Starting /dee2/code/volunteer_pipeline.sh SRR7170621 current disk space = 2818774749184 free memory = 1463779888 SRR7170621 SRAfilesize 9e31043e502f0fc64e7687fe50eae389 SRR7170621.sra SRR7170621.sra file validated SRR7170621 is paired end SRR7170621 is conventional basespace SRR7170621 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170621_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.2615 30.0 18.0 32.0 18.0 33.0 2 31.73375 33.0 31.0 33.0 29.0 33.0 3 32.40625 33.0 33.0 33.0 31.0 34.0 4 32.777 33.0 33.0 34.0 32.0 34.0 5 33.04125 33.0 33.0 34.0 32.0 34.0 6 37.0455 38.0 37.0 38.0 36.0 38.0 7 37.23475 38.0 38.0 38.0 36.0 38.0 8 37.37725 38.0 38.0 38.0 37.0 38.0 9 37.37025 38.0 38.0 38.0 37.0 38.0 10-14 37.37995 38.0 38.0 38.0 37.0 38.0 15-19 37.3572 38.0 38.0 38.0 37.0 38.0 20-24 37.4611 38.0 38.0 38.0 37.2 38.0 25-29 37.525800000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.47025 38.0 38.0 38.0 37.6 38.0 35-39 37.4702 38.0 38.0 38.0 37.2 38.0 40-44 37.43365 38.0 38.0 38.0 37.0 38.0 45-49 37.44735 38.0 38.0 38.0 37.0 38.0 50-54 37.24615 38.0 38.0 38.0 36.8 38.0 55-59 37.17255 38.0 38.0 38.0 36.0 38.0 60-64 37.18065 38.0 38.0 38.0 36.0 38.0 65-69 37.10745 38.0 38.0 38.0 36.0 38.0 70-74 37.04765 38.0 38.0 38.0 36.0 38.0 75-79 36.913850000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.7786 38.0 38.0 38.0 35.0 38.0 85-89 36.677949999999996 38.0 38.0 38.0 34.8 38.0 90-94 36.60135 38.0 38.0 38.0 34.2 38.0 95-99 36.41305 38.0 38.0 38.0 34.0 38.0 100-104 36.2496 38.0 37.6 38.0 33.8 38.0 105-109 36.10105 38.0 37.0 38.0 33.2 38.0 110-114 35.91805 38.0 37.0 38.0 32.4 38.0 115-119 35.66029999999999 38.0 36.8 38.0 31.0 38.0 120-124 35.49385 38.0 36.0 38.0 30.6 38.0 125-129 35.50665 38.0 36.0 38.0 31.0 38.0 130-134 35.202200000000005 38.0 35.6 38.0 29.8 38.0 135-139 34.668 38.0 34.6 38.0 27.6 38.0 140-144 33.818400000000004 38.0 33.8 38.0 23.0 38.0 145-149 33.11515 38.0 33.0 38.0 20.0 38.0 150-151 28.504875 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 2.0 17 1.0 18 4.0 19 9.0 20 3.0 21 6.0 22 4.0 23 7.0 24 9.0 25 21.0 26 15.0 27 17.0 28 20.0 29 26.0 30 39.0 31 54.0 32 67.0 33 105.0 34 187.0 35 359.0 36 847.0 37 2195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.83059418457648 17.319848293299618 14.867256637168142 33.98230088495575 2 18.8 25.55 38.05 17.599999999999998 3 15.25 32.0 29.349999999999998 23.400000000000002 4 19.475 36.425000000000004 23.45 20.65 5 20.905226306576644 37.23430857714429 23.20580145036259 18.65466366591648 6 15.925 37.35 24.9 21.825 7 12.6 20.225 45.550000000000004 21.625 8 18.425 21.15 27.975 32.45 9 16.925 23.625 30.175 29.275000000000002 10-14 19.13 30.819999999999997 26.674999999999997 23.375 15-19 19.32 29.775000000000002 27.11 23.794999999999998 20-24 19.455 29.675 27.88 22.99 25-29 19.915 30.31 27.055 22.720000000000002 30-34 19.34 30.064999999999998 27.355 23.24 35-39 19.345000000000002 29.49 27.505000000000003 23.66 40-44 19.650000000000002 29.64 26.924999999999997 23.785 45-49 20.075000000000003 29.830000000000002 26.369999999999997 23.724999999999998 50-54 19.900000000000002 29.56 26.724999999999998 23.815 55-59 19.45 29.53 27.189999999999998 23.830000000000002 60-64 19.139999999999997 29.189999999999998 27.16 24.51 65-69 19.689999999999998 29.14 27.49 23.68 70-74 20.080000000000002 28.825 27.715 23.380000000000003 75-79 19.595000000000002 29.885 27.07 23.45 80-84 19.545 29.09 26.895000000000003 24.47 85-89 20.24 28.555000000000003 27.67 23.535 90-94 20.195 28.89 26.950000000000003 23.965 95-99 20.315 28.095 27.815 23.775 100-104 19.55 28.749999999999996 27.445000000000004 24.255 105-109 19.99 27.83 27.794999999999998 24.385 110-114 20.69 28.050000000000004 27.639999999999997 23.62 115-119 20.225 28.360000000000003 27.665 23.75 120-124 20.65 28.925 26.490000000000002 23.935000000000002 125-129 20.04 28.060000000000002 27.615000000000002 24.285 130-134 21.05 28.1 27.200000000000003 23.65 135-139 20.75 28.050000000000004 27.05 24.15 140-144 20.94 28.439999999999998 26.505000000000003 24.115000000000002 145-149 20.825 28.285 26.619999999999997 24.27 150-151 21.1125 28.237499999999997 26.737499999999997 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.5 21 2.0 22 1.5 23 4.5 24 6.0 25 5.5 26 6.5 27 9.5 28 15.5 29 26.0 30 38.5 31 44.5 32 52.0 33 72.5 34 84.0 35 96.0 36 106.5 37 123.5 38 169.5 39 190.0 40 181.5 41 199.0 42 222.5 43 224.0 44 236.0 45 231.5 46 217.5 47 219.0 48 211.0 49 187.5 50 153.5 51 138.0 52 115.5 53 82.5 54 74.5 55 67.0 56 49.0 57 38.0 58 32.5 59 21.5 60 13.0 61 10.0 62 6.5 63 4.0 64 2.5 65 1.0 66 0.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.375 #Duplication Level Percentage of deduplicated Percentage of total 1 97.9204107830552 95.35 2 1.6944801026957637 3.3000000000000003 3 0.23106546854942236 0.675 4 0.12836970474967907 0.5 5 0.0 0.0 6 0.0 0.0 7 0.025673940949935817 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.4875 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.1500000000000004 0.0 0.0 0.0 0.0 124-125 3.4000000000000004 0.0 0.0 0.0 0.0 126-127 3.5999999999999996 0.0 0.0 0.0 0.0 128-129 3.95 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.55 0.0 0.0 0.0 0.0 134-135 4.9 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170621 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170621_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9855 33.0 33.0 34.0 32.0 34.0 2 33.07975 34.0 33.0 34.0 32.0 34.0 3 33.06825 34.0 33.0 34.0 32.0 34.0 4 33.0465 34.0 33.0 34.0 32.0 34.0 5 33.01225 34.0 33.0 34.0 33.0 34.0 6 37.24425 38.0 38.0 38.0 37.0 38.0 7 37.29575 38.0 38.0 38.0 37.0 38.0 8 37.2915 38.0 38.0 38.0 37.0 38.0 9 37.2355 38.0 38.0 38.0 37.0 38.0 10-14 37.28335 38.0 38.0 38.0 37.2 38.0 15-19 37.2447 38.0 38.0 38.0 37.0 38.0 20-24 37.211549999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.18195 38.0 38.0 38.0 37.0 38.0 30-34 37.1473 38.0 38.0 38.0 37.0 38.0 35-39 37.146100000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.081450000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.05605 38.0 38.0 38.0 37.0 38.0 50-54 36.971849999999996 38.0 38.0 38.0 36.6 38.0 55-59 36.9644 38.0 38.0 38.0 36.6 38.0 60-64 36.9444 38.0 38.0 38.0 36.0 38.0 65-69 36.9153 38.0 38.0 38.0 36.0 38.0 70-74 36.91105 38.0 38.0 38.0 36.0 38.0 75-79 36.8214 38.0 38.0 38.0 36.0 38.0 80-84 36.708349999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.6477 38.0 38.0 38.0 36.0 38.0 90-94 36.5221 38.0 38.0 38.0 35.0 38.0 95-99 36.34805 38.0 38.0 38.0 34.4 38.0 100-104 36.2634 38.0 38.0 38.0 34.0 38.0 105-109 36.2129 38.0 38.0 38.0 34.0 38.0 110-114 35.9924 38.0 37.6 38.0 33.4 38.0 115-119 35.77845 38.0 37.0 38.0 33.0 38.0 120-124 35.74105000000001 38.0 37.0 38.0 33.0 38.0 125-129 35.44520000000001 38.0 36.6 38.0 31.4 38.0 130-134 34.87055 38.0 36.0 38.0 29.2 38.0 135-139 34.580149999999996 38.0 35.4 38.0 28.2 38.0 140-144 34.006299999999996 38.0 34.0 38.0 24.2 38.0 145-149 32.8141 38.0 33.0 38.0 16.6 38.0 150-151 27.280375 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 6.0 4 5.0 5 3.0 6 1.0 7 3.0 8 1.0 9 0.0 10 4.0 11 2.0 12 4.0 13 3.0 14 2.0 15 5.0 16 1.0 17 8.0 18 4.0 19 11.0 20 7.0 21 3.0 22 14.0 23 2.0 24 8.0 25 11.0 26 12.0 27 14.0 28 17.0 29 19.0 30 27.0 31 50.0 32 70.0 33 85.0 34 135.0 35 227.0 36 682.0 37 2549.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.800000000000004 15.9 15.725 29.575000000000003 2 24.0 24.075 34.849999999999994 17.075000000000003 3 20.849999999999998 25.95 31.924999999999997 21.275 4 24.125 34.5 21.25 20.125 5 23.075000000000003 37.9 21.075 17.95 6 17.65 38.3 24.85 19.2 7 17.125 17.299999999999997 43.425000000000004 22.15 8 20.775 22.725 26.424999999999997 30.075000000000003 9 23.5 23.275000000000002 27.400000000000002 25.825 10-14 22.939999999999998 28.27 26.83 21.959999999999997 15-19 22.99 27.83 27.815 21.365000000000002 20-24 23.580000000000002 27.275 28.415000000000003 20.73 25-29 22.895 28.044999999999998 28.26 20.8 30-34 23.150000000000002 28.249999999999996 27.474999999999998 21.125 35-39 23.23 28.17 27.715 20.885 40-44 23.330000000000002 28.04 27.665 20.965 45-49 22.665 28.499999999999996 27.58 21.255 50-54 23.355 27.74 28.1 20.805 55-59 23.53 27.375 28.095 21.0 60-64 23.145 27.765 27.855 21.235 65-69 23.785 26.82 28.005000000000003 21.39 70-74 23.865 28.205000000000002 27.075 20.855 75-79 23.080000000000002 28.79 27.034999999999997 21.095 80-84 23.73 28.13 27.325 20.815 85-89 23.985 28.175 27.685 20.155 90-94 24.85 27.779999999999998 26.91 20.46 95-99 23.685000000000002 28.110000000000003 27.355 20.849999999999998 100-104 23.445 27.644999999999996 28.51 20.4 105-109 24.18 27.85 27.779999999999998 20.19 110-114 23.44 28.505000000000003 27.615000000000002 20.44 115-119 24.26 28.189999999999998 27.58 19.97 120-124 24.38 27.96 27.665 19.994999999999997 125-129 24.73 28.105000000000004 27.815 19.35 130-134 24.67 27.365000000000002 27.985 19.98 135-139 24.63 27.36 27.765 20.244999999999997 140-144 24.224999999999998 28.095 27.834999999999997 19.845 145-149 25.025 27.965 27.57 19.439999999999998 150-151 24.975 26.737499999999997 28.425 19.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 1.0 24 1.0 25 1.0 26 2.5 27 5.0 28 6.5 29 7.0 30 15.5 31 25.0 32 30.0 33 40.0 34 49.5 35 64.0 36 86.0 37 108.0 38 144.0 39 159.5 40 160.5 41 197.5 42 225.0 43 232.5 44 259.0 45 286.5 46 285.0 47 262.5 48 233.5 49 205.0 50 177.0 51 145.0 52 112.5 53 93.5 54 92.0 55 89.0 56 65.5 57 36.5 58 25.0 59 21.5 60 14.0 61 11.0 62 11.0 63 5.5 64 1.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.32861918230907 95.6 2 1.131396245821548 2.1999999999999997 3 0.282849061455387 0.8250000000000001 4 0.05142710208279763 0.2 5 0.07714065312419646 0.375 6 0.07714065312419646 0.44999999999999996 7 0.05142710208279763 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 6 0.15 No Hit CATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 6 0.15 No Hit TTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACC 6 0.15 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 5 0.125 No Hit CCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGG 5 0.125 No Hit CATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.4875 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.0250000000000004 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.1500000000000004 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.575 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.1375 0.0 0.0 0.0 0.0 132-133 4.45 0.0 0.0 0.0 0.0 134-135 4.824999999999999 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537621 spots for SRR7170621.sra Written 537621 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra Read 537602 spots for SRR7170621.sra Written 537602 spots for SRR7170621.sra SRR ids: ['SRR7170621.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8stl2aps SRR7170621.sra spots: 10752059 blocks: [[1, 537602], [537603, 1075204], [1075205, 1612806], [1612807, 2150408], [2150409, 2688010], [2688011, 3225612], [3225613, 3763214], [3763215, 4300816], [4300817, 4838418], [4838419, 5376020], [5376021, 5913622], [5913623, 6451224], [6451225, 6988826], [6988827, 7526428], [7526429, 8064030], [8064031, 8601632], [8601633, 9139234], [9139235, 9676836], [9676837, 10214438], [10214439, 10752059]] SRR7170621 file size 3621819 SRR7170621 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170621 SRR7170621_1.fastq SRR7170621_2.fastq Input file: SRR7170621_1.fastq Paired file: SRR7170621_2.fastq trimmed: SRR7170621-trimmed-pair1.fastq, SRR7170621-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:57:10 2025 >> started Thu Apr 10 15:57:21 2025 >> done (11.136s) 10752059 read pairs processed; of these: 11674 ( 0.11%) short read pairs filtered out after trimming by size control 32439 ( 0.30%) empty read pairs filtered out after trimming by size control 10707946 (99.59%) read pairs available; of these: 5682097 (53.06%) trimmed read pairs available after processing 5025849 (46.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 3 0.00% 21 11 0.00% 22 7 0.00% 23 6 0.00% 24 9 0.00% 25 8 0.00% 26 11 0.00% 27 11 0.00% 28 14 0.00% 29 10 0.00% 30 6 0.00% 31 10 0.00% 32 9 0.00% 33 14 0.00% 34 18 0.00% 35 13 0.00% 36 14 0.00% 37 28 0.00% 38 16 0.00% 39 23 0.00% 40 20 0.00% 41 23 0.00% 42 36 0.00% 43 32 0.00% 44 34 0.00% 45 41 0.00% 46 53 0.00% 47 69 0.00% 48 82 0.00% 49 82 0.00% 50 89 0.00% 51 96 0.00% 52 88 0.00% 53 97 0.00% 54 126 0.00% 55 113 0.00% 56 132 0.00% 57 149 0.00% 58 180 0.00% 59 206 0.00% 60 201 0.00% 61 241 0.00% 62 280 0.00% 63 304 0.00% 64 331 0.00% 65 370 0.00% 66 382 0.00% 67 424 0.00% 68 482 0.00% 69 544 0.01% 70 660 0.01% 71 673 0.01% 72 833 0.01% 73 959 0.01% 74 1079 0.01% 75 1233 0.01% 76 1748 0.02% 77 1983 0.02% 78 1580 0.01% 79 1779 0.02% 80 1848 0.02% 81 2043 0.02% 82 2302 0.02% 83 2706 0.03% 84 3492 0.03% 85 4199 0.04% 86 4400 0.04% 87 4566 0.04% 88 4703 0.04% 89 5023 0.05% 90 5273 0.05% 91 5494 0.05% 92 5941 0.06% 93 6431 0.06% 94 6753 0.06% 95 7041 0.07% 96 7508 0.07% 97 7775 0.07% 98 8065 0.08% 99 8404 0.08% 100 8956 0.08% 101 9268 0.09% 102 9823 0.09% 103 10532 0.10% 104 10949 0.10% 105 11744 0.11% 106 12320 0.12% 107 12416 0.12% 108 12826 0.12% 109 13280 0.12% 110 13774 0.13% 111 14220 0.13% 112 15003 0.14% 113 15772 0.15% 114 16438 0.15% 115 16507 0.15% 116 17116 0.16% 117 17481 0.16% 118 18306 0.17% 119 18238 0.17% 120 19006 0.18% 121 19377 0.18% 122 19956 0.19% 123 21056 0.20% 124 21975 0.21% 125 22719 0.21% 126 23967 0.22% 127 24136 0.23% 128 25240 0.24% 129 26191 0.24% 130 27264 0.25% 131 28542 0.27% 132 30032 0.28% 133 31893 0.30% 134 33664 0.31% 135 35305 0.33% 136 38041 0.36% 137 40712 0.38% 138 44009 0.41% 139 47724 0.45% 140 52754 0.49% 141 58454 0.55% 142 66045 0.62% 143 76140 0.71% 144 91097 0.85% 145 112607 1.05% 146 144795 1.35% 147 204427 1.91% 148 326207 3.05% 149 668722 6.25% 150 2903015 27.11% 151 5025849 46.94% 10707946 reads passed initial QC criterion=sequence-density sequence-density=1.61 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=1.50 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=83.46 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.9 sequence=TTTTTTGGATTTTTTCCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCCTATTGGGATACCTCCCGTCCATTAAGTTAGGGCTTTCA criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=24 prefix-density=0.71 prefix-fanout=2.1 sequence=CAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=74.62 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.4 sequence=ACACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA SRR7170621 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:58:08 Started mapping on | Apr 10 15:58:08 Finished on | Apr 10 16:00:18 Mapping speed, Million of reads per hour | 296.53 Number of input reads | 10707946 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9556887 Uniquely mapped reads % | 89.25% Average mapped length | 293.92 Number of splices: Total | 9049299 Number of splices: Annotated (sjdb) | 8843999 Number of splices: GT/AG | 8877469 Number of splices: GC/AG | 134204 Number of splices: AT/AC | 6614 Number of splices: Non-canonical | 31012 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 247424 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 11412 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.28% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 914373 914373 914373 N_multimapping 247424 247424 247424 N_noFeature 290783 9270244 349949 N_ambiguous 310859 700 83033 UnstrandedReadsAssigned:8955245 PositiveStrandReadsAssigned:285943 NegativeStrandReadsAssigned:9123905 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170621 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170621-trimmed-pair1.fastq SRR7170621-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,707,946 reads, 9,004,789 reads pseudoaligned [quant] estimated average fragment length: 256.885 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR7170621.ke.tsv 34699 SRR7170621.se.tsv 87100 total ==> SRR7170621.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.11 562 23.1586 Potri.005G024800.1.v4.1 1035 779.115 185 17.2417 Potri.004G059700.1.v4.1 961 705.131 2 0.205954 Potri.007G009000.2.v4.1 1416 1160.11 0 0 Potri.003G141000.2.v4.1 2943 2687.11 385.427 10.4152 Potri.016G087400.1.v4.1 270 77.0024 574 541.275 Potri.015G069301.1.v4.1 564 314.165 0 0 Potri.010G195200.1.v4.1 1773 1517.11 44 2.10593 Potri.012G127500.1.v4.1 977 721.125 45 4.53119 ==> SRR7170621.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 209 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 50 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170621 completed mapping pipeline successfully