Starting /dee2/code/volunteer_pipeline.sh SRR7170623 current disk space = 3091893121024 free memory = 1578524432 SRR7170623 SRAfilesize 9257ff75e0aa32af6ab6e9470f8ceee5 SRR7170623.sra SRR7170623.sra file validated SRR7170623 is paired end SRR7170623 is conventional basespace SRR7170623 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170623_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.444 32.0 25.0 33.0 18.0 33.0 2 30.766 31.0 30.0 33.0 27.0 33.0 3 32.21125 33.0 33.0 33.0 29.0 34.0 4 32.7525 33.0 33.0 33.0 32.0 34.0 5 32.9375 33.0 33.0 34.0 32.0 34.0 6 37.1935 38.0 38.0 38.0 36.0 38.0 7 37.4715 38.0 38.0 38.0 37.0 38.0 8 37.50975 38.0 38.0 38.0 37.0 38.0 9 37.43425 38.0 38.0 38.0 37.0 38.0 10-14 37.4764 38.0 38.0 38.0 37.6 38.0 15-19 37.41224999999999 38.0 38.0 38.0 37.2 38.0 20-24 37.54245 38.0 38.0 38.0 37.8 38.0 25-29 37.5876 38.0 38.0 38.0 38.0 38.0 30-34 37.55735 38.0 38.0 38.0 38.0 38.0 35-39 37.49209999999999 38.0 38.0 38.0 37.6 38.0 40-44 37.45975 38.0 38.0 38.0 37.2 38.0 45-49 37.49005 38.0 38.0 38.0 37.4 38.0 50-54 37.387100000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.30264999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.2093 38.0 38.0 38.0 36.4 38.0 65-69 37.15585 38.0 38.0 38.0 36.2 38.0 70-74 37.16575 38.0 38.0 38.0 36.0 38.0 75-79 37.04915 38.0 38.0 38.0 36.0 38.0 80-84 36.99210000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.893150000000006 38.0 38.0 38.0 35.8 38.0 90-94 36.7795 38.0 38.0 38.0 35.0 38.0 95-99 36.5587 38.0 38.0 38.0 34.2 38.0 100-104 36.40885 38.0 38.0 38.0 34.0 38.0 105-109 36.35555000000001 38.0 37.6 38.0 34.0 38.0 110-114 36.16525 38.0 37.2 38.0 33.6 38.0 115-119 35.92965 38.0 37.0 38.0 32.8 38.0 120-124 35.7378 38.0 36.8 38.0 31.0 38.0 125-129 35.82745 38.0 36.4 38.0 32.2 38.0 130-134 35.499449999999996 38.0 36.0 38.0 31.0 38.0 135-139 35.13000000000001 38.0 35.6 38.0 30.4 38.0 140-144 34.25845 38.0 33.8 38.0 25.8 38.0 145-149 33.704699999999995 38.0 33.0 38.0 23.8 38.0 150-151 29.157874999999997 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 1.0 16 3.0 17 1.0 18 1.0 19 3.0 20 4.0 21 4.0 22 4.0 23 4.0 24 9.0 25 17.0 26 12.0 27 10.0 28 16.0 29 28.0 30 34.0 31 50.0 32 71.0 33 106.0 34 140.0 35 303.0 36 787.0 37 2389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.176049129989764 19.012282497441145 10.516888433981576 31.294779938587514 2 18.65 24.725 38.625 18.0 3 17.849999999999998 30.675 28.275 23.200000000000003 4 20.150000000000002 36.55 21.95 21.349999999999998 5 20.06504878658994 38.92919689767326 22.416812609457093 18.58894170627971 6 17.275 36.1 25.825 20.8 7 12.65 20.1 46.2 21.05 8 17.1 20.875 29.525000000000002 32.5 9 17.025000000000002 21.975 31.924999999999997 29.075 10-14 19.595000000000002 30.095 26.41 23.9 15-19 19.56 29.015 27.495000000000005 23.93 20-24 20.13 29.035 27.52 23.315 25-29 19.61 28.945 27.505000000000003 23.94 30-34 19.865 29.4 26.945000000000004 23.79 35-39 19.785 28.965000000000003 27.235 24.015 40-44 19.705000000000002 28.470000000000002 28.165000000000003 23.66 45-49 20.1 28.43 27.279999999999998 24.19 50-54 20.544999999999998 28.18 27.305 23.97 55-59 19.8 28.785 27.435 23.98 60-64 20.355 28.15 27.865000000000002 23.630000000000003 65-69 20.22 28.935 27.195000000000004 23.65 70-74 19.79 29.275000000000002 26.855 24.08 75-79 19.400000000000002 28.470000000000002 28.02 24.11 80-84 19.615 28.555000000000003 27.694999999999997 24.135 85-89 19.97 28.720000000000002 27.279999999999998 24.03 90-94 19.91 28.825 27.525 23.74 95-99 20.18 28.095 27.99 23.735 100-104 20.575 27.79 27.415 24.22 105-109 21.38 27.345000000000002 27.529999999999998 23.745 110-114 20.49 28.345 27.18 23.985 115-119 20.465 28.560000000000002 27.485 23.49 120-124 21.18 27.405 27.6 23.815 125-129 20.82 27.525 27.089999999999996 24.565 130-134 20.755000000000003 28.689999999999998 27.175 23.380000000000003 135-139 21.099999999999998 27.595 27.185 24.12 140-144 20.815 27.67 26.99 24.525 145-149 20.93 28.084999999999997 27.310000000000002 23.674999999999997 150-151 21.025 27.9375 26.787499999999998 24.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.5 20 1.5 21 0.5 22 1.0 23 3.0 24 4.5 25 3.0 26 4.5 27 8.5 28 12.5 29 21.0 30 29.0 31 31.5 32 40.5 33 57.0 34 77.0 35 99.5 36 107.5 37 122.0 38 140.0 39 151.0 40 176.0 41 206.0 42 221.0 43 224.0 44 229.0 45 254.5 46 256.5 47 233.0 48 223.5 49 205.5 50 179.0 51 144.5 52 123.0 53 109.0 54 81.5 55 58.5 56 41.0 57 30.5 58 27.0 59 19.5 60 13.0 61 9.0 62 7.5 63 4.0 64 0.5 65 0.5 66 0.5 67 0.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01390644753477 97.89999999999999 2 0.8849557522123894 1.7500000000000002 3 0.05056890012642225 0.15 4 0.05056890012642225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.5 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.9249999999999998 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.2625 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.7249999999999996 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.5 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.0375 0.0 0.0 0.0 0.0 136-137 4.3875 0.0 0.0 0.0 0.0 138-139 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170623 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170623_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.807 33.0 33.0 34.0 32.0 34.0 2 32.9195 33.0 33.0 34.0 32.0 34.0 3 32.98025 34.0 33.0 34.0 32.0 34.0 4 32.862 34.0 33.0 34.0 32.0 34.0 5 32.878 34.0 33.0 34.0 32.0 34.0 6 37.069 38.0 38.0 38.0 37.0 38.0 7 37.13175 38.0 38.0 38.0 37.0 38.0 8 37.10275 38.0 38.0 38.0 37.0 38.0 9 37.07875 38.0 38.0 38.0 37.0 38.0 10-14 37.04084999999999 38.0 38.0 38.0 36.6 38.0 15-19 37.0629 38.0 38.0 38.0 36.8 38.0 20-24 37.019600000000004 38.0 38.0 38.0 36.6 38.0 25-29 36.9379 38.0 38.0 38.0 36.0 38.0 30-34 36.951100000000004 38.0 38.0 38.0 36.2 38.0 35-39 36.95615 38.0 38.0 38.0 36.2 38.0 40-44 36.977 38.0 38.0 38.0 36.0 38.0 45-49 36.9073 38.0 38.0 38.0 36.0 38.0 50-54 36.8233 38.0 38.0 38.0 36.0 38.0 55-59 36.803399999999996 38.0 38.0 38.0 35.6 38.0 60-64 36.7466 38.0 38.0 38.0 35.4 38.0 65-69 36.63484999999999 38.0 38.0 38.0 35.0 38.0 70-74 36.6436 38.0 38.0 38.0 35.2 38.0 75-79 36.57085 38.0 38.0 38.0 34.8 38.0 80-84 36.480199999999996 38.0 38.0 38.0 34.2 38.0 85-89 36.44035 38.0 38.0 38.0 34.0 38.0 90-94 36.283500000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.0662 38.0 38.0 38.0 33.2 38.0 100-104 36.01055 38.0 37.6 38.0 33.2 38.0 105-109 35.868750000000006 38.0 37.0 38.0 33.0 38.0 110-114 35.6065 38.0 36.8 38.0 30.6 38.0 115-119 35.3333 38.0 36.2 38.0 29.8 38.0 120-124 35.35815 38.0 36.0 38.0 30.6 38.0 125-129 35.01485 38.0 36.0 38.0 28.6 38.0 130-134 34.3782 38.0 34.2 38.0 26.0 38.0 135-139 33.96025 38.0 33.2 38.0 24.2 38.0 140-144 33.23925 38.0 33.0 38.0 19.8 38.0 145-149 32.075900000000004 38.0 33.0 38.0 10.4 38.0 150-151 26.31025 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 3.0 5 0.0 6 1.0 7 1.0 8 1.0 9 2.0 10 2.0 11 0.0 12 1.0 13 2.0 14 4.0 15 7.0 16 6.0 17 7.0 18 7.0 19 6.0 20 8.0 21 8.0 22 10.0 23 13.0 24 12.0 25 19.0 26 14.0 27 24.0 28 32.0 29 37.0 30 50.0 31 65.0 32 98.0 33 120.0 34 157.0 35 264.0 36 698.0 37 2310.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.25 16.875 13.575000000000001 28.299999999999997 2 23.075000000000003 22.625 37.025000000000006 17.275 3 20.175 25.3 33.275 21.25 4 24.45 34.25 21.4 19.900000000000002 5 22.6 37.9 21.325 18.175 6 17.849999999999998 36.525 24.775 20.849999999999998 7 18.425 15.325 43.675000000000004 22.575 8 21.3 22.475 26.200000000000003 30.025000000000002 9 21.175 23.549999999999997 28.549999999999997 26.724999999999998 10-14 23.119999999999997 28.685 26.22 21.975 15-19 23.189999999999998 27.72 27.534999999999997 21.555 20-24 23.13 27.58 27.944999999999997 21.345 25-29 23.34 28.1 27.185 21.375 30-34 22.07 28.46 27.705000000000002 21.765 35-39 22.761138056902848 28.016400820041003 27.87139356967848 21.35106755337767 40-44 23.13615680784039 27.75638781939097 27.38136906845342 21.726086304315213 45-49 23.215 27.534999999999997 28.025 21.224999999999998 50-54 23.265 27.725 27.450000000000003 21.560000000000002 55-59 23.7 27.85 27.125 21.325 60-64 23.51 27.139999999999997 27.37 21.98 65-69 22.91 27.22 27.99 21.88 70-74 23.845 26.924999999999997 27.474999999999998 21.755 75-79 23.055 28.17 27.76 21.015 80-84 23.66 28.144999999999996 26.884999999999998 21.310000000000002 85-89 23.875 27.72 26.810000000000002 21.595 90-94 23.78 27.700000000000003 27.339999999999996 21.18 95-99 23.74 27.750000000000004 27.74 20.77 100-104 24.535 27.775 26.900000000000002 20.79 105-109 23.91 27.584999999999997 27.839999999999996 20.665 110-114 23.71 27.63 27.97 20.69 115-119 24.515 27.875 27.255000000000003 20.355 120-124 24.615000000000002 27.655 27.195000000000004 20.535 125-129 24.740000000000002 26.66 27.455000000000002 21.145 130-134 23.96 28.03 27.415 20.595 135-139 24.79 27.139999999999997 27.860000000000003 20.21 140-144 24.58 27.855 27.175 20.39 145-149 24.77 27.985 26.979999999999997 20.265 150-151 24.65 28.4 27.3 19.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 0.5 21 1.5 22 3.0 23 2.0 24 4.5 25 5.0 26 5.5 27 5.5 28 3.5 29 7.5 30 9.0 31 14.5 32 27.0 33 33.0 34 49.0 35 68.0 36 70.5 37 85.0 38 117.0 39 139.0 40 158.5 41 191.0 42 232.0 43 250.0 44 258.5 45 271.5 46 266.5 47 257.0 48 242.5 49 215.0 50 184.0 51 156.0 52 144.0 53 123.0 54 88.5 55 75.5 56 63.5 57 46.0 58 30.5 59 27.0 60 23.5 61 12.5 62 10.0 63 9.0 64 4.5 65 1.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.55035605289929 96.875 2 1.2716174974567651 2.5 3 0.10172939979654119 0.3 4 0.050864699898270596 0.2 5 0.025432349949135298 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.2625 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.475 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.5 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.025 0.0 0.0 0.0 0.0 136-137 4.3625 0.0 0.0 0.0 0.0 138-139 4.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTACAC 10 0.006830828 145.0 4 AGAAACC 10 0.006830828 145.0 2 TGCTACA 10 0.006830828 145.0 3 >>END_MODULE Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771143 spots for SRR7170623.sra Written 771143 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra Read 771132 spots for SRR7170623.sra Written 771132 spots for SRR7170623.sra SRR ids: ['SRR7170623.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1sptp6m1 SRR7170623.sra spots: 15422651 blocks: [[1, 771132], [771133, 1542264], [1542265, 2313396], [2313397, 3084528], [3084529, 3855660], [3855661, 4626792], [4626793, 5397924], [5397925, 6169056], [6169057, 6940188], [6940189, 7711320], [7711321, 8482452], [8482453, 9253584], [9253585, 10024716], [10024717, 10795848], [10795849, 11566980], [11566981, 12338112], [12338113, 13109244], [13109245, 13880376], [13880377, 14651508], [14651509, 15422651]] SRR7170623 file size 5204529 SRR7170623 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170623 SRR7170623_1.fastq SRR7170623_2.fastq Input file: SRR7170623_1.fastq Paired file: SRR7170623_2.fastq trimmed: SRR7170623-trimmed-pair1.fastq, SRR7170623-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:37:49 2025 >> started Thu Feb 13 12:38:05 2025 >> done (16.654s) 15422651 read pairs processed; of these: 15751 ( 0.10%) short read pairs filtered out after trimming by size control 31816 ( 0.21%) empty read pairs filtered out after trimming by size control 15375084 (99.69%) read pairs available; of these: 8185286 (53.24%) trimmed read pairs available after processing 7189798 (46.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 5 0.00% 21 8 0.00% 22 8 0.00% 23 9 0.00% 24 7 0.00% 25 11 0.00% 26 12 0.00% 27 11 0.00% 28 9 0.00% 29 14 0.00% 30 8 0.00% 31 19 0.00% 32 10 0.00% 33 13 0.00% 34 13 0.00% 35 17 0.00% 36 20 0.00% 37 15 0.00% 38 30 0.00% 39 24 0.00% 40 30 0.00% 41 28 0.00% 42 46 0.00% 43 32 0.00% 44 34 0.00% 45 39 0.00% 46 53 0.00% 47 56 0.00% 48 77 0.00% 49 89 0.00% 50 110 0.00% 51 121 0.00% 52 125 0.00% 53 133 0.00% 54 127 0.00% 55 153 0.00% 56 155 0.00% 57 163 0.00% 58 201 0.00% 59 243 0.00% 60 259 0.00% 61 311 0.00% 62 353 0.00% 63 404 0.00% 64 484 0.00% 65 460 0.00% 66 499 0.00% 67 502 0.00% 68 629 0.00% 69 665 0.00% 70 811 0.01% 71 855 0.01% 72 1042 0.01% 73 1206 0.01% 74 1348 0.01% 75 1483 0.01% 76 1821 0.01% 77 2024 0.01% 78 1866 0.01% 79 2092 0.01% 80 2278 0.01% 81 2609 0.02% 82 3088 0.02% 83 3331 0.02% 84 4441 0.03% 85 5101 0.03% 86 5294 0.03% 87 5563 0.04% 88 5887 0.04% 89 6059 0.04% 90 6514 0.04% 91 6988 0.05% 92 7366 0.05% 93 8241 0.05% 94 8738 0.06% 95 9094 0.06% 96 9767 0.06% 97 9801 0.06% 98 10520 0.07% 99 10506 0.07% 100 11464 0.07% 101 11973 0.08% 102 12828 0.08% 103 13504 0.09% 104 14335 0.09% 105 14810 0.10% 106 15603 0.10% 107 15923 0.10% 108 16255 0.11% 109 16909 0.11% 110 17702 0.12% 111 18196 0.12% 112 19030 0.12% 113 20363 0.13% 114 21098 0.14% 115 21924 0.14% 116 22766 0.15% 117 23381 0.15% 118 23547 0.15% 119 24377 0.16% 120 25263 0.16% 121 26389 0.17% 122 27262 0.18% 123 29321 0.19% 124 30560 0.20% 125 31927 0.21% 126 32738 0.21% 127 34569 0.22% 128 35721 0.23% 129 37430 0.24% 130 38772 0.25% 131 40749 0.27% 132 43783 0.28% 133 46553 0.30% 134 49974 0.33% 135 53524 0.35% 136 57477 0.37% 137 62965 0.41% 138 68325 0.44% 139 74845 0.49% 140 83354 0.54% 141 92128 0.60% 142 104641 0.68% 143 121069 0.79% 144 144708 0.94% 145 179176 1.17% 146 223690 1.45% 147 309017 2.01% 148 481557 3.13% 149 970668 6.31% 150 4118554 26.79% 151 7189798 46.76% 15375084 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=16 prefix-density=0.96 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=209.05 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=11.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=13 prefix-density=1.01 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=101.65 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.3 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170623 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:38:46 Started mapping on | Feb 13 12:38:46 Finished on | Feb 13 12:40:16 Mapping speed, Million of reads per hour | 615.00 Number of input reads | 15375084 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14516185 Uniquely mapped reads % | 94.41% Average mapped length | 294.18 Number of splices: Total | 14386334 Number of splices: Annotated (sjdb) | 14094602 Number of splices: GT/AG | 14118755 Number of splices: GC/AG | 222613 Number of splices: AT/AC | 8157 Number of splices: Non-canonical | 36809 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382169 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 35650 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 492132 492132 492132 N_multimapping 382169 382169 382169 N_noFeature 465552 14246604 544015 N_ambiguous 294114 1025 102408 UnstrandedReadsAssigned:13756519 PositiveStrandReadsAssigned:268556 NegativeStrandReadsAssigned:13869762 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170623 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170623-trimmed-pair1.fastq SRR7170623-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,375,084 reads, 13,816,692 reads pseudoaligned [quant] estimated average fragment length: 268.516 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR7170623.ke.tsv 34699 SRR7170623.se.tsv 87100 total ==> SRR7170623.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.48 546 18.1489 Potri.005G024800.1.v4.1 1035 767.484 193 14.632 Potri.004G059700.1.v4.1 961 693.535 8 0.671176 Potri.007G009000.2.v4.1 1416 1148.48 0 0 Potri.003G141000.2.v4.1 2943 2675.48 730 15.8758 Potri.016G087400.1.v4.1 270 74.8113 959.664 746.391 Potri.015G069301.1.v4.1 564 304.892 0 0 Potri.010G195200.1.v4.1 1773 1505.48 17 0.657034 Potri.012G127500.1.v4.1 977 709.505 173 14.1875 ==> SRR7170623.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 697 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 325 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170623 completed mapping pipeline successfully