Starting /dee2/code/volunteer_pipeline.sh SRR7170620 current disk space = 3092472467456 free memory = 1579391144 SRR7170620 SRAfilesize 358410df66fb6cbb64fc54e8cbb30ea6 SRR7170620.sra SRR7170620.sra file validated SRR7170620 is paired end SRR7170620 is conventional basespace SRR7170620 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170620_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.57275 28.0 18.0 32.0 18.0 33.0 2 31.54175 33.0 31.0 33.0 29.0 33.0 3 32.26725 33.0 33.0 33.0 30.0 34.0 4 32.1855 33.0 33.0 33.0 31.0 34.0 5 32.81825 33.0 33.0 34.0 32.0 34.0 6 36.85775 38.0 37.0 38.0 35.0 38.0 7 37.21625 38.0 38.0 38.0 36.0 38.0 8 37.33325 38.0 38.0 38.0 36.0 38.0 9 37.35925 38.0 38.0 38.0 37.0 38.0 10-14 37.407199999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.39635 38.0 38.0 38.0 37.0 38.0 20-24 37.50599999999999 38.0 38.0 38.0 37.6 38.0 25-29 37.4803 38.0 38.0 38.0 37.8 38.0 30-34 37.48885 38.0 38.0 38.0 37.6 38.0 35-39 37.45609999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.430749999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.3746 38.0 38.0 38.0 37.0 38.0 50-54 37.2818 38.0 38.0 38.0 36.8 38.0 55-59 37.14555 38.0 38.0 38.0 36.0 38.0 60-64 37.176399999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.072 38.0 38.0 38.0 36.0 38.0 70-74 37.0475 38.0 38.0 38.0 36.0 38.0 75-79 36.9058 38.0 38.0 38.0 35.6 38.0 80-84 36.8028 38.0 38.0 38.0 35.2 38.0 85-89 36.74995 38.0 38.0 38.0 34.8 38.0 90-94 36.54254999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.48945 38.0 38.0 38.0 34.0 38.0 100-104 36.36485 38.0 37.8 38.0 34.0 38.0 105-109 36.2438 38.0 37.2 38.0 33.8 38.0 110-114 35.949 38.0 37.0 38.0 32.6 38.0 115-119 35.7297 38.0 36.8 38.0 31.2 38.0 120-124 35.649649999999994 38.0 36.4 38.0 31.0 38.0 125-129 35.33515 38.0 36.0 38.0 29.4 38.0 130-134 34.93405 38.0 34.8 38.0 28.0 38.0 135-139 34.74204999999999 38.0 34.4 38.0 27.0 38.0 140-144 34.060649999999995 38.0 33.2 38.0 24.6 38.0 145-149 33.2027 38.0 33.0 38.0 20.2 38.0 150-151 28.822125 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 2.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 0.0 18 2.0 19 4.0 20 2.0 21 6.0 22 4.0 23 6.0 24 5.0 25 10.0 26 18.0 27 18.0 28 14.0 29 41.0 30 40.0 31 52.0 32 86.0 33 108.0 34 178.0 35 332.0 36 994.0 37 2072.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.98459958932238 16.529774127310063 11.627310061601642 36.85831622176591 2 17.625 27.175 38.574999999999996 16.625 3 15.024999999999999 32.275 27.175 25.525 4 21.224999999999998 37.175000000000004 22.3 19.3 5 19.32983245811453 37.23430857714429 24.006001500375092 19.42985746436609 6 14.875 36.375 25.924999999999997 22.825 7 11.899999999999999 19.675 46.6 21.825 8 17.9 21.025 28.675 32.4 9 16.35 22.475 31.25 29.925 10-14 18.91 29.965000000000003 26.855 24.27 15-19 19.595000000000002 28.970000000000002 27.845 23.59 20-24 19.165 29.659999999999997 28.125 23.05 25-29 19.64 29.14 27.310000000000002 23.91 30-34 19.08 28.78 27.735 24.404999999999998 35-39 19.13 28.560000000000002 28.28 24.03 40-44 19.439999999999998 28.945 28.09 23.525 45-49 19.66 29.304999999999996 27.189999999999998 23.845 50-54 20.169999999999998 29.185 27.555000000000003 23.09 55-59 19.375 29.549999999999997 27.315 23.76 60-64 19.25 28.804999999999996 27.744999999999997 24.2 65-69 19.855 28.89 28.015 23.24 70-74 19.48 28.595 27.839999999999996 24.085 75-79 19.585 28.625 28.21 23.580000000000002 80-84 19.650000000000002 28.18 27.755000000000003 24.415 85-89 20.26 28.78 27.389999999999997 23.57 90-94 19.515 28.23 28.315 23.94 95-99 19.400000000000002 28.71 28.485 23.405 100-104 20.080000000000002 28.505000000000003 27.865000000000002 23.549999999999997 105-109 20.215 28.199999999999996 27.925 23.66 110-114 20.28 28.07 27.74 23.91 115-119 20.495 28.28 27.57 23.655 120-124 19.794999999999998 28.215 28.1 23.89 125-129 19.905 28.49 27.255000000000003 24.349999999999998 130-134 20.48 28.365000000000002 28.000000000000004 23.155 135-139 20.64 28.735 27.400000000000002 23.225 140-144 20.78 27.825 27.644999999999996 23.75 145-149 20.369999999999997 28.46 27.465 23.705000000000002 150-151 20.775 28.212500000000002 27.55 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 4.0 25 5.5 26 7.5 27 9.0 28 15.5 29 22.0 30 23.5 31 31.5 32 43.0 33 53.0 34 65.5 35 84.0 36 100.5 37 126.5 38 150.5 39 178.0 40 208.5 41 225.0 42 247.0 43 255.5 44 263.5 45 262.0 46 255.0 47 246.0 48 222.0 49 204.5 50 171.5 51 123.5 52 97.5 53 71.5 54 48.5 55 45.5 56 34.5 57 26.5 58 22.0 59 15.5 60 11.5 61 7.0 62 3.0 63 1.5 64 1.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24280666330137 98.3 2 0.6309944472488642 1.25 3 0.0757193336698637 0.22499999999999998 4 0.025239777889954566 0.1 5 0.025239777889954566 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.7749999999999999 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.7999999999999998 0.0 0.0 0.0 0.0 118-119 1.8875 0.0 0.0 0.0 0.0 120-121 1.9874999999999998 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.4124999999999996 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.5999999999999996 0.0 0.0 0.0 0.0 134-135 3.925 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138-139 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGAGG 10 0.0068343505 144.975 8 TCCAGAG 10 0.0068343505 144.975 7 AAAAGTT 10 0.0068343505 144.975 2 GGTAGGG 10 0.0068343505 144.975 5 GTAGGGA 10 0.0068343505 144.975 6 >>END_MODULE SRR7170620 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170620_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86225 33.0 33.0 34.0 32.0 34.0 2 33.00225 33.0 33.0 34.0 32.0 34.0 3 32.9605 34.0 33.0 34.0 32.0 34.0 4 32.954 34.0 33.0 34.0 32.0 34.0 5 32.951 34.0 33.0 34.0 32.0 34.0 6 37.07675 38.0 38.0 38.0 36.0 38.0 7 37.11825 38.0 38.0 38.0 37.0 38.0 8 37.1755 38.0 38.0 38.0 37.0 38.0 9 37.142 38.0 38.0 38.0 37.0 38.0 10-14 37.1179 38.0 38.0 38.0 37.0 38.0 15-19 37.0916 38.0 38.0 38.0 37.0 38.0 20-24 37.02445 38.0 38.0 38.0 37.0 38.0 25-29 37.05775 38.0 38.0 38.0 37.0 38.0 30-34 37.066250000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.02855 38.0 38.0 38.0 37.0 38.0 40-44 36.9918 38.0 38.0 38.0 37.0 38.0 45-49 36.930049999999994 38.0 38.0 38.0 36.4 38.0 50-54 36.8158 38.0 38.0 38.0 36.0 38.0 55-59 36.80905 38.0 38.0 38.0 36.0 38.0 60-64 36.7913 38.0 38.0 38.0 36.0 38.0 65-69 36.70625 38.0 38.0 38.0 35.4 38.0 70-74 36.6897 38.0 38.0 38.0 35.6 38.0 75-79 36.6465 38.0 38.0 38.0 35.6 38.0 80-84 36.563500000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.4561 38.0 38.0 38.0 35.0 38.0 90-94 36.27095 38.0 38.0 38.0 34.0 38.0 95-99 36.15745 38.0 38.0 38.0 34.0 38.0 100-104 35.990449999999996 38.0 37.6 38.0 33.4 38.0 105-109 35.88225 38.0 37.2 38.0 33.0 38.0 110-114 35.68495 38.0 37.0 38.0 32.2 38.0 115-119 35.48135 38.0 37.0 38.0 31.0 38.0 120-124 35.25664999999999 38.0 36.4 38.0 30.6 38.0 125-129 34.82015 38.0 35.8 38.0 27.8 38.0 130-134 34.3501 38.0 34.2 38.0 26.0 38.0 135-139 33.9631 38.0 33.2 38.0 24.2 38.0 140-144 33.528949999999995 38.0 33.0 38.0 21.8 38.0 145-149 32.6049 38.0 33.0 38.0 13.8 38.0 150-151 27.572125 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 13.0 4 3.0 5 4.0 6 1.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 6.0 13 4.0 14 3.0 15 4.0 16 3.0 17 4.0 18 6.0 19 5.0 20 5.0 21 1.0 22 6.0 23 6.0 24 9.0 25 15.0 26 17.0 27 15.0 28 28.0 29 34.0 30 38.0 31 63.0 32 70.0 33 111.0 34 175.0 35 274.0 36 721.0 37 2343.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.975 15.75 13.025 31.25 2 21.6 22.825 38.85 16.725 3 19.3 26.8 32.125 21.775 4 25.4 34.55 20.325 19.725 5 22.025 36.925000000000004 23.125 17.925 6 18.11811811811812 37.712712712712715 25.725725725725724 18.443443443443446 7 16.437327995997 15.861896422316738 47.285464098073554 20.41531148361271 8 17.49249249249249 21.746746746746748 30.105105105105107 30.655655655655657 9 22.892169126845133 22.842131598699027 28.32124093069802 25.94445834375782 10-14 22.260034030627565 28.870983885496948 27.184466019417474 21.684516064458013 15-19 23.39637746422496 27.429200440308215 28.164715300710498 21.00970679475633 20-24 22.820974682277594 27.849494646252378 28.2597818472931 21.069748824176923 25-29 23.029969480162105 28.248361434932708 27.793065492570168 20.92860359233502 30-34 23.317488116087066 28.261195896922693 28.081060795596695 20.340255191393545 35-39 23.304809087724564 28.058850022519145 27.913726667667515 20.722614222088776 40-44 22.61100265305101 28.042248585873754 28.692996946488464 20.653751814586773 45-49 22.760484435992392 27.8300470423381 28.410569512561306 20.998899009108197 50-54 22.97067360624562 27.850065058552698 28.28045240716645 20.89880892803523 55-59 23.41106996296667 27.399659693724352 27.980182163947553 21.209088179361427 60-64 23.121965867574197 27.28091687102748 28.487062709574097 21.110054551824234 65-69 23.14388633179908 27.516509905943565 28.352011206724036 20.98759255553332 70-74 23.08500525341472 27.84309801370891 28.45349477160154 20.61840196127483 75-79 23.369021412847708 28.026816089653796 27.976786071642984 20.627376425855513 80-84 23.071149804863406 27.814470129090363 28.44991494045832 20.66446512558791 85-89 23.89672770939658 27.44921445011508 28.17472230561393 20.479335534874412 90-94 23.722792094070552 27.705779334500875 28.45634225669252 20.115086314736054 95-99 23.330164606994547 28.20333216590784 27.9031370390754 20.563366188022215 100-104 23.547660745559167 28.186139604703524 27.920940705529144 20.345258944208155 105-109 23.821439295365828 27.58482634370934 27.950155139625664 20.64357922129917 110-114 23.739926923269433 28.049451924520746 28.294709444917167 19.915911707292658 115-119 23.69514086973928 27.79862883450933 28.3290797177601 20.17715057799129 120-124 23.80523444928189 28.264024420757643 27.733573537506878 20.197167592453585 125-129 23.950357804133514 27.90371816043637 27.838662863433917 20.307261171996196 130-134 24.532078870983888 28.665799219297366 27.174457011310178 19.627664898408568 135-139 24.911156714550277 27.939336303118274 27.939336303118274 19.210170679213174 140-144 24.29536921151439 27.879849812265334 28.030037546933666 19.79474342928661 145-149 23.836918459229615 28.134067033516757 28.194097048524263 19.834917458729365 150-151 24.74368592148037 27.59439859964991 27.7569392348087 19.904976244061015 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 1.5 20 1.5 21 1.0 22 2.0 23 4.0 24 5.5 25 5.0 26 6.5 27 10.5 28 13.5 29 12.5 30 13.5 31 21.0 32 31.0 33 40.5 34 47.5 35 64.0 36 88.0 37 106.5 38 130.0 39 160.0 40 187.5 41 220.0 42 236.0 43 244.0 44 269.0 45 286.0 46 288.0 47 266.5 48 229.5 49 198.0 50 167.0 51 141.5 52 107.0 53 83.5 54 76.0 55 56.0 56 51.0 57 45.0 58 26.5 59 18.5 60 10.5 61 5.5 62 5.5 63 3.0 64 2.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.075 8 0.1 9 0.075 10-14 0.09 15-19 0.06999999999999999 20-24 0.06999999999999999 25-29 0.065 30-34 0.075 35-39 0.08499999999999999 40-44 0.11499999999999999 45-49 0.09 50-54 0.09 55-59 0.09 60-64 0.095 65-69 0.06 70-74 0.065 75-79 0.06 80-84 0.06999999999999999 85-89 0.06999999999999999 90-94 0.075 95-99 0.065 100-104 0.075 105-109 0.09 110-114 0.105 115-119 0.08499999999999999 120-124 0.08499999999999999 125-129 0.08499999999999999 130-134 0.09 135-139 0.105 140-144 0.125 145-149 0.05 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16603487490522 98.1 2 0.6065200909780136 1.2 3 0.20217336365933786 0.6 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.7749999999999999 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.8625 0.0 0.0 0.0 0.0 120-121 1.9625 0.0 0.0 0.0 0.0 122-123 2.125 0.0 0.0 0.0 0.0 124-125 2.4124999999999996 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.5999999999999996 0.0 0.0 0.0 0.0 134-135 3.925 0.0 0.0 0.0 0.0 136-137 4.175 0.0 0.0 0.0 0.0 138-139 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGAGT 10 0.006830828 145.0 7 GCATTCA 10 0.006830828 145.0 4 >>END_MODULE Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850419 spots for SRR7170620.sra Written 850419 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra Read 850411 spots for SRR7170620.sra Written 850411 spots for SRR7170620.sra SRR ids: ['SRR7170620.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_da4p37xz SRR7170620.sra spots: 17008228 blocks: [[1, 850411], [850412, 1700822], [1700823, 2551233], [2551234, 3401644], [3401645, 4252055], [4252056, 5102466], [5102467, 5952877], [5952878, 6803288], [6803289, 7653699], [7653700, 8504110], [8504111, 9354521], [9354522, 10204932], [10204933, 11055343], [11055344, 11905754], [11905755, 12756165], [12756166, 13606576], [13606577, 14456987], [14456988, 15307398], [15307399, 16157809], [16157810, 17008228]] SRR7170620 file size 5741830 SRR7170620 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170620 SRR7170620_1.fastq SRR7170620_2.fastq Input file: SRR7170620_1.fastq Paired file: SRR7170620_2.fastq trimmed: SRR7170620-trimmed-pair1.fastq, SRR7170620-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:18:55 2025 >> started Thu Feb 13 12:19:14 2025 >> done (18.515s) 17008228 read pairs processed; of these: 19217 ( 0.11%) short read pairs filtered out after trimming by size control 21118 ( 0.12%) empty read pairs filtered out after trimming by size control 16967893 (99.76%) read pairs available; of these: 8847932 (52.15%) trimmed read pairs available after processing 8119961 (47.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 8 0.00% 21 10 0.00% 22 7 0.00% 23 7 0.00% 24 6 0.00% 25 7 0.00% 26 12 0.00% 27 11 0.00% 28 5 0.00% 29 8 0.00% 30 12 0.00% 31 11 0.00% 32 13 0.00% 33 10 0.00% 34 16 0.00% 35 20 0.00% 36 21 0.00% 37 8 0.00% 38 26 0.00% 39 27 0.00% 40 33 0.00% 41 29 0.00% 42 31 0.00% 43 38 0.00% 44 39 0.00% 45 44 0.00% 46 46 0.00% 47 57 0.00% 48 52 0.00% 49 73 0.00% 50 80 0.00% 51 94 0.00% 52 107 0.00% 53 93 0.00% 54 99 0.00% 55 130 0.00% 56 144 0.00% 57 154 0.00% 58 164 0.00% 59 198 0.00% 60 219 0.00% 61 260 0.00% 62 289 0.00% 63 346 0.00% 64 342 0.00% 65 357 0.00% 66 444 0.00% 67 440 0.00% 68 541 0.00% 69 573 0.00% 70 696 0.00% 71 770 0.00% 72 884 0.01% 73 1020 0.01% 74 1102 0.01% 75 1237 0.01% 76 1397 0.01% 77 1590 0.01% 78 1588 0.01% 79 1723 0.01% 80 1898 0.01% 81 2164 0.01% 82 2540 0.01% 83 2971 0.02% 84 3989 0.02% 85 4551 0.03% 86 4920 0.03% 87 4988 0.03% 88 5382 0.03% 89 5854 0.03% 90 6075 0.04% 91 6398 0.04% 92 6900 0.04% 93 7485 0.04% 94 8063 0.05% 95 8514 0.05% 96 8943 0.05% 97 9401 0.06% 98 9858 0.06% 99 10346 0.06% 100 10764 0.06% 101 11511 0.07% 102 12214 0.07% 103 13309 0.08% 104 13809 0.08% 105 14421 0.08% 106 14994 0.09% 107 15396 0.09% 108 15856 0.09% 109 16816 0.10% 110 17238 0.10% 111 18008 0.11% 112 19032 0.11% 113 19899 0.12% 114 21042 0.12% 115 21710 0.13% 116 22352 0.13% 117 23239 0.14% 118 24089 0.14% 119 24486 0.14% 120 25666 0.15% 121 26550 0.16% 122 27694 0.16% 123 29483 0.17% 124 30594 0.18% 125 32013 0.19% 126 33147 0.20% 127 35250 0.21% 128 36876 0.22% 129 37356 0.22% 130 39321 0.23% 131 41065 0.24% 132 43401 0.26% 133 46410 0.27% 134 49863 0.29% 135 53716 0.32% 136 57298 0.34% 137 62830 0.37% 138 68766 0.41% 139 75700 0.45% 140 83335 0.49% 141 94737 0.56% 142 108214 0.64% 143 126343 0.74% 144 150245 0.89% 145 185689 1.09% 146 236955 1.40% 147 330596 1.95% 148 517133 3.05% 149 1044205 6.15% 150 4628280 27.28% 151 8119961 47.85% 16967893 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.43 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=60.22 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.4 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=14 prefix-density=0.60 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=30.35 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=10.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170620 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:20:04 Started mapping on | Feb 13 12:20:04 Finished on | Feb 13 12:22:00 Mapping speed, Million of reads per hour | 526.59 Number of input reads | 16967893 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16010076 Uniquely mapped reads % | 94.36% Average mapped length | 294.73 Number of splices: Total | 16055877 Number of splices: Annotated (sjdb) | 15673988 Number of splices: GT/AG | 15767384 Number of splices: GC/AG | 232204 Number of splices: AT/AC | 9447 Number of splices: Non-canonical | 46842 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 459488 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 33501 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.68% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 514339 514339 514339 N_multimapping 459488 459488 459488 N_noFeature 663642 15697842 756047 N_ambiguous 344550 1200 124268 UnstrandedReadsAssigned:15001884 PositiveStrandReadsAssigned:311034 NegativeStrandReadsAssigned:15129761 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170620 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170620-trimmed-pair1.fastq SRR7170620-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,967,893 reads, 15,006,049 reads pseudoaligned [quant] estimated average fragment length: 273.683 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR7170620.ke.tsv 34699 SRR7170620.se.tsv 87100 total ==> SRR7170620.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.32 2276 72.9046 Potri.005G024800.1.v4.1 1035 762.317 449 32.9282 Potri.004G059700.1.v4.1 961 688.4 3 0.243634 Potri.007G009000.2.v4.1 1416 1143.32 0 0 Potri.003G141000.2.v4.1 2943 2670.32 585.66 12.2614 Potri.016G087400.1.v4.1 270 73.2742 751 572.988 Potri.015G069301.1.v4.1 564 300.716 0 0 Potri.010G195200.1.v4.1 1773 1500.32 499 18.5941 Potri.012G127500.1.v4.1 977 704.373 356 28.2556 ==> SRR7170620.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 259 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 275 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170620 completed mapping pipeline successfully