Starting /dee2/code/volunteer_pipeline.sh SRR7170619 current disk space = 3092430884864 free memory = 1576580672 SRR7170619 SRAfilesize bf2441568a9d2b0bf36f927a62938a8f SRR7170619.sra SRR7170619.sra file validated SRR7170619 is paired end SRR7170619 is conventional basespace SRR7170619 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170619_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.22 28.0 18.0 32.0 18.0 33.0 2 31.15475 33.0 30.0 33.0 27.0 33.0 3 32.0085 33.0 31.0 33.0 29.0 33.0 4 32.48475 33.0 33.0 33.0 31.0 34.0 5 32.994 33.0 33.0 34.0 32.0 34.0 6 37.07325 38.0 37.0 38.0 36.0 38.0 7 37.30325 38.0 38.0 38.0 36.0 38.0 8 37.4405 38.0 38.0 38.0 37.0 38.0 9 37.3945 38.0 38.0 38.0 37.0 38.0 10-14 37.45335 38.0 38.0 38.0 37.0 38.0 15-19 37.426750000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.530199999999994 38.0 38.0 38.0 37.8 38.0 25-29 37.4868 38.0 38.0 38.0 37.6 38.0 30-34 37.446600000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.443149999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.35315 38.0 38.0 38.0 37.0 38.0 45-49 37.36035 38.0 38.0 38.0 37.0 38.0 50-54 37.278000000000006 38.0 38.0 38.0 36.8 38.0 55-59 37.20035 38.0 38.0 38.0 36.4 38.0 60-64 37.192499999999995 38.0 38.0 38.0 36.2 38.0 65-69 37.06524999999999 38.0 38.0 38.0 35.8 38.0 70-74 36.95865 38.0 38.0 38.0 35.6 38.0 75-79 36.817949999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.90575 38.0 38.0 38.0 35.8 38.0 85-89 36.71075 38.0 38.0 38.0 34.6 38.0 90-94 36.541250000000005 38.0 38.0 38.0 34.2 38.0 95-99 36.42255 38.0 38.0 38.0 34.0 38.0 100-104 36.22835 38.0 37.0 38.0 33.4 38.0 105-109 36.1772 38.0 37.2 38.0 33.2 38.0 110-114 35.985949999999995 38.0 37.0 38.0 32.2 38.0 115-119 35.80485 38.0 36.8 38.0 31.8 38.0 120-124 35.6957 38.0 36.0 38.0 30.6 38.0 125-129 35.381299999999996 38.0 36.0 38.0 29.8 38.0 130-134 34.7871 38.0 35.0 38.0 26.8 38.0 135-139 34.20335 38.0 34.2 38.0 24.0 38.0 140-144 33.60369999999999 38.0 33.4 38.0 21.0 38.0 145-149 32.78055 38.0 33.4 38.0 16.4 38.0 150-151 28.7635 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 2.0 16 0.0 17 1.0 18 3.0 19 3.0 20 3.0 21 3.0 22 8.0 23 6.0 24 10.0 25 11.0 26 15.0 27 17.0 28 22.0 29 32.0 30 47.0 31 61.0 32 78.0 33 113.0 34 206.0 35 362.0 36 912.0 37 2080.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.859043233563575 17.779483243796367 12.125863392171912 31.23561013046815 2 19.1 24.025 36.625 20.25 3 15.475 31.3 29.049999999999997 24.175 4 20.474999999999998 36.65 23.599999999999998 19.275000000000002 5 19.899874843554443 38.02252816020025 22.102628285356694 19.97496871088861 6 15.55 37.65 25.7 21.099999999999998 7 13.65 20.599999999999998 44.725 21.025 8 17.325 21.0 27.025 34.65 9 16.400000000000002 23.375 31.15 29.075 10-14 18.975 29.81 27.29 23.925 15-19 19.31 29.425 27.11 24.154999999999998 20-24 18.94 29.04 27.425 24.595 25-29 19.5 29.4 26.995 24.104999999999997 30-34 19.445 28.815 28.1 23.64 35-39 19.53 28.810000000000002 26.655 25.005 40-44 19.535 28.28 27.685 24.5 45-49 19.865 28.65 27.284999999999997 24.2 50-54 20.165 28.655 27.400000000000002 23.78 55-59 20.02 28.694999999999997 27.18 24.104999999999997 60-64 19.139999999999997 28.139999999999997 27.725 24.995 65-69 19.785 28.57 27.384999999999998 24.26 70-74 20.330000000000002 28.28 27.735 23.655 75-79 19.59 28.22 27.41 24.779999999999998 80-84 19.96 28.32 27.339999999999996 24.38 85-89 20.544999999999998 28.09 27.155 24.21 90-94 19.86 27.900000000000002 28.044999999999998 24.195 95-99 20.23 28.075 27.42 24.275 100-104 20.385 27.55 27.189999999999998 24.875 105-109 19.895 27.675 27.655 24.775 110-114 21.29 27.265 27.334999999999997 24.11 115-119 20.419999999999998 27.694999999999997 27.805000000000003 24.08 120-124 20.580000000000002 27.515 26.995 24.91 125-129 20.66 27.334999999999997 27.900000000000002 24.104999999999997 130-134 21.135 27.725 27.26 23.880000000000003 135-139 20.91 27.375 27.755000000000003 23.96 140-144 20.365 27.845 27.325 24.465 145-149 20.805 27.875 26.775 24.545 150-151 21.224999999999998 26.85 28.212500000000002 23.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 3.0 21 2.5 22 2.0 23 2.5 24 3.0 25 5.0 26 6.5 27 8.5 28 11.0 29 18.0 30 27.0 31 28.0 32 35.5 33 53.5 34 67.0 35 84.0 36 105.0 37 120.5 38 125.0 39 141.5 40 169.0 41 202.0 42 215.5 43 232.0 44 261.5 45 253.0 46 244.5 47 235.0 48 228.5 49 225.0 50 210.5 51 165.5 52 113.5 53 95.0 54 81.0 55 62.0 56 47.5 57 37.0 58 24.0 59 15.0 60 11.5 61 9.0 62 5.0 63 2.0 64 2.0 65 2.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.67801857585138 94.65 2 1.9091847265221877 3.6999999999999997 3 0.2837977296181631 0.8250000000000001 4 0.05159958720330237 0.2 5 0.025799793601651185 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05159958720330237 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 10 0.25 No Hit GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 10 0.25 No Hit CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.775 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.4125 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 2.8375000000000004 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.3625 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170619 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170619_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82275 33.0 33.0 34.0 32.0 34.0 2 32.85875 33.0 33.0 34.0 32.0 34.0 3 32.946 34.0 33.0 34.0 32.0 34.0 4 32.91075 34.0 33.0 34.0 32.0 34.0 5 32.90425 34.0 33.0 34.0 32.0 34.0 6 37.12525 38.0 38.0 38.0 37.0 38.0 7 37.075 38.0 38.0 38.0 37.0 38.0 8 37.185 38.0 38.0 38.0 37.0 38.0 9 37.06125 38.0 38.0 38.0 37.0 38.0 10-14 37.058299999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.0257 38.0 38.0 38.0 36.8 38.0 20-24 36.984399999999994 38.0 38.0 38.0 36.4 38.0 25-29 36.99675 38.0 38.0 38.0 36.6 38.0 30-34 36.9631 38.0 38.0 38.0 36.4 38.0 35-39 36.934250000000006 38.0 38.0 38.0 36.4 38.0 40-44 36.96185 38.0 38.0 38.0 36.4 38.0 45-49 36.8571 38.0 38.0 38.0 36.0 38.0 50-54 36.84755 38.0 38.0 38.0 36.0 38.0 55-59 36.762299999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.7547 38.0 38.0 38.0 36.0 38.0 65-69 36.7571 38.0 38.0 38.0 35.8 38.0 70-74 36.6779 38.0 38.0 38.0 35.8 38.0 75-79 36.5927 38.0 38.0 38.0 35.0 38.0 80-84 36.4884 38.0 38.0 38.0 34.8 38.0 85-89 36.3168 38.0 38.0 38.0 34.2 38.0 90-94 36.26135 38.0 38.0 38.0 34.0 38.0 95-99 36.0152 38.0 38.0 38.0 33.8 38.0 100-104 35.9131 38.0 37.8 38.0 33.2 38.0 105-109 35.86215 38.0 37.6 38.0 33.0 38.0 110-114 35.709799999999994 38.0 37.0 38.0 32.8 38.0 115-119 35.43390000000001 38.0 36.8 38.0 30.4 38.0 120-124 35.158449999999995 38.0 36.6 38.0 29.8 38.0 125-129 34.7155 38.0 35.6 38.0 26.6 38.0 130-134 34.39365 38.0 35.2 38.0 26.2 38.0 135-139 34.19799999999999 38.0 34.0 38.0 25.4 38.0 140-144 33.6346 38.0 33.0 38.0 21.8 38.0 145-149 32.6644 38.0 33.0 38.0 12.4 38.0 150-151 27.678125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 2.0 5 4.0 6 3.0 7 2.0 8 2.0 9 3.0 10 4.0 11 3.0 12 3.0 13 5.0 14 5.0 15 5.0 16 4.0 17 7.0 18 7.0 19 4.0 20 5.0 21 4.0 22 10.0 23 9.0 24 12.0 25 17.0 26 20.0 27 21.0 28 28.0 29 31.0 30 43.0 31 55.0 32 68.0 33 110.0 34 152.0 35 269.0 36 649.0 37 2421.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.775 18.325 14.025000000000002 25.874999999999996 2 22.625 23.25 35.449999999999996 18.675 3 19.7 27.700000000000003 32.1 20.5 4 23.974999999999998 35.675000000000004 20.775 19.575 5 21.975 39.35 20.599999999999998 18.075 6 18.454613653413354 38.50962740685171 23.055763940985248 19.979994998749685 7 17.974999999999998 17.299999999999997 42.275 22.45 8 20.43010752688172 21.73043260815204 27.35683920980245 30.48262065516379 9 21.955488872218055 24.48112028007002 26.481620405101275 27.081770442610654 10-14 22.61065266316579 28.922230557639413 26.301575393848463 22.165541385346337 15-19 22.697269726972696 28.052805280528055 27.907790779077907 21.342134213421343 20-24 22.965 28.544999999999998 27.12 21.37 25-29 23.275000000000002 28.325 27.025 21.375 30-34 22.91843776566485 28.229234385157774 27.544131619742963 21.308196229434415 35-39 22.870717679419855 27.861965491372843 28.24206051512878 21.02525631407852 40-44 23.005352408583864 27.832524636086237 27.20724325946676 21.954879695863138 45-49 22.893434015102265 28.219232884932737 27.169075361304195 21.7182577386608 50-54 23.31 27.465 27.765 21.46 55-59 23.78356753513027 26.87903185477822 27.704155623343503 21.63324498674801 60-64 23.582358235823584 26.86768676867687 27.127712771277128 22.422242224222423 65-69 23.57 26.82 27.185 22.425 70-74 23.369999999999997 27.705000000000002 26.61 22.314999999999998 75-79 23.246162308115405 27.936396819840994 26.84134206710336 21.976098804940246 80-84 23.625 27.88 26.85 21.645 85-89 24.099999999999998 27.48 26.384999999999998 22.035 90-94 23.9 27.905 26.740000000000002 21.455 95-99 23.45 27.615000000000002 26.825 22.11 100-104 24.255 28.07 26.625 21.05 105-109 24.32 27.884999999999998 26.545 21.25 110-114 23.402340234023402 28.17781778177818 27.34773477347735 21.07210721072107 115-119 24.216210810540527 28.451422571128553 26.32131606580329 21.011050552527628 120-124 25.03 27.665 26.965 20.34 125-129 24.83 27.950000000000003 26.27 20.95 130-134 24.92 27.42 27.36 20.3 135-139 24.584916983396678 27.050410082016402 27.965593118623726 20.39907981596319 140-144 25.39007801560312 27.790558111622328 26.915383076615324 19.90398079615923 145-149 24.315 28.37 26.834999999999997 20.48 150-151 25.025 28.3375 26.6 20.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 2.0 26 3.5 27 7.5 28 8.5 29 10.5 30 13.0 31 16.5 32 23.5 33 26.0 34 33.5 35 50.0 36 68.0 37 93.0 38 111.5 39 132.5 40 172.5 41 203.0 42 220.0 43 251.0 44 271.5 45 286.0 46 277.0 47 230.0 48 219.5 49 224.0 50 205.5 51 162.5 52 126.5 53 115.5 54 108.5 55 87.5 56 66.0 57 47.5 58 32.0 59 34.0 60 25.0 61 12.5 62 9.0 63 4.0 64 2.0 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.025 9 0.025 10-14 0.025 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.025 40-44 0.045 45-49 0.015 50-54 0.0 55-59 0.015 60-64 0.01 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.02 140-144 0.02 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.5 #Duplication Level Percentage of deduplicated Percentage of total 1 97.84974093264248 94.425 2 1.5803108808290156 3.05 3 0.233160621761658 0.675 4 0.1295336787564767 0.5 5 0.025906735751295335 0.125 6 0.10362694300518134 0.6 7 0.05181347150259067 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.025906735751295335 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 11 0.27499999999999997 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 7 0.17500000000000002 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 7 0.17500000000000002 No Hit TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit CTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCAGACTT 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.525 0.0 0.0 0.0 0.0 118-119 1.6375 0.0 0.0 0.0 0.0 120-121 1.8250000000000002 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2875 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.7625 0.0 0.0 0.0 0.0 130-131 2.9625000000000004 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.75 0.0 0.0 0.0 0.0 138-139 4.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAATTC 10 0.006830828 145.0 3 >>END_MODULE Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859177 spots for SRR7170619.sra Written 859177 spots for SRR7170619.sra Read 859189 spots for SRR7170619.sra Written 859189 spots for SRR7170619.sra SRR ids: ['SRR7170619.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7r6yomaf SRR7170619.sra spots: 17183552 blocks: [[1, 859177], [859178, 1718354], [1718355, 2577531], [2577532, 3436708], [3436709, 4295885], [4295886, 5155062], [5155063, 6014239], [6014240, 6873416], [6873417, 7732593], [7732594, 8591770], [8591771, 9450947], [9450948, 10310124], [10310125, 11169301], [11169302, 12028478], [12028479, 12887655], [12887656, 13746832], [13746833, 14606009], [14606010, 15465186], [15465187, 16324363], [16324364, 17183552]] SRR7170619 file size 5801241 SRR7170619 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170619 SRR7170619_1.fastq SRR7170619_2.fastq Input file: SRR7170619_1.fastq Paired file: SRR7170619_2.fastq trimmed: SRR7170619-trimmed-pair1.fastq, SRR7170619-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:20:39 2025 >> started Thu Feb 13 12:20:58 2025 >> done (19.766s) 17183552 read pairs processed; of these: 27037 ( 0.16%) short read pairs filtered out after trimming by size control 43781 ( 0.25%) empty read pairs filtered out after trimming by size control 17112734 (99.59%) read pairs available; of these: 8502543 (49.69%) trimmed read pairs available after processing 8610191 (50.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 11 0.00% 21 10 0.00% 22 10 0.00% 23 5 0.00% 24 8 0.00% 25 8 0.00% 26 18 0.00% 27 17 0.00% 28 11 0.00% 29 7 0.00% 30 10 0.00% 31 19 0.00% 32 10 0.00% 33 14 0.00% 34 15 0.00% 35 14 0.00% 36 24 0.00% 37 20 0.00% 38 24 0.00% 39 29 0.00% 40 27 0.00% 41 35 0.00% 42 34 0.00% 43 30 0.00% 44 34 0.00% 45 46 0.00% 46 61 0.00% 47 60 0.00% 48 83 0.00% 49 88 0.00% 50 86 0.00% 51 102 0.00% 52 109 0.00% 53 99 0.00% 54 116 0.00% 55 114 0.00% 56 137 0.00% 57 130 0.00% 58 150 0.00% 59 175 0.00% 60 236 0.00% 61 236 0.00% 62 279 0.00% 63 330 0.00% 64 300 0.00% 65 362 0.00% 66 392 0.00% 67 418 0.00% 68 472 0.00% 69 548 0.00% 70 620 0.00% 71 725 0.00% 72 859 0.01% 73 954 0.01% 74 1078 0.01% 75 1353 0.01% 76 2143 0.01% 77 2276 0.01% 78 1825 0.01% 79 1862 0.01% 80 1984 0.01% 81 2284 0.01% 82 2533 0.01% 83 2867 0.02% 84 4252 0.02% 85 5230 0.03% 86 5431 0.03% 87 6273 0.04% 88 6026 0.04% 89 6275 0.04% 90 6502 0.04% 91 6812 0.04% 92 7128 0.04% 93 7805 0.05% 94 8422 0.05% 95 9161 0.05% 96 9257 0.05% 97 9443 0.06% 98 9918 0.06% 99 10439 0.06% 100 11128 0.07% 101 11673 0.07% 102 12465 0.07% 103 13295 0.08% 104 13886 0.08% 105 14834 0.09% 106 15454 0.09% 107 15947 0.09% 108 16173 0.09% 109 17139 0.10% 110 17880 0.10% 111 18650 0.11% 112 19523 0.11% 113 20635 0.12% 114 21585 0.13% 115 21849 0.13% 116 22798 0.13% 117 23462 0.14% 118 24122 0.14% 119 24793 0.14% 120 25860 0.15% 121 26740 0.16% 122 27692 0.16% 123 29760 0.17% 124 30978 0.18% 125 31597 0.18% 126 33537 0.20% 127 35183 0.21% 128 36886 0.22% 129 37441 0.22% 130 38752 0.23% 131 40250 0.24% 132 43253 0.25% 133 45505 0.27% 134 48675 0.28% 135 51299 0.30% 136 55316 0.32% 137 59820 0.35% 138 64150 0.37% 139 70400 0.41% 140 76292 0.45% 141 86309 0.50% 142 97740 0.57% 143 113582 0.66% 144 135085 0.79% 145 164685 0.96% 146 210952 1.23% 147 296560 1.73% 148 463480 2.71% 149 956722 5.59% 150 4563427 26.67% 151 8610191 50.31% 17112734 reads passed initial QC criterion=sequence-density sequence-density=1.34 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=12 prefix-density=1.38 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=51.44 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.3 sequence=TAAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=1.35 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=9 prefix-density=1.52 prefix-fanout=2.1 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=13.35 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR7170619 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:21:40 Started mapping on | Feb 13 12:21:40 Finished on | Feb 13 12:23:42 Mapping speed, Million of reads per hour | 504.97 Number of input reads | 17112734 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16096885 Uniquely mapped reads % | 94.06% Average mapped length | 294.97 Number of splices: Total | 16637932 Number of splices: Annotated (sjdb) | 16318098 Number of splices: GT/AG | 16335901 Number of splices: GC/AG | 251050 Number of splices: AT/AC | 9904 Number of splices: Non-canonical | 41077 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 425725 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 34668 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 612562 612562 612562 N_multimapping 425725 425725 425725 N_noFeature 399008 15702370 466969 N_ambiguous 472844 777 145989 UnstrandedReadsAssigned:15225033 PositiveStrandReadsAssigned:393738 NegativeStrandReadsAssigned:15483927 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170619 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170619-trimmed-pair1.fastq SRR7170619-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,112,734 reads, 15,357,324 reads pseudoaligned [quant] estimated average fragment length: 270.611 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR7170619.ke.tsv 34699 SRR7170619.se.tsv 87100 total ==> SRR7170619.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.39 413 9.36986 Potri.005G024800.1.v4.1 1035 765.389 215 11.1424 Potri.004G059700.1.v4.1 961 691.445 22 1.26208 Potri.007G009000.2.v4.1 1416 1146.39 0 0 Potri.003G141000.2.v4.1 2943 2673.39 391.315 5.80612 Potri.016G087400.1.v4.1 270 73.623 1555 837.795 Potri.015G069301.1.v4.1 564 302.648 0 0 Potri.010G195200.1.v4.1 1773 1503.39 13 0.342999 Potri.012G127500.1.v4.1 977 707.427 187 10.4853 ==> SRR7170619.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 381 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 469 Potri.001G212900.v4.1 81 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 71 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170619 completed mapping pipeline successfully