Starting /dee2/code/volunteer_pipeline.sh SRR7170622 current disk space = 2818822946816 free memory = 1463937132 SRR7170622 SRAfilesize 3d2475022b755bd40ec5f7d6a7707ad6 SRR7170622.sra SRR7170622.sra file validated SRR7170622 is paired end SRR7170622 is conventional basespace SRR7170622 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170622_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.31675 32.0 25.0 33.0 18.0 33.0 2 30.75525 31.0 30.0 33.0 27.0 33.0 3 32.21 33.0 33.0 33.0 29.0 34.0 4 32.66275 33.0 33.0 33.0 32.0 34.0 5 32.9645 33.0 33.0 34.0 32.0 34.0 6 37.15825 38.0 38.0 38.0 36.0 38.0 7 37.40975 38.0 38.0 38.0 37.0 38.0 8 37.45775 38.0 38.0 38.0 37.0 38.0 9 37.4005 38.0 38.0 38.0 37.0 38.0 10-14 37.462199999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.4544 38.0 38.0 38.0 37.4 38.0 20-24 37.52855 38.0 38.0 38.0 38.0 38.0 25-29 37.540949999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.48195 38.0 38.0 38.0 38.0 38.0 35-39 37.48415 38.0 38.0 38.0 37.8 38.0 40-44 37.45205 38.0 38.0 38.0 37.4 38.0 45-49 37.414049999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.3366 38.0 38.0 38.0 37.0 38.0 55-59 37.2481 38.0 38.0 38.0 36.8 38.0 60-64 37.18095 38.0 38.0 38.0 36.2 38.0 65-69 37.1514 38.0 38.0 38.0 36.0 38.0 70-74 37.10105 38.0 38.0 38.0 36.0 38.0 75-79 37.048649999999995 38.0 38.0 38.0 35.8 38.0 80-84 36.9806 38.0 38.0 38.0 36.0 38.0 85-89 36.9003 38.0 38.0 38.0 35.4 38.0 90-94 36.71225 38.0 38.0 38.0 34.8 38.0 95-99 36.62904999999999 38.0 38.0 38.0 34.4 38.0 100-104 36.450100000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.31855 38.0 37.6 38.0 33.8 38.0 110-114 36.15265 38.0 37.0 38.0 33.2 38.0 115-119 35.8543 38.0 37.0 38.0 31.8 38.0 120-124 35.70995 38.0 36.2 38.0 31.0 38.0 125-129 35.680350000000004 38.0 36.0 38.0 31.0 38.0 130-134 35.363600000000005 38.0 35.6 38.0 30.0 38.0 135-139 35.025400000000005 38.0 35.2 38.0 28.4 38.0 140-144 34.1947 38.0 33.8 38.0 25.6 38.0 145-149 33.85795 38.0 33.0 38.0 24.6 38.0 150-151 29.30675 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 3.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 0.0 18 0.0 19 5.0 20 0.0 21 2.0 22 4.0 23 2.0 24 11.0 25 12.0 26 10.0 27 11.0 28 17.0 29 36.0 30 47.0 31 47.0 32 60.0 33 108.0 34 154.0 35 291.0 36 845.0 37 2329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.41042678251981 18.374648607206748 10.656785075389728 32.55813953488372 2 19.0 24.675 38.2 18.125 3 16.5 31.175000000000004 27.775 24.55 4 20.775 37.75 21.4 20.075000000000003 5 20.375 38.224999999999994 22.725 18.675 6 16.425 35.4 25.7 22.475 7 12.575 20.674999999999997 44.975 21.775 8 18.7 19.675 28.799999999999997 32.824999999999996 9 16.8 21.725 31.624999999999996 29.849999999999998 10-14 19.445 29.81 26.919999999999998 23.825 15-19 19.215 28.425 28.22 24.14 20-24 19.689999999999998 28.585 28.01 23.715 25-29 19.8 29.035 27.295 23.87 30-34 19.634999999999998 29.01 27.79 23.565 35-39 19.55 29.375 27.465 23.61 40-44 19.31 28.910000000000004 27.88 23.9 45-49 19.74 28.54 27.61 24.11 50-54 19.689999999999998 28.525 27.865000000000002 23.919999999999998 55-59 19.78 28.965000000000003 27.42 23.835 60-64 19.99 28.04 27.605 24.365000000000002 65-69 19.49 29.005 27.925 23.580000000000002 70-74 20.165 28.425 27.860000000000003 23.549999999999997 75-79 19.965 28.185 28.605000000000004 23.244999999999997 80-84 19.8 28.544999999999998 27.235 24.42 85-89 20.115 28.725 27.525 23.635 90-94 20.29 28.01 27.3 24.4 95-99 20.294999999999998 28.255000000000003 27.61 23.84 100-104 20.18 28.660000000000004 27.85 23.31 105-109 20.59 27.87 27.83 23.71 110-114 20.669999999999998 27.950000000000003 27.915 23.465 115-119 20.265 28.875 27.02 23.84 120-124 20.78 28.77 27.015 23.435 125-129 20.315 28.16 27.77 23.755000000000003 130-134 21.2 28.515 27.12 23.165 135-139 20.075000000000003 28.939999999999998 27.115000000000002 23.87 140-144 20.51 28.294999999999998 27.58 23.615 145-149 20.585 28.560000000000002 27.005000000000003 23.849999999999998 150-151 21.15 28.475 27.375 23.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 3.5 23 2.5 24 1.0 25 3.0 26 8.5 27 12.0 28 12.5 29 18.0 30 28.0 31 33.0 32 39.0 33 54.0 34 66.5 35 78.0 36 90.0 37 109.0 38 138.0 39 162.5 40 198.0 41 222.0 42 227.0 43 245.5 44 272.0 45 285.0 46 256.0 47 227.0 48 218.5 49 199.0 50 167.5 51 136.5 52 117.0 53 95.5 54 72.0 55 56.5 56 41.0 57 30.0 58 19.5 59 13.0 60 11.5 61 7.0 62 7.5 63 4.5 64 0.5 65 1.5 66 2.0 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29417695991933 98.475 2 0.604991177211999 1.2 3 0.07562389715149988 0.22499999999999998 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.4875 0.0 0.0 0.0 0.0 132-133 3.6625 0.0 0.0 0.0 0.0 134-135 3.9749999999999996 0.0 0.0 0.0 0.0 136-137 4.262499999999999 0.0 0.0 0.0 0.0 138-139 4.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGTG 10 0.0068343505 144.975 4 >>END_MODULE SRR7170622 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170622_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77125 33.0 33.0 34.0 32.0 34.0 2 32.91375 33.0 33.0 34.0 32.0 34.0 3 32.91125 34.0 33.0 34.0 32.0 34.0 4 32.8515 34.0 33.0 34.0 32.0 34.0 5 32.87925 34.0 33.0 34.0 32.0 34.0 6 37.03775 38.0 38.0 38.0 36.0 38.0 7 37.1235 38.0 38.0 38.0 37.0 38.0 8 37.14175 38.0 38.0 38.0 37.0 38.0 9 36.997 38.0 38.0 38.0 36.0 38.0 10-14 36.999300000000005 38.0 38.0 38.0 36.4 38.0 15-19 37.0358 38.0 38.0 38.0 37.0 38.0 20-24 37.006600000000006 38.0 38.0 38.0 36.8 38.0 25-29 36.948449999999994 38.0 38.0 38.0 36.4 38.0 30-34 36.952749999999995 38.0 38.0 38.0 36.4 38.0 35-39 36.92725 38.0 38.0 38.0 36.0 38.0 40-44 36.89555 38.0 38.0 38.0 36.0 38.0 45-49 36.8584 38.0 38.0 38.0 36.0 38.0 50-54 36.77695 38.0 38.0 38.0 36.0 38.0 55-59 36.74135 38.0 38.0 38.0 35.6 38.0 60-64 36.695899999999995 38.0 38.0 38.0 35.4 38.0 65-69 36.69445 38.0 38.0 38.0 35.4 38.0 70-74 36.644850000000005 38.0 38.0 38.0 35.0 38.0 75-79 36.5344 38.0 38.0 38.0 34.8 38.0 80-84 36.45225000000001 38.0 38.0 38.0 34.6 38.0 85-89 36.4388 38.0 38.0 38.0 34.4 38.0 90-94 36.3413 38.0 38.0 38.0 34.2 38.0 95-99 36.12785 38.0 38.0 38.0 33.8 38.0 100-104 36.02835 38.0 37.8 38.0 33.6 38.0 105-109 35.89960000000001 38.0 37.4 38.0 33.0 38.0 110-114 35.61475 38.0 37.0 38.0 31.2 38.0 115-119 35.42695 38.0 36.6 38.0 30.6 38.0 120-124 35.32835 38.0 36.0 38.0 30.4 38.0 125-129 35.00085 38.0 35.8 38.0 28.6 38.0 130-134 34.44690000000001 38.0 34.6 38.0 25.8 38.0 135-139 34.033 38.0 33.4 38.0 24.0 38.0 140-144 33.3331 38.0 33.0 38.0 19.8 38.0 145-149 32.14469999999999 38.0 33.0 38.0 10.6 38.0 150-151 26.650125000000003 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 5.0 4 0.0 5 1.0 6 0.0 7 3.0 8 2.0 9 0.0 10 2.0 11 4.0 12 2.0 13 6.0 14 5.0 15 4.0 16 5.0 17 4.0 18 3.0 19 10.0 20 6.0 21 4.0 22 8.0 23 15.0 24 15.0 25 22.0 26 20.0 27 21.0 28 31.0 29 40.0 30 40.0 31 60.0 32 82.0 33 102.0 34 171.0 35 295.0 36 669.0 37 2334.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.8 16.05 14.000000000000002 29.15 2 23.549999999999997 22.45 36.3 17.7 3 19.375 26.525 32.875 21.224999999999998 4 22.625 36.075 21.425 19.875 5 22.475 38.3 22.400000000000002 16.825000000000003 6 16.75 37.8 24.75 20.7 7 15.975 16.175 47.475 20.375 8 20.75 20.575 28.775000000000002 29.9 9 21.325 23.45 30.0 25.224999999999998 10-14 22.305 28.475 27.63 21.59 15-19 22.759999999999998 27.37 28.7 21.17 20-24 22.745 27.93 28.075 21.25 25-29 22.57 28.32 28.38 20.73 30-34 22.855 27.775 28.26 21.11 35-39 22.941147057352868 28.441422071103556 27.58137906895345 21.03605180259013 40-44 23.051152557627884 27.991399569978498 28.601430071503575 20.356017800890044 45-49 23.36 27.395000000000003 28.449999999999996 20.794999999999998 50-54 23.175 27.755000000000003 28.084999999999997 20.985 55-59 22.755 27.33 28.384999999999998 21.529999999999998 60-64 23.189999999999998 28.310000000000002 27.825 20.674999999999997 65-69 23.51 27.97 27.245 21.275 70-74 22.900000000000002 28.465 27.55 21.085 75-79 23.585 27.900000000000002 27.875 20.64 80-84 23.185 28.410000000000004 27.735 20.669999999999998 85-89 23.294999999999998 28.335 27.839999999999996 20.53 90-94 23.21 27.650000000000002 28.435 20.705000000000002 95-99 22.605 27.685 28.92 20.79 100-104 23.830000000000002 27.900000000000002 28.139999999999997 20.13 105-109 23.845 27.750000000000004 27.515 20.89 110-114 23.51 28.599999999999998 27.900000000000002 19.99 115-119 23.45 28.499999999999996 27.365000000000002 20.685000000000002 120-124 24.240000000000002 28.105000000000004 27.58 20.075000000000003 125-129 24.22 28.675 27.01 20.095 130-134 24.610000000000003 27.725 27.384999999999998 20.28 135-139 24.19 27.565 27.575 20.669999999999998 140-144 24.145 27.855 27.725 20.275000000000002 145-149 24.445 27.915 27.87 19.77 150-151 24.3 28.000000000000004 27.962500000000002 19.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.5 23 2.5 24 2.5 25 4.5 26 6.5 27 8.5 28 14.0 29 17.0 30 21.0 31 25.5 32 31.0 33 43.5 34 55.0 35 72.5 36 85.0 37 106.0 38 137.0 39 160.0 40 180.5 41 221.0 42 248.5 43 243.5 44 278.5 45 303.5 46 277.0 47 234.0 48 201.0 49 195.5 50 181.0 51 138.0 52 104.5 53 91.5 54 71.5 55 55.0 56 39.5 57 35.5 58 32.5 59 19.5 60 15.0 61 12.5 62 11.0 63 6.0 64 2.5 65 2.5 66 1.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16666666666667 98.175 2 0.6818181818181818 1.35 3 0.12626262626262627 0.375 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6749999999999998 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.1500000000000004 0.0 0.0 0.0 0.0 120-121 2.3625 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.15 0.0 0.0 0.0 0.0 128-129 3.4 0.0 0.0 0.0 0.0 130-131 3.5875 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.075 0.0 0.0 0.0 0.0 136-137 4.35 0.0 0.0 0.0 0.0 138-139 4.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806412 spots for SRR7170622.sra Written 806412 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra Read 806405 spots for SRR7170622.sra Written 806405 spots for SRR7170622.sra SRR ids: ['SRR7170622.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_md3lwdpe SRR7170622.sra spots: 16128107 blocks: [[1, 806405], [806406, 1612810], [1612811, 2419215], [2419216, 3225620], [3225621, 4032025], [4032026, 4838430], [4838431, 5644835], [5644836, 6451240], [6451241, 7257645], [7257646, 8064050], [8064051, 8870455], [8870456, 9676860], [9676861, 10483265], [10483266, 11289670], [11289671, 12096075], [12096076, 12902480], [12902481, 13708885], [13708886, 14515290], [14515291, 15321695], [15321696, 16128107]] SRR7170622 file size 5443585 SRR7170622 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170622 SRR7170622_1.fastq SRR7170622_2.fastq Input file: SRR7170622_1.fastq Paired file: SRR7170622_2.fastq trimmed: SRR7170622-trimmed-pair1.fastq, SRR7170622-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:56:03 2025 >> started Thu Apr 10 15:56:20 2025 >> done (17.232s) 16128107 read pairs processed; of these: 14385 ( 0.09%) short read pairs filtered out after trimming by size control 17719 ( 0.11%) empty read pairs filtered out after trimming by size control 16096003 (99.80%) read pairs available; of these: 8617741 (53.54%) trimmed read pairs available after processing 7478262 (46.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 7 0.00% 21 5 0.00% 22 11 0.00% 23 9 0.00% 24 15 0.00% 25 9 0.00% 26 7 0.00% 27 8 0.00% 28 8 0.00% 29 9 0.00% 30 19 0.00% 31 9 0.00% 32 13 0.00% 33 15 0.00% 34 13 0.00% 35 17 0.00% 36 25 0.00% 37 23 0.00% 38 27 0.00% 39 30 0.00% 40 26 0.00% 41 39 0.00% 42 41 0.00% 43 37 0.00% 44 44 0.00% 45 58 0.00% 46 70 0.00% 47 64 0.00% 48 72 0.00% 49 101 0.00% 50 112 0.00% 51 116 0.00% 52 130 0.00% 53 145 0.00% 54 167 0.00% 55 176 0.00% 56 152 0.00% 57 191 0.00% 58 226 0.00% 59 237 0.00% 60 326 0.00% 61 361 0.00% 62 371 0.00% 63 449 0.00% 64 416 0.00% 65 497 0.00% 66 543 0.00% 67 627 0.00% 68 659 0.00% 69 770 0.00% 70 868 0.01% 71 1010 0.01% 72 1174 0.01% 73 1351 0.01% 74 1419 0.01% 75 1558 0.01% 76 1815 0.01% 77 2054 0.01% 78 2009 0.01% 79 2240 0.01% 80 2490 0.02% 81 2835 0.02% 82 3171 0.02% 83 3624 0.02% 84 4627 0.03% 85 5377 0.03% 86 5524 0.03% 87 6006 0.04% 88 6121 0.04% 89 6439 0.04% 90 6989 0.04% 91 7390 0.05% 92 7933 0.05% 93 8449 0.05% 94 9064 0.06% 95 9564 0.06% 96 10007 0.06% 97 10250 0.06% 98 10566 0.07% 99 11050 0.07% 100 11877 0.07% 101 12584 0.08% 102 13314 0.08% 103 13830 0.09% 104 14426 0.09% 105 15278 0.09% 106 15755 0.10% 107 16031 0.10% 108 16681 0.10% 109 17271 0.11% 110 17721 0.11% 111 18784 0.12% 112 19638 0.12% 113 20319 0.13% 114 20879 0.13% 115 21970 0.14% 116 22615 0.14% 117 23591 0.15% 118 24053 0.15% 119 24412 0.15% 120 25360 0.16% 121 26342 0.16% 122 27344 0.17% 123 29459 0.18% 124 30300 0.19% 125 31961 0.20% 126 33258 0.21% 127 34611 0.22% 128 35833 0.22% 129 37902 0.24% 130 39793 0.25% 131 41819 0.26% 132 44566 0.28% 133 47696 0.30% 134 51149 0.32% 135 55062 0.34% 136 59482 0.37% 137 63839 0.40% 138 70523 0.44% 139 77290 0.48% 140 87083 0.54% 141 97392 0.61% 142 110296 0.69% 143 127915 0.79% 144 152682 0.95% 145 191705 1.19% 146 240326 1.49% 147 333110 2.07% 148 517823 3.22% 149 1042407 6.48% 150 4331893 26.91% 151 7478262 46.46% 16096003 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=15 prefix-density=0.57 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=12.84 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.6 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATG criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=11 prefix-density=0.71 prefix-fanout=2.4 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.19 sequence-density-rank=14 fanout-score=12.27 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=4.5 sequence=AGCAATGGCAGCA SRR7170622 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:57:06 Started mapping on | Apr 10 15:57:07 Finished on | Apr 10 15:59:01 Mapping speed, Million of reads per hour | 508.29 Number of input reads | 16096003 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15021993 Uniquely mapped reads % | 93.33% Average mapped length | 294.10 Number of splices: Total | 14902658 Number of splices: Annotated (sjdb) | 14544770 Number of splices: GT/AG | 14627456 Number of splices: GC/AG | 220925 Number of splices: AT/AC | 9107 Number of splices: Non-canonical | 45170 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418438 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 22811 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.88% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 670932 670932 670932 N_multimapping 418438 418438 418438 N_noFeature 601510 14773477 689983 N_ambiguous 279729 1017 119144 UnstrandedReadsAssigned:14140754 PositiveStrandReadsAssigned:247499 NegativeStrandReadsAssigned:14212866 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170622 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170622-trimmed-pair1.fastq SRR7170622-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,096,003 reads, 14,157,227 reads pseudoaligned [quant] estimated average fragment length: 272.229 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 982 rounds 52401 SRR7170622.ke.tsv 34699 SRR7170622.se.tsv 87100 total ==> SRR7170622.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.77 630 24.2634 Potri.005G024800.1.v4.1 1035 763.771 181 15.9427 Potri.004G059700.1.v4.1 961 689.862 17 1.65781 Potri.007G009000.2.v4.1 1416 1144.77 0 0 Potri.003G141000.2.v4.1 2943 2671.77 571 14.3775 Potri.016G087400.1.v4.1 270 74.7382 999 899.227 Potri.015G069301.1.v4.1 564 301.674 0 0 Potri.010G195200.1.v4.1 1773 1501.77 52 2.32941 Potri.012G127500.1.v4.1 977 705.814 196 18.6815 ==> SRR7170622.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1236 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7170622 completed mapping pipeline successfully