Starting /dee2/code/volunteer_pipeline.sh SRR7170618 current disk space = 3092459556864 free memory = 1572594752 SRR7170618 SRAfilesize 94c710e697b24e68094d4fe727f52594 SRR7170618.sra SRR7170618.sra file validated SRR7170618 is paired end SRR7170618 is conventional basespace SRR7170618 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170618_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.399 28.0 18.0 32.0 18.0 33.0 2 31.39575 33.0 31.0 33.0 29.0 33.0 3 32.15175 33.0 33.0 33.0 29.0 34.0 4 32.052 33.0 33.0 33.0 31.0 34.0 5 32.6945 33.0 33.0 34.0 32.0 34.0 6 36.7465 38.0 37.0 38.0 34.0 38.0 7 37.089 38.0 38.0 38.0 36.0 38.0 8 37.265 38.0 38.0 38.0 36.0 38.0 9 37.30575 38.0 38.0 38.0 37.0 38.0 10-14 37.3152 38.0 38.0 38.0 37.0 38.0 15-19 37.35055 38.0 38.0 38.0 37.0 38.0 20-24 37.423350000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.41675 38.0 38.0 38.0 37.0 38.0 30-34 37.363 38.0 38.0 38.0 37.0 38.0 35-39 37.411199999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.36225 38.0 38.0 38.0 37.0 38.0 45-49 37.3154 38.0 38.0 38.0 37.0 38.0 50-54 37.221599999999995 38.0 38.0 38.0 36.4 38.0 55-59 37.0656 38.0 38.0 38.0 36.0 38.0 60-64 37.06635 38.0 38.0 38.0 36.0 38.0 65-69 36.964150000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.881699999999995 38.0 38.0 38.0 35.0 38.0 75-79 36.7905 38.0 38.0 38.0 34.8 38.0 80-84 36.71845 38.0 38.0 38.0 34.6 38.0 85-89 36.68685 38.0 38.0 38.0 34.0 38.0 90-94 36.5092 38.0 37.8 38.0 34.0 38.0 95-99 36.38099999999999 38.0 37.2 38.0 33.6 38.0 100-104 36.22664999999999 38.0 37.0 38.0 33.6 38.0 105-109 36.02165 38.0 37.0 38.0 33.0 38.0 110-114 35.71945 38.0 36.6 38.0 30.6 38.0 115-119 35.52405 38.0 36.0 38.0 29.8 38.0 120-124 35.2978 38.0 36.0 38.0 28.8 38.0 125-129 35.0207 38.0 35.0 38.0 28.0 38.0 130-134 34.7012 38.0 34.8 38.0 27.2 38.0 135-139 34.3558 38.0 34.2 38.0 25.4 38.0 140-144 33.7 38.0 33.2 38.0 23.0 38.0 145-149 32.8246 38.0 33.0 38.0 16.6 38.0 150-151 28.402375 35.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 1.0 17 2.0 18 1.0 19 3.0 20 6.0 21 3.0 22 2.0 23 8.0 24 15.0 25 16.0 26 8.0 27 23.0 28 23.0 29 30.0 30 46.0 31 73.0 32 83.0 33 132.0 34 210.0 35 412.0 36 931.0 37 1966.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.83009211873081 18.065506653019447 12.589559877175024 36.514841351074715 2 19.775000000000002 26.424999999999997 37.525 16.275000000000002 3 16.175 32.025 28.625 23.175 4 19.975 36.75 22.725 20.549999999999997 5 20.650813516896118 36.545682102628284 23.329161451814766 19.474342928660825 6 15.950000000000001 35.925000000000004 25.674999999999997 22.45 7 13.55 19.675 45.225 21.55 8 19.575 20.0 27.400000000000002 33.025 9 17.4 20.8 31.75 30.049999999999997 10-14 19.155 29.17 27.01 24.665 15-19 19.42 28.175 28.29 24.115000000000002 20-24 19.61 28.82 27.825 23.745 25-29 19.57 28.88 27.805000000000003 23.745 30-34 19.830000000000002 28.945 28.4 22.825 35-39 20.01 28.49 27.800000000000004 23.7 40-44 19.53 29.34 27.944999999999997 23.185 45-49 19.82 29.04 27.62 23.52 50-54 19.475 28.999999999999996 27.73 23.794999999999998 55-59 20.005 28.910000000000004 28.275 22.81 60-64 19.6 28.67 28.310000000000002 23.419999999999998 65-69 19.655 29.015 27.794999999999998 23.535 70-74 20.025000000000002 28.775000000000002 27.77 23.43 75-79 20.005 28.105000000000004 28.04 23.849999999999998 80-84 20.3 28.84 27.084999999999997 23.775 85-89 19.835 28.475 28.065 23.625 90-94 19.72 28.26 28.455000000000002 23.565 95-99 20.07 27.63 28.33 23.97 100-104 20.064999999999998 28.449999999999996 27.33 24.154999999999998 105-109 20.025000000000002 27.994999999999997 28.215 23.765 110-114 19.869999999999997 28.105000000000004 28.685 23.34 115-119 20.91 28.52 27.405 23.165 120-124 20.52 28.185 27.665 23.630000000000003 125-129 20.23 28.310000000000002 27.560000000000002 23.9 130-134 20.225 28.715000000000003 27.495000000000005 23.565 135-139 20.555 27.91 27.845 23.69 140-144 20.075000000000003 28.58 27.215 24.13 145-149 20.335 28.505000000000003 27.275 23.885 150-151 20.3875 28.325 27.5875 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 2.0 24 3.0 25 4.0 26 9.0 27 13.0 28 12.5 29 16.0 30 26.5 31 30.5 32 32.0 33 47.0 34 73.5 35 97.5 36 111.0 37 126.0 38 126.0 39 152.0 40 206.0 41 229.5 42 232.0 43 243.5 44 268.0 45 271.5 46 259.5 47 242.5 48 228.0 49 211.5 50 177.0 51 140.0 52 111.0 53 83.5 54 57.0 55 42.0 56 35.0 57 22.0 58 13.0 59 10.0 60 8.0 61 6.0 62 3.0 63 3.5 64 3.0 65 2.0 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.7749999999999999 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.2125000000000004 0.0 0.0 0.0 0.0 128-129 2.35 0.0 0.0 0.0 0.0 130-131 2.5374999999999996 0.0 0.0 0.0 0.0 132-133 2.7625 0.0 0.0 0.0 0.0 134-135 3.0625 0.0 0.0 0.0 0.0 136-137 3.1875 0.0 0.0 0.0 0.0 138-139 3.3375000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170618 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170618_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74425 33.0 33.0 34.0 32.0 34.0 2 32.88075 33.0 33.0 34.0 32.0 34.0 3 32.942 33.0 33.0 34.0 32.0 34.0 4 32.9555 34.0 33.0 34.0 32.0 34.0 5 32.921 34.0 33.0 34.0 32.0 34.0 6 37.01 38.0 38.0 38.0 36.0 38.0 7 37.12 38.0 38.0 38.0 37.0 38.0 8 37.0815 38.0 38.0 38.0 37.0 38.0 9 37.07025 38.0 38.0 38.0 37.0 38.0 10-14 37.0949 38.0 38.0 38.0 37.0 38.0 15-19 37.055 38.0 38.0 38.0 36.8 38.0 20-24 37.02865 38.0 38.0 38.0 36.6 38.0 25-29 37.009249999999994 38.0 38.0 38.0 36.8 38.0 30-34 36.97615 38.0 38.0 38.0 36.2 38.0 35-39 37.00599999999999 38.0 38.0 38.0 36.6 38.0 40-44 36.98475 38.0 38.0 38.0 36.6 38.0 45-49 36.9129 38.0 38.0 38.0 36.2 38.0 50-54 36.816050000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.7601 38.0 38.0 38.0 36.0 38.0 60-64 36.74715 38.0 38.0 38.0 35.8 38.0 65-69 36.64065 38.0 38.0 38.0 35.0 38.0 70-74 36.614 38.0 38.0 38.0 35.0 38.0 75-79 36.663650000000004 38.0 38.0 38.0 35.2 38.0 80-84 36.4745 38.0 38.0 38.0 34.6 38.0 85-89 36.40455 38.0 38.0 38.0 34.0 38.0 90-94 36.226600000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.1464 38.0 38.0 38.0 33.6 38.0 100-104 35.975350000000006 38.0 37.2 38.0 33.0 38.0 105-109 35.8594 38.0 37.0 38.0 32.8 38.0 110-114 35.688900000000004 38.0 37.0 38.0 31.6 38.0 115-119 35.4773 38.0 36.8 38.0 31.0 38.0 120-124 35.150850000000005 38.0 36.0 38.0 29.0 38.0 125-129 34.8898 38.0 35.8 38.0 28.0 38.0 130-134 34.34895 38.0 34.0 38.0 25.6 38.0 135-139 33.894800000000004 38.0 33.2 38.0 23.4 38.0 140-144 33.307550000000006 38.0 33.0 38.0 20.4 38.0 145-149 32.22175 38.0 33.0 38.0 12.4 38.0 150-151 26.847 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 8.0 4 3.0 5 1.0 6 1.0 7 2.0 8 3.0 9 0.0 10 2.0 11 2.0 12 1.0 13 2.0 14 1.0 15 1.0 16 5.0 17 6.0 18 2.0 19 5.0 20 4.0 21 5.0 22 7.0 23 15.0 24 11.0 25 16.0 26 21.0 27 24.0 28 40.0 29 37.0 30 49.0 31 61.0 32 83.0 33 94.0 34 177.0 35 316.0 36 744.0 37 2242.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.449999999999996 14.6 14.799999999999999 34.150000000000006 2 23.200000000000003 23.125 37.4 16.275000000000002 3 19.2 25.75 32.425 22.625 4 22.650000000000002 36.449999999999996 21.45 19.45 5 21.375 38.925 21.775 17.925 6 17.00050075112669 37.781672508763144 25.01251877816725 20.205307961942914 7 17.34668335419274 15.494367959949937 45.90738423028786 21.25156445556946 8 20.926157697121404 21.026282853566958 26.83354192740926 31.214017521902377 9 20.075093867334168 23.704630788485606 29.662077596996244 26.558197747183982 10-14 22.65331664580726 28.340425531914892 27.479349186483105 21.526908635794744 15-19 22.41741741741742 27.24224224224224 29.06906906906907 21.27127127127127 20-24 22.333983886303358 27.953760696592106 27.923735174898663 21.788520242205873 25-29 22.137710168134507 29.0482385908727 27.892313851080864 20.92173738991193 30-34 22.575317786007407 27.759983985587027 28.305474927434695 21.35922330097087 35-39 22.583229036295368 27.989987484355446 28.355444305381727 21.07133917396746 40-44 23.054581872809212 27.541311967951927 28.217325988983475 21.186780170255386 45-49 22.51201441730076 27.89347216659992 28.328994793752504 21.265518622346814 50-54 22.683354192740925 27.9549436795995 28.46558197747184 20.896120150187734 55-59 23.17628798878486 27.557202223001052 28.10794572673109 21.158564061483002 60-64 23.269086357947437 27.449311639549435 27.684605757196497 21.59699624530663 65-69 22.75706780085064 27.340505379034276 28.251188391293468 21.651238428821618 70-74 23.397227365997697 28.17676792953306 27.315950152645012 21.110054551824234 75-79 22.896027219053337 28.164715300710498 27.789452616831785 21.149804863404384 80-84 22.574188059850872 28.30405844968223 27.57343742180854 21.54831606865836 85-89 22.992992992992995 27.97797797797798 27.67267267267267 21.356356356356358 90-94 23.190871784606145 27.860074066659994 28.145330797717943 20.803723351015915 95-99 23.165849264337904 28.115303773396054 27.950155139625664 20.768691822640374 100-104 23.361024922430186 28.130317285557 28.49064157741968 20.018016214593136 105-109 23.122747296756106 27.968562274729674 28.183820584701643 20.724869843812574 110-114 23.32265171239736 28.394752653715198 27.598638093330663 20.68395754055678 115-119 23.339173967459324 28.455569461827285 27.74468085106383 20.46057571964956 120-124 23.70344413295955 28.449138966760113 27.53804565478574 20.309371245494592 125-129 23.059977971362773 28.431961550015018 28.071492940823067 20.43656753779914 130-134 23.809762202753443 28.50563204005006 27.239048811013767 20.445556946182727 135-139 23.62926243052426 28.51634870562315 27.55996194481999 20.294426919032595 140-144 23.769219211699305 28.266639955927282 28.006210246907397 19.95793058546602 145-149 24.273495723503228 28.344920722252787 28.00980343120092 19.371780123043063 150-151 24.675 27.3375 27.737499999999997 20.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 2.5 23 3.5 24 3.5 25 3.5 26 5.0 27 5.0 28 10.5 29 15.0 30 13.5 31 16.5 32 24.5 33 42.0 34 60.5 35 74.5 36 84.5 37 95.5 38 124.5 39 156.0 40 190.0 41 220.5 42 234.5 43 249.0 44 269.0 45 289.5 46 285.0 47 260.5 48 242.5 49 200.5 50 164.5 51 147.5 52 113.5 53 95.0 54 78.5 55 54.0 56 44.0 57 36.0 58 22.5 59 17.0 60 14.5 61 9.0 62 5.5 63 3.0 64 1.5 65 0.5 66 1.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.15 7 0.125 8 0.125 9 0.125 10-14 0.125 15-19 0.1 20-24 0.08499999999999999 25-29 0.08 30-34 0.09 35-39 0.125 40-44 0.15 45-49 0.12 50-54 0.125 55-59 0.135 60-64 0.125 65-69 0.075 70-74 0.095 75-79 0.06999999999999999 80-84 0.08499999999999999 85-89 0.1 90-94 0.09 95-99 0.09 100-104 0.09 105-109 0.12 110-114 0.13999999999999999 115-119 0.125 120-124 0.12 125-129 0.13 130-134 0.125 135-139 0.145 140-144 0.165 145-149 0.034999999999999996 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19110212335693 98.1 2 0.6825075834175935 1.35 3 0.07583417593528817 0.22499999999999998 4 0.0 0.0 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02527805864509606 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 8 0.2 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.7749999999999999 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.2625 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 1.9874999999999998 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.5875000000000004 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 3.0875 0.0 0.0 0.0 0.0 136-137 3.2125000000000004 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGCCA 10 0.006830828 145.0 8 >>END_MODULE Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778883 spots for SRR7170618.sra Written 778883 spots for SRR7170618.sra Read 778884 spots for SRR7170618.sra Written 778884 spots for SRR7170618.sra SRR ids: ['SRR7170618.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vh4aqlnj SRR7170618.sra spots: 15577661 blocks: [[1, 778883], [778884, 1557766], [1557767, 2336649], [2336650, 3115532], [3115533, 3894415], [3894416, 4673298], [4673299, 5452181], [5452182, 6231064], [6231065, 7009947], [7009948, 7788830], [7788831, 8567713], [8567714, 9346596], [9346597, 10125479], [10125480, 10904362], [10904363, 11683245], [11683246, 12462128], [12462129, 13241011], [13241012, 14019894], [14019895, 14798777], [14798778, 15577661]] SRR7170618 file size 5257057 SRR7170618 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170618 SRR7170618_1.fastq SRR7170618_2.fastq Input file: SRR7170618_1.fastq Paired file: SRR7170618_2.fastq trimmed: SRR7170618-trimmed-pair1.fastq, SRR7170618-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:19:26 2025 >> started Thu Feb 13 12:19:46 2025 >> done (19.386s) 15577661 read pairs processed; of these: 14390 ( 0.09%) short read pairs filtered out after trimming by size control 12066 ( 0.08%) empty read pairs filtered out after trimming by size control 15551205 (99.83%) read pairs available; of these: 8080464 (51.96%) trimmed read pairs available after processing 7470741 (48.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 6 0.00% 21 7 0.00% 22 8 0.00% 23 10 0.00% 24 6 0.00% 25 8 0.00% 26 6 0.00% 27 12 0.00% 28 6 0.00% 29 11 0.00% 30 9 0.00% 31 11 0.00% 32 10 0.00% 33 9 0.00% 34 11 0.00% 35 13 0.00% 36 12 0.00% 37 20 0.00% 38 13 0.00% 39 13 0.00% 40 28 0.00% 41 23 0.00% 42 26 0.00% 43 26 0.00% 44 21 0.00% 45 25 0.00% 46 31 0.00% 47 41 0.00% 48 35 0.00% 49 45 0.00% 50 61 0.00% 51 74 0.00% 52 85 0.00% 53 89 0.00% 54 86 0.00% 55 90 0.00% 56 122 0.00% 57 114 0.00% 58 150 0.00% 59 196 0.00% 60 164 0.00% 61 201 0.00% 62 239 0.00% 63 267 0.00% 64 278 0.00% 65 350 0.00% 66 343 0.00% 67 355 0.00% 68 471 0.00% 69 511 0.00% 70 610 0.00% 71 688 0.00% 72 786 0.01% 73 882 0.01% 74 1014 0.01% 75 1042 0.01% 76 1251 0.01% 77 1299 0.01% 78 1404 0.01% 79 1551 0.01% 80 1708 0.01% 81 1964 0.01% 82 2268 0.01% 83 2622 0.02% 84 3396 0.02% 85 3977 0.03% 86 4225 0.03% 87 4459 0.03% 88 4514 0.03% 89 4940 0.03% 90 5231 0.03% 91 5447 0.04% 92 5794 0.04% 93 6324 0.04% 94 6836 0.04% 95 7220 0.05% 96 7531 0.05% 97 7875 0.05% 98 8220 0.05% 99 8396 0.05% 100 8955 0.06% 101 9607 0.06% 102 9812 0.06% 103 10463 0.07% 104 10939 0.07% 105 11652 0.07% 106 11875 0.08% 107 12340 0.08% 108 13007 0.08% 109 13443 0.09% 110 13605 0.09% 111 14558 0.09% 112 15416 0.10% 113 16011 0.10% 114 16770 0.11% 115 17252 0.11% 116 17720 0.11% 117 18444 0.12% 118 19168 0.12% 119 19498 0.13% 120 20590 0.13% 121 21401 0.14% 122 22333 0.14% 123 24082 0.15% 124 25359 0.16% 125 26760 0.17% 126 27170 0.17% 127 28812 0.19% 128 30600 0.20% 129 31289 0.20% 130 32869 0.21% 131 34399 0.22% 132 37171 0.24% 133 39607 0.25% 134 42788 0.28% 135 46375 0.30% 136 50112 0.32% 137 55181 0.35% 138 60556 0.39% 139 67264 0.43% 140 75033 0.48% 141 85659 0.55% 142 99041 0.64% 143 117180 0.75% 144 138682 0.89% 145 173714 1.12% 146 221150 1.42% 147 312470 2.01% 148 487540 3.14% 149 984308 6.33% 150 4262199 27.41% 151 7470741 48.04% 15551205 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=15 prefix-density=0.64 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=11.34 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.9 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGA criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=13 prefix-density=0.85 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=32.59 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.4 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170618 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:20:32 Started mapping on | Feb 13 12:20:32 Finished on | Feb 13 12:22:06 Mapping speed, Million of reads per hour | 595.58 Number of input reads | 15551205 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14728515 Uniquely mapped reads % | 94.71% Average mapped length | 295.18 Number of splices: Total | 14808942 Number of splices: Annotated (sjdb) | 14478398 Number of splices: GT/AG | 14513112 Number of splices: GC/AG | 244637 Number of splices: AT/AC | 7913 Number of splices: Non-canonical | 43280 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 419848 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 24256 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 415762 415762 415762 N_multimapping 419848 419848 419848 N_noFeature 570486 14512458 651040 N_ambiguous 240838 922 104754 UnstrandedReadsAssigned:13917191 PositiveStrandReadsAssigned:215135 NegativeStrandReadsAssigned:13972721 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170618 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170618-trimmed-pair1.fastq SRR7170618-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,551,205 reads, 13,881,049 reads pseudoaligned [quant] estimated average fragment length: 288.656 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR7170618.ke.tsv 34699 SRR7170618.se.tsv 87100 total ==> SRR7170618.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.34 538 22.2942 Potri.005G024800.1.v4.1 1035 747.344 95 9.11476 Potri.004G059700.1.v4.1 961 673.45 13 1.38414 Potri.007G009000.2.v4.1 1416 1128.34 0 0 Potri.003G141000.2.v4.1 2943 2655.34 887.755 23.9726 Potri.016G087400.1.v4.1 270 71.2733 750 754.53 Potri.015G069301.1.v4.1 564 288.857 0 0 Potri.010G195200.1.v4.1 1773 1485.34 57.8585 2.79307 Potri.012G127500.1.v4.1 977 689.398 72 7.48867 ==> SRR7170618.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1246 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 3 SRR7170618 completed mapping pipeline successfully