 23.075000000000003 4 20.375 36.4 22.75 20.474999999999998 5 20.782150915016295 36.95161694660316 23.940837302582104 18.325394835798445 6 17.7 35.199999999999996 26.05 21.05 7 12.8 20.474999999999998 46.475 20.25 8 16.8 22.575 28.7 31.924999999999997 9 17.25 23.7 31.25 27.800000000000004 10-14 18.360000000000003 31.435000000000002 26.0 24.205 15-19 18.435000000000002 29.875 27.82 23.87 20-24 19.375 30.305 27.35 22.97 25-29 18.65 29.87 27.54 23.94 30-34 18.88 29.64 27.515 23.965 35-39 18.77 29.865000000000002 27.644999999999996 23.72 40-44 19.61 29.575000000000003 27.515 23.3 45-49 19.035 30.11 27.36 23.494999999999997 50-54 19.509999999999998 29.01 27.425 24.055 55-59 19.355 28.955 27.905 23.785 60-64 19.105 29.57 27.675 23.65 65-69 19.52 29.785 27.224999999999998 23.47 70-74 19.07 30.159999999999997 27.089999999999996 23.68 75-79 19.445 30.485 26.91 23.16 80-84 19.21 29.755 27.1 23.935000000000002 85-89 19.73 29.415000000000003 27.255000000000003 23.599999999999998 90-94 19.905 29.285 27.22 23.59 95-99 19.75 29.195 27.625 23.43 100-104 20.005 29.110000000000003 26.965 23.919999999999998 105-109 20.035 28.925 26.995 24.044999999999998 110-114 20.080000000000002 28.035 27.32 24.565 115-119 19.744999999999997 28.84 27.305 24.11 120-124 20.345 28.235 26.63 24.79 125-129 20.13 28.935 27.245 23.69 130-134 20.525 28.165000000000003 26.66 24.65 135-139 20.78 27.800000000000004 27.21 24.21 140-144 20.175 28.17 27.01 24.645 145-149 19.835 27.965 27.060000000000002 25.14 150-151 20.517953209057925 28.312273239084202 26.310521706493184 24.859251845364692 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 2.0 20 2.0 21 2.0 22 4.0 23 3.0 24 4.0 25 7.5 26 12.0 27 16.0 28 18.5 29 27.0 30 43.0 31 59.5 32 70.5 33 73.0 34 94.5 35 119.0 36 127.0 37 138.0 38 149.0 39 179.0 40 190.5 41 197.0 42 208.0 43 218.5 44 233.5 45 231.0 46 222.0 47 192.0 48 178.0 49 168.5 50 141.5 51 126.5 52 113.0 53 97.0 54 84.5 55 68.0 56 49.0 57 36.0 58 28.5 59 22.0 60 12.0 61 9.5 62 10.0 63 4.5 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.325 #Duplication Level Percentage of deduplicated Percentage of total 1 97.89774201920581 94.3 2 1.7648585517778352 3.4000000000000004 3 0.23358422008824295 0.675 4 0.05190760446405398 0.2 5 0.0 0.0 6 0.02595380223202699 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02595380223202699 1.275 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 51 1.275 TruSeq Adapter, Index 2 (97% over 37bp) GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.425 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.475 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 2.9625 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.7125 0.0 0.0 0.0 0.0 122-123 3.925 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 5.1125 0.0 0.0 0.0 0.0 130-131 5.449999999999999 0.0 0.0 0.0 0.0 132-133 5.825 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.4625 0.0 0.0 0.0 0.0 138-139 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATACAC 10 0.006841402 144.925 7 ATATACA 10 0.006841402 144.925 6 AAAAAAA 100 7.9798733E-4 11.594001 65-69 >>END_MODULE SRR7170617 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170617_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87275 33.0 33.0 34.0 32.0 34.0 2 33.00225 33.0 33.0 34.0 32.0 34.0 3 33.05225 34.0 33.0 34.0 32.0 34.0 4 32.92825 34.0 33.0 34.0 32.0 34.0 5 32.931 34.0 33.0 34.0 32.0 34.0 6 37.10425 38.0 38.0 38.0 37.0 38.0 7 37.048 38.0 38.0 38.0 37.0 38.0 8 37.063 38.0 38.0 38.0 37.0 38.0 9 37.11625 38.0 38.0 38.0 37.0 38.0 10-14 37.12055 38.0 38.0 38.0 37.0 38.0 15-19 37.091499999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.097 38.0 38.0 38.0 37.0 38.0 25-29 37.0833 38.0 38.0 38.0 37.0 38.0 30-34 37.046 38.0 38.0 38.0 36.8 38.0 35-39 37.09660000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.075199999999995 38.0 38.0 38.0 37.0 38.0 45-49 36.9481 38.0 38.0 38.0 36.6 38.0 50-54 36.8814 38.0 38.0 38.0 36.2 38.0 55-59 36.83505 38.0 38.0 38.0 36.2 38.0 60-64 36.739549999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.783550000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.803250000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.69185 38.0 38.0 38.0 36.0 38.0 80-84 36.3152 38.0 38.0 38.0 35.4 38.0 85-89 36.206599999999995 38.0 38.0 38.0 35.2 38.0 90-94 36.057 38.0 38.0 38.0 34.4 38.0 95-99 36.0428 38.0 38.0 38.0 34.4 38.0 100-104 35.84325 38.0 38.0 38.0 34.0 38.0 105-109 35.73655 38.0 38.0 38.0 33.8 38.0 110-114 35.5943 38.0 38.0 38.0 33.2 38.0 115-119 35.5013 38.0 37.6 38.0 33.0 38.0 120-124 35.37275 38.0 37.0 38.0 31.8 38.0 125-129 35.0349 38.0 36.4 38.0 30.6 38.0 130-134 34.6079 38.0 36.0 38.0 28.0 38.0 135-139 34.364799999999995 38.0 36.0 38.0 26.6 38.0 140-144 33.965500000000006 38.0 34.8 38.0 24.0 38.0 145-149 33.16675 38.0 33.0 38.0 17.2 38.0 150-151 28.257875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 7.0 4 6.0 5 1.0 6 1.0 7 1.0 8 3.0 9 2.0 10 3.0 11 2.0 12 4.0 13 4.0 14 6.0 15 5.0 16 8.0 17 17.0 18 11.0 19 21.0 20 13.0 21 3.0 22 3.0 23 10.0 24 10.0 25 5.0 26 9.0 27 11.0 28 22.0 29 27.0 30 30.0 31 39.0 32 62.0 33 81.0 34 143.0 35 212.0 36 539.0 37 2667.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.3 15.575 15.425 27.700000000000003 2 25.174999999999997 23.0 34.175 17.65 3 20.849999999999998 26.1 31.674999999999997 21.375 4 24.125 35.475 21.2 19.2 5 25.825 37.675 19.375 17.125 6 20.474999999999998 36.65 23.05 19.825 7 18.65 17.7 43.35 20.3 8 22.15 22.0 26.200000000000003 29.65 9 23.474999999999998 23.799999999999997 28.575 24.15 10-14 23.974999999999998 28.875 26.255 20.895 15-19 24.154999999999998 27.250000000000004 28.084999999999997 20.51 20-24 24.325 28.665000000000003 26.810000000000002 20.200000000000003 25-29 24.505 28.499999999999996 26.75 20.244999999999997 30-34 23.65 27.834999999999997 28.050000000000004 20.465 35-39 24.455 27.735 27.165 20.645 40-44 24.07 28.18 27.375 20.375 45-49 23.715 27.98 27.765 20.54 50-54 24.08 27.975 27.439999999999998 20.505000000000003 55-59 24.415 26.924999999999997 27.500000000000004 21.16 60-64 24.235 27.334999999999997 27.689999999999998 20.74 65-69 23.61 27.88 28.105000000000004 20.405 70-74 24.03 28.51 26.83 20.630000000000003 75-79 23.64 28.660000000000004 27.63 20.07 80-84 24.125 28.52 27.384999999999998 19.97 85-89 24.325 28.044999999999998 27.544999999999998 20.085 90-94 23.525 28.470000000000002 27.750000000000004 20.255000000000003 95-99 24.099999999999998 27.98 27.96 19.96 100-104 24.68 28.599999999999998 26.86 19.86 105-109 24.47 27.389999999999997 27.884999999999998 20.255000000000003 110-114 23.799999999999997 28.915000000000003 27.515 19.77 115-119 24.52 28.605000000000004 27.965 18.91 120-124 24.315 28.544999999999998 27.405 19.735 125-129 24.945 28.660000000000004 27.05 19.345000000000002 130-134 24.905 27.52 27.839999999999996 19.735 135-139 24.995 28.1 27.744999999999997 19.16 140-144 24.925 28.115000000000002 27.625 19.335 145-149 25.314999999999998 27.985 27.915 18.785 150-151 25.618904726181547 27.84446111527882 28.182045511377847 18.35458864716179 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 4.0 24 4.5 25 3.5 26 7.5 27 9.5 28 14.5 29 20.5 30 24.5 31 23.5 32 28.0 33 40.0 34 56.5 35 70.5 36 77.5 37 99.5 38 130.0 39 148.0 40 163.5 41 183.5 42 223.0 43 251.0 44 238.0 45 242.0 46 253.5 47 230.5 48 203.5 49 200.5 50 181.5 51 147.5 52 133.0 53 122.5 54 105.5 55 97.5 56 81.0 57 49.5 58 31.0 59 24.5 60 19.5 61 16.5 62 16.5 63 9.5 64 1.5 65 2.0 66 1.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.15966822187661 94.675 2 1.4515292897874545 2.8000000000000003 3 0.23328149300155523 0.675 4 0.02592016588906169 0.1 5 0.07776049766718507 0.375 6 0.02592016588906169 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02592016588906169 1.225 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 49 1.225 Illumina Single End PCR Primer 1 (96% over 32bp) GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 6 0.15 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 5 0.125 No Hit CGGCGAGCGAACGGGGAGCAGCCCAGAGCCTGAATCAGTGTGTGTGTTAG 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7625 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 2.9625 0.0 0.0 0.0 0.0 118-119 3.4375 0.0 0.0 0.0 0.0 120-121 3.725 0.0 0.0 0.0 0.0 122-123 3.9375 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.699999999999999 0.0 0.0 0.0 0.0 128-129 5.1375 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 5.8625 0.0 0.0 0.0 0.0 134-135 6.237500000000001 0.0 0.0 0.0 0.0 136-137 6.475 0.0 0.0 0.0 0.0 138-139 6.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACTGC 10 0.006830828 145.0 8 CATTAAT 10 0.006830828 145.0 145 AAAAAAA 120 2.133589E-5 12.083334 70-74 >>END_MODULE Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625726 spots for SRR7170617.sra Written 625726 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra Read 625712 spots for SRR7170617.sra Written 625712 spots for SRR7170617.sra SRR ids: ['SRR7170617.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rr2ttmlc SRR7170617.sra spots: 12514254 blocks: [[1, 625712], [625713, 1251424], [1251425, 1877136], [1877137, 2502848], [2502849, 3128560], [3128561, 3754272], [3754273, 4379984], [4379985, 5005696], [5005697, 5631408], [5631409, 6257120], [6257121, 6882832], [6882833, 7508544], [7508545, 8134256], [8134257, 8759968], [8759969, 9385680], [9385681, 10011392], [10011393, 10637104], [10637105, 11262816], [11262817, 11888528], [11888529, 12514254]] SRR7170617 file size 4218969 SRR7170617 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170617 SRR7170617_1.fastq SRR7170617_2.fastq Input file: SRR7170617_1.fastq Paired file: SRR7170617_2.fastq trimmed: SRR7170617-trimmed-pair1.fastq, SRR7170617-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 16:02:53 2025 >> started Thu Apr 10 16:03:07 2025 >> done (14.185s) 12514254 read pairs processed; of these: 17744 ( 0.14%) short read pairs filtered out after trimming by size control 181521 ( 1.45%) empty read pairs filtered out after trimming by size control 12314989 (98.41%) read pairs available; of these: 6003156 (48.75%) trimmed read pairs available after processing 6311833 (51.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 11 0.00% 20 14 0.00% 21 13 0.00% 22 10 0.00% 23 14 0.00% 24 16 0.00% 25 16 0.00% 26 14 0.00% 27 15 0.00% 28 11 0.00% 29 13 0.00% 30 18 0.00% 31 21 0.00% 32 20 0.00% 33 23 0.00% 34 20 0.00% 35 14 0.00% 36 22 0.00% 37 20 0.00% 38 39 0.00% 39 36 0.00% 40 39 0.00% 41 45 0.00% 42 39 0.00% 43 56 0.00% 44 62 0.00% 45 83 0.00% 46 107 0.00% 47 114 0.00% 48 138 0.00% 49 132 0.00% 50 148 0.00% 51 175 0.00% 52 175 0.00% 53 178 0.00% 54 208 0.00% 55 232 0.00% 56 247 0.00% 57 271 0.00% 58 308 0.00% 59 358 0.00% 60 422 0.00% 61 420 0.00% 62 443 0.00% 63 507 0.00% 64 587 0.00% 65 586 0.00% 66 645 0.01% 67 658 0.01% 68 729 0.01% 69 820 0.01% 70 1001 0.01% 71 1182 0.01% 72 1419 0.01% 73 1564 0.01% 74 1835 0.01% 75 2916 0.02% 76 7256 0.06% 77 7698 0.06% 78 3645 0.03% 79 3160 0.03% 80 3035 0.02% 81 3221 0.03% 82 3878 0.03% 83 4267 0.03% 84 5573 0.05% 85 6059 0.05% 86 6613 0.05% 87 6598 0.05% 88 7138 0.06% 89 7115 0.06% 90 7586 0.06% 91 8177 0.07% 92 8704 0.07% 93 9695 0.08% 94 10078 0.08% 95 10457 0.08% 96 11137 0.09% 97 11175 0.09% 98 11513 0.09% 99 11844 0.10% 100 12525 0.10% 101 13287 0.11% 102 14325 0.12% 103 15295 0.12% 104 16016 0.13% 105 16614 0.13% 106 17078 0.14% 107 16786 0.14% 108 17231 0.14% 109 18439 0.15% 110 18938 0.15% 111 19414 0.16% 112 20746 0.17% 113 22328 0.18% 114 22821 0.19% 115 22664 0.18% 116 23197 0.19% 117 23137 0.19% 118 23837 0.19% 119 23759 0.19% 120 24687 0.20% 121 25372 0.21% 122 25920 0.21% 123 27726 0.23% 124 28312 0.23% 125 29154 0.24% 126 29926 0.24% 127 30292 0.25% 128 31115 0.25% 129 31838 0.26% 130 32659 0.27% 131 33461 0.27% 132 35042 0.28% 133 36644 0.30% 134 38939 0.32% 135 40505 0.33% 136 42606 0.35% 137 44908 0.36% 138 46377 0.38% 139 49960 0.41% 140 53035 0.43% 141 59211 0.48% 142 65239 0.53% 143 73329 0.60% 144 84138 0.68% 145 101318 0.82% 146 128517 1.04% 147 178737 1.45% 148 279952 2.27% 149 568991 4.62% 150 3151951 25.59% 151 6311833 51.25% 12314989 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=21 prefix-density=0.63 prefix-fanout=2.3 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=51.57 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=1.3 sequence=TTATTTATCACTAATATTCCAGGTAATAGAAGCACTAATTTCATAATCAGAAAGGTTTAGTAAGGTTTTTGCCCAACATAGTTGCCGGGTGGATCATAGTTGCACCCAATGAAGGTTCCTCCGGTGCTACACTTCACTTTAGCACATCCTAGGCGAGCAGAGTTACGCCAAACCACCTGAGTATAGTGCCCACACTGCTGGCCAGCGGCACATGAGTTGGAGTTGTAGTCGTAGTAAGCCTTCTCATCAACCCACAGTTTTACAGCATCTGTACCTGAAAGGTCCGCGCTGCTCCATGCAATGTTCTCCCCATAAGGTCCACCTGAATGGACAAGGTTGCAATCGCCGGCACGTTGGTTAGCATAATTTTGTGCATAGGCTTGCACTGTGGTGTCCCAGGTTAGTGGACCAACACCTACAGCTGCACGAGCTGCATTATGAGCATCAAGGTAATCTTGTGGGTTGTCTTGGGCACGAGAGGG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=9 prefix-density=0.79 prefix-fanout=2.4 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=36.22 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170617 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 16:03:53 Started mapping on | Apr 10 16:03:53 Finished on | Apr 10 16:06:01 Mapping speed, Million of reads per hour | 346.36 Number of input reads | 12314989 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11029039 Uniquely mapped reads % | 89.56% Average mapped length | 293.56 Number of splices: Total | 9376448 Number of splices: Annotated (sjdb) | 9158475 Number of splices: GT/AG | 9188739 Number of splices: GC/AG | 146027 Number of splices: AT/AC | 8468 Number of splices: Non-canonical | 33214 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.03% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327058 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 26352 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.46% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 976046 976046 976046 N_multimapping 327058 327058 327058 N_noFeature 334869 10711445 393985 N_ambiguous 343414 744 84776 UnstrandedReadsAssigned:10350756 PositiveStrandReadsAssigned:316850 NegativeStrandReadsAssigned:10550278 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170617 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170617-trimmed-pair1.fastq SRR7170617-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,314,989 reads, 10,445,781 reads pseudoaligned [quant] estimated average fragment length: 248.067 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7170617.ke.tsv 34699 SRR7170617.se.tsv 87100 total ==> SRR7170617.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.93 438 16.2784 Potri.005G024800.1.v4.1 1035 787.933 332 27.7325 Potri.004G059700.1.v4.1 961 713.947 16 1.47501 Potri.007G009000.2.v4.1 1416 1168.93 0 0 Potri.003G141000.2.v4.1 2943 2695.93 531 12.9636 Potri.016G087400.1.v4.1 270 78.6749 673 563.013 Potri.015G069301.1.v4.1 564 321.556 0 0 Potri.010G195200.1.v4.1 1773 1525.93 111 4.78771 Potri.012G127500.1.v4.1 977 729.947 140 12.6234 ==> SRR7170617.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 737 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 371 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 90 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR7170617 completed mapping pipeline successfully