Starting /dee2/code/volunteer_pipeline.sh SRR7170624 current disk space = 3092208603136 free memory = 1415542008 SRR7170624 SRAfilesize 40652b7738b5a9d0513c3e64c5194286 SRR7170624.sra SRR7170624.sra file validated SRR7170624 is paired end SRR7170624 is conventional basespace SRR7170624 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170624_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.924 30.0 18.0 33.0 18.0 33.0 2 30.3715 31.0 29.0 33.0 27.0 33.0 3 31.92075 33.0 31.0 33.0 29.0 33.0 4 32.403 33.0 33.0 33.0 31.0 34.0 5 32.92075 33.0 33.0 34.0 32.0 34.0 6 37.124 38.0 37.0 38.0 36.0 38.0 7 37.41375 38.0 38.0 38.0 37.0 38.0 8 37.4825 38.0 38.0 38.0 37.0 38.0 9 37.59175 38.0 38.0 38.0 38.0 38.0 10-14 37.516149999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.477999999999994 38.0 38.0 38.0 37.8 38.0 20-24 37.54885 38.0 38.0 38.0 38.0 38.0 25-29 37.525850000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.478049999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.469100000000005 38.0 38.0 38.0 37.8 38.0 40-44 37.428700000000006 38.0 38.0 38.0 37.4 38.0 45-49 37.389950000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.3023 38.0 38.0 38.0 37.0 38.0 55-59 37.26605 38.0 38.0 38.0 36.8 38.0 60-64 37.1883 38.0 38.0 38.0 36.6 38.0 65-69 37.09735 38.0 38.0 38.0 36.0 38.0 70-74 36.944500000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.88795 38.0 38.0 38.0 35.6 38.0 80-84 36.91005 38.0 38.0 38.0 35.8 38.0 85-89 36.77995 38.0 38.0 38.0 35.0 38.0 90-94 36.62455 38.0 38.0 38.0 34.4 38.0 95-99 36.4525 38.0 38.0 38.0 34.0 38.0 100-104 36.21605 38.0 37.2 38.0 33.8 38.0 105-109 36.25725 38.0 37.4 38.0 33.8 38.0 110-114 36.05195 38.0 37.0 38.0 33.2 38.0 115-119 35.89145 38.0 37.0 38.0 32.2 38.0 120-124 35.742799999999995 38.0 36.8 38.0 31.0 38.0 125-129 35.3815 38.0 36.0 38.0 30.6 38.0 130-134 34.832 38.0 35.4 38.0 27.4 38.0 135-139 34.36289999999999 38.0 34.6 38.0 25.0 38.0 140-144 33.6678 38.0 33.4 38.0 22.6 38.0 145-149 33.18965 38.0 33.4 38.0 19.6 38.0 150-151 29.2145 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 2.0 15 1.0 16 2.0 17 4.0 18 1.0 19 2.0 20 2.0 21 4.0 22 4.0 23 9.0 24 5.0 25 15.0 26 18.0 27 17.0 28 27.0 29 29.0 30 40.0 31 52.0 32 76.0 33 106.0 34 179.0 35 329.0 36 810.0 37 2260.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.24126326689102 18.534817499352833 10.924152213305721 34.299767020450425 2 18.3 26.700000000000003 38.5 16.5 3 15.675 31.1 27.55 25.674999999999997 4 19.925 36.55 23.25 20.275000000000002 5 19.28374655647383 38.66766841973453 24.417731029301276 17.63085399449036 6 16.650000000000002 35.75 24.775 22.825 7 12.3 19.225 46.300000000000004 22.175 8 17.424999999999997 21.625 28.075 32.875 9 18.2 21.825 30.575000000000003 29.4 10-14 18.834999999999997 30.285 26.284999999999997 24.595 15-19 19.465 28.395 28.03 24.11 20-24 19.59 28.505000000000003 28.465 23.44 25-29 19.33 29.685 27.694999999999997 23.29 30-34 19.564999999999998 29.265 27.560000000000002 23.61 35-39 19.735 28.875 27.905 23.485 40-44 19.555 29.470000000000002 28.134999999999998 22.84 45-49 19.814999999999998 28.78 27.750000000000004 23.655 50-54 18.96 28.93 28.49 23.62 55-59 19.994999999999997 28.845 27.525 23.635 60-64 20.25 28.299999999999997 27.985 23.465 65-69 19.295 28.71 28.67 23.325000000000003 70-74 19.845 29.005 27.855 23.294999999999998 75-79 19.365 29.285 27.49 23.86 80-84 19.74 28.405 28.050000000000004 23.805 85-89 20.015 29.555 27.63 22.8 90-94 19.62 29.01 28.084999999999997 23.285 95-99 19.78 28.64 27.955000000000002 23.625 100-104 20.32 28.08 28.13 23.47 105-109 20.155 28.435 27.74 23.669999999999998 110-114 20.055 28.994999999999997 27.400000000000002 23.549999999999997 115-119 20.155 28.449999999999996 28.105000000000004 23.29 120-124 20.815 28.1 27.560000000000002 23.525 125-129 20.305 28.65 27.634999999999998 23.41 130-134 19.99 28.849999999999998 27.805000000000003 23.355 135-139 20.080000000000002 28.62 27.150000000000002 24.15 140-144 20.825 28.249999999999996 27.195000000000004 23.73 145-149 20.11 28.605000000000004 27.36 23.925 150-151 21.0375 28.287499999999998 27.3125 23.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 2.0 20 1.0 21 0.5 22 1.0 23 2.5 24 5.0 25 8.5 26 9.5 27 13.5 28 16.0 29 24.0 30 33.5 31 36.0 32 40.5 33 42.0 34 63.5 35 87.0 36 102.0 37 118.0 38 141.0 39 175.0 40 207.0 41 256.0 42 264.5 43 246.5 44 266.0 45 273.5 46 253.0 47 237.5 48 211.0 49 177.5 50 154.5 51 118.5 52 92.5 53 78.0 54 65.5 55 51.0 56 28.0 57 23.5 58 24.0 59 13.5 60 8.5 61 7.0 62 5.5 63 4.5 64 2.0 65 0.5 66 0.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.1375000000000002 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.7125 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.4000000000000004 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.3375 0.0 0.0 0.0 0.0 136-137 3.6875 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170624 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170624_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.732 33.0 33.0 34.0 32.0 34.0 2 32.80925 33.0 33.0 34.0 32.0 34.0 3 32.864 34.0 33.0 34.0 32.0 34.0 4 32.827 34.0 33.0 34.0 32.0 34.0 5 32.8755 34.0 33.0 34.0 32.0 34.0 6 36.956 38.0 38.0 38.0 36.0 38.0 7 36.946 38.0 38.0 38.0 36.0 38.0 8 36.96925 38.0 38.0 38.0 36.0 38.0 9 36.90125 38.0 38.0 38.0 36.0 38.0 10-14 36.9132 38.0 38.0 38.0 36.0 38.0 15-19 36.87075 38.0 38.0 38.0 36.0 38.0 20-24 36.88779999999999 38.0 38.0 38.0 36.0 38.0 25-29 36.7692 38.0 38.0 38.0 36.0 38.0 30-34 36.81605 38.0 38.0 38.0 35.8 38.0 35-39 36.80095 38.0 38.0 38.0 36.0 38.0 40-44 36.79855 38.0 38.0 38.0 36.0 38.0 45-49 36.74929999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.69235 38.0 38.0 38.0 35.4 38.0 55-59 36.6479 38.0 38.0 38.0 35.2 38.0 60-64 36.56765 38.0 38.0 38.0 34.8 38.0 65-69 36.58389999999999 38.0 38.0 38.0 34.8 38.0 70-74 36.5253 38.0 38.0 38.0 34.6 38.0 75-79 36.45415 38.0 38.0 38.0 34.4 38.0 80-84 36.270399999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.10595000000001 38.0 38.0 38.0 33.4 38.0 90-94 36.04675 38.0 38.0 38.0 33.4 38.0 95-99 35.7856 38.0 37.2 38.0 31.8 38.0 100-104 35.668099999999995 38.0 37.0 38.0 32.0 38.0 105-109 35.544799999999995 38.0 37.0 38.0 31.0 38.0 110-114 35.36085 38.0 37.0 38.0 29.8 38.0 115-119 35.144949999999994 38.0 36.4 38.0 28.8 38.0 120-124 34.88805000000001 38.0 35.8 38.0 27.8 38.0 125-129 34.302949999999996 38.0 34.8 38.0 23.6 38.0 130-134 33.901250000000005 38.0 33.4 38.0 21.8 38.0 135-139 33.69834999999999 38.0 33.0 38.0 22.2 38.0 140-144 32.8824 38.0 33.0 38.0 16.2 38.0 145-149 31.910149999999998 38.0 33.0 38.0 8.4 38.0 150-151 26.807375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 3.0 5 2.0 6 0.0 7 2.0 8 3.0 9 3.0 10 2.0 11 0.0 12 7.0 13 1.0 14 5.0 15 2.0 16 6.0 17 12.0 18 8.0 19 7.0 20 12.0 21 7.0 22 12.0 23 15.0 24 15.0 25 23.0 26 24.0 27 23.0 28 34.0 29 38.0 30 57.0 31 60.0 32 87.0 33 134.0 34 176.0 35 322.0 36 650.0 37 2235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.175 16.425 13.675 31.724999999999998 2 24.325 23.125 36.475 16.075 3 19.675 26.05 32.35 21.925 4 23.724999999999998 35.425000000000004 20.9 19.950000000000003 5 22.45 38.15 22.825 16.575 6 16.74174174174174 37.23723723723724 25.900900900900904 20.12012012012012 7 16.783391695847925 15.057528764382191 47.42371185592796 20.735367683841922 8 19.794794794794797 20.92092092092092 28.053053053053052 31.23123123123123 9 22.07759699624531 22.97872340425532 29.061326658322905 25.882352941176475 10-14 22.990289318250078 28.361197317048752 27.089798778656522 21.55871458604465 15-19 22.805964174922448 27.624337035925144 28.55498849194436 21.014710297208044 20-24 22.37506878095143 28.06763043369516 28.80296133259967 20.75433945275374 25-29 22.726363181590795 28.224112056028016 28.134067033516757 20.915457728864432 30-34 22.032626100880705 28.397718174539634 28.63791032826261 20.93174539631705 35-39 22.324557012713985 28.796676343978376 27.925718290119132 20.953048353188507 40-44 22.634424752177832 28.396915990788024 28.051466906979073 20.91719235005507 45-49 23.003402722177743 28.297638110488393 27.997397918334666 20.7015612489992 50-54 23.046523261630817 27.693846923461727 28.729364682341167 20.530265132566285 55-59 22.898318654923937 27.722177742193754 28.742994395516412 20.636509207365894 60-64 22.85599919943961 27.414189932953064 28.78014610227159 20.949664765335736 65-69 23.03421368547419 28.141256502601042 28.171268507402964 20.65326130452181 70-74 23.074614922984598 27.81056211242248 28.300660132026405 20.814162832566513 75-79 23.011903571071322 27.9333800140042 28.95368610583175 20.101030309092728 80-84 23.26965393078616 28.255651130226045 28.435687137427486 20.039007801560313 85-89 23.187318731873187 28.412841284128415 28.002800280028 20.397039703970396 90-94 23.189999999999998 27.57 28.785 20.455000000000002 95-99 23.72 27.36 28.599999999999998 20.32 100-104 23.59617980899045 27.936396819840994 28.431421571078552 20.036001800090006 105-109 23.749499799919967 27.981192476990795 27.906162464985997 20.36314525810324 110-114 23.491444010807566 28.19973981787251 28.059641749224458 20.249174422095468 115-119 23.44289359147531 28.460653359347642 27.865325929261093 20.231127119915953 120-124 23.22696809042713 27.95838751625488 28.588576572971892 20.226067820346103 125-129 23.849999999999998 27.834999999999997 28.29 20.025000000000002 130-134 24.10223066920076 28.353506051815547 27.418225467640294 20.1260378113434 135-139 24.00160144129717 27.614853368031227 28.150335301771594 20.23320988890001 140-144 24.587128415574018 27.805024522069864 27.719947953157842 19.88789910919828 145-149 25.016250812540626 27.42137106855343 27.956397819890995 19.60598029901495 150-151 23.9875 27.8375 28.299999999999997 19.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 0.0 17 1.5 18 1.5 19 1.0 20 1.5 21 1.5 22 1.0 23 0.5 24 2.5 25 5.0 26 7.0 27 7.5 28 8.0 29 14.0 30 26.0 31 29.5 32 32.5 33 42.5 34 54.5 35 65.0 36 83.5 37 110.0 38 143.0 39 175.5 40 193.5 41 232.0 42 269.0 43 268.5 44 281.0 45 287.0 46 266.0 47 245.5 48 214.5 49 183.0 50 152.5 51 126.5 52 113.5 53 91.5 54 61.0 55 46.0 56 42.5 57 29.0 58 16.5 59 16.5 60 13.5 61 8.0 62 6.0 63 5.0 64 2.5 65 1.5 66 1.0 67 1.0 68 1.5 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.05 8 0.1 9 0.125 10-14 0.11 15-19 0.06999999999999999 20-24 0.045 25-29 0.05 30-34 0.08 35-39 0.11 40-44 0.13 45-49 0.08 50-54 0.05 55-59 0.08 60-64 0.06999999999999999 65-69 0.04 70-74 0.02 75-79 0.03 80-84 0.02 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.04 110-114 0.06999999999999999 115-119 0.055 120-124 0.03 125-129 0.0 130-134 0.03 135-139 0.09 140-144 0.09 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.40221216691804923 0.8 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.037500000000000006 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.0625 0.0 0.0 0.025 0.0 86-87 0.075 0.0 0.0 0.025 0.0 88-89 0.125 0.0 0.0 0.025 0.0 90-91 0.1875 0.0 0.0 0.025 0.0 92-93 0.225 0.0 0.0 0.025 0.0 94-95 0.2625 0.0 0.0 0.025 0.0 96-97 0.38749999999999996 0.0 0.0 0.025 0.0 98-99 0.45 0.0 0.0 0.025 0.0 100-101 0.4875 0.0 0.0 0.025 0.0 102-103 0.575 0.0 0.0 0.025 0.0 104-105 0.6375 0.0 0.0 0.025 0.0 106-107 0.7 0.0 0.0 0.025 0.0 108-109 0.825 0.0 0.0 0.025 0.0 110-111 1.0 0.0 0.0 0.025 0.0 112-113 1.0375 0.0 0.0 0.025 0.0 114-115 1.0875 0.0 0.0 0.025 0.0 116-117 1.1875 0.0 0.0 0.025 0.0 118-119 1.4 0.0 0.0 0.025 0.0 120-121 1.7374999999999998 0.0 0.0 0.025 0.0 122-123 1.9375 0.0 0.0 0.025 0.0 124-125 2.175 0.0 0.0 0.025 0.0 126-127 2.425 0.0 0.0 0.025 0.0 128-129 2.625 0.0 0.0 0.025 0.0 130-131 2.8875 0.0 0.0 0.025 0.0 132-133 3.1375 0.0 0.0 0.025 0.0 134-135 3.4125 0.0 0.0 0.025 0.0 136-137 3.7249999999999996 0.0 0.0 0.025 0.0 138-139 3.9625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTCC 10 0.006830828 145.0 6 TCTGCAG 10 0.006830828 145.0 5 CGTGTCT 10 0.006830828 145.0 1 >>END_MODULE Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra Read 1007415 spots for SRR7170624.sra Written 1007415 spots for SRR7170624.sra SRR ids: ['SRR7170624.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_76n4tol_ SRR7170624.sra spots: 20148300 blocks: [[1, 1007415], [1007416, 2014830], [2014831, 3022245], [3022246, 4029660], [4029661, 5037075], [5037076, 6044490], [6044491, 7051905], [7051906, 8059320], [8059321, 9066735], [9066736, 10074150], [10074151, 11081565], [11081566, 12088980], [12088981, 13096395], [13096396, 14103810], [14103811, 15111225], [15111226, 16118640], [16118641, 17126055], [17126056, 18133470], [18133471, 19140885], [19140886, 20148300]] SRR7170624 file size 6805897 SRR7170624 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170624 SRR7170624_1.fastq SRR7170624_2.fastq Input file: SRR7170624_1.fastq Paired file: SRR7170624_2.fastq trimmed: SRR7170624-trimmed-pair1.fastq, SRR7170624-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:28:37 2025 >> started Thu Feb 13 12:29:14 2025 >> done (37.420s) 20148300 read pairs processed; of these: 21995 ( 0.11%) short read pairs filtered out after trimming by size control 31170 ( 0.15%) empty read pairs filtered out after trimming by size control 20095135 (99.74%) read pairs available; of these: 10175123 (50.63%) trimmed read pairs available after processing 9920012 (49.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 13 0.00% 20 7 0.00% 21 17 0.00% 22 15 0.00% 23 6 0.00% 24 8 0.00% 25 13 0.00% 26 3 0.00% 27 8 0.00% 28 12 0.00% 29 9 0.00% 30 13 0.00% 31 16 0.00% 32 18 0.00% 33 14 0.00% 34 16 0.00% 35 18 0.00% 36 30 0.00% 37 35 0.00% 38 28 0.00% 39 27 0.00% 40 35 0.00% 41 29 0.00% 42 33 0.00% 43 42 0.00% 44 42 0.00% 45 48 0.00% 46 64 0.00% 47 79 0.00% 48 91 0.00% 49 91 0.00% 50 113 0.00% 51 140 0.00% 52 132 0.00% 53 156 0.00% 54 159 0.00% 55 191 0.00% 56 167 0.00% 57 209 0.00% 58 210 0.00% 59 278 0.00% 60 287 0.00% 61 360 0.00% 62 378 0.00% 63 446 0.00% 64 457 0.00% 65 512 0.00% 66 555 0.00% 67 608 0.00% 68 683 0.00% 69 751 0.00% 70 869 0.00% 71 992 0.00% 72 1183 0.01% 73 1261 0.01% 74 1442 0.01% 75 1620 0.01% 76 1795 0.01% 77 1999 0.01% 78 2099 0.01% 79 2260 0.01% 80 2508 0.01% 81 2854 0.01% 82 3270 0.02% 83 3654 0.02% 84 4740 0.02% 85 5640 0.03% 86 6060 0.03% 87 6720 0.03% 88 6707 0.03% 89 7034 0.04% 90 7292 0.04% 91 7872 0.04% 92 8288 0.04% 93 8944 0.04% 94 9874 0.05% 95 10351 0.05% 96 10692 0.05% 97 10873 0.05% 98 11472 0.06% 99 12025 0.06% 100 12765 0.06% 101 13675 0.07% 102 14488 0.07% 103 15107 0.08% 104 15634 0.08% 105 16615 0.08% 106 17563 0.09% 107 18058 0.09% 108 18494 0.09% 109 19294 0.10% 110 20166 0.10% 111 21001 0.10% 112 21925 0.11% 113 23002 0.11% 114 23835 0.12% 115 24813 0.12% 116 25760 0.13% 117 26592 0.13% 118 27458 0.14% 119 28168 0.14% 120 29521 0.15% 121 30400 0.15% 122 32004 0.16% 123 34099 0.17% 124 35506 0.18% 125 37198 0.19% 126 38682 0.19% 127 41250 0.21% 128 42855 0.21% 129 43358 0.22% 130 46016 0.23% 131 47955 0.24% 132 51719 0.26% 133 54661 0.27% 134 58872 0.29% 135 62392 0.31% 136 67777 0.34% 137 73343 0.36% 138 80030 0.40% 139 89140 0.44% 140 98727 0.49% 141 111390 0.55% 142 127877 0.64% 143 148916 0.74% 144 175991 0.88% 145 215565 1.07% 146 272664 1.36% 147 380656 1.89% 148 584134 2.91% 149 1164729 5.80% 150 5323219 26.49% 151 9920012 49.37% 20095135 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=18 prefix-density=0.33 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=39.74 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.3 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=17 prefix-density=0.40 prefix-fanout=2.4 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=293.76 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=14.9 sequence=CAACAACTTCCATAAACAATCTCAAAACACAGAGAAGTTTCTTTGGTTTTTTTATCATGTCGTTGCTTTCAGATCTCATTAACCTTAACCTCTCAGACTCCACTGAGAAAATCATTGCTGAGTACTTATGGATTGGTGGATCTGGATTGGATATAAGGAGCAAAGCAAGGACTCTTTCCGGCCCAGTTAGTGATCCTGCAAAGCTTCCCAAATGGAACTATGATGGTTCCAGCACAGGCCAGGCTCCTGGACAAGACAGTGAAGTGATCCTATATCCACAAGCTATTTTCAGAGATCCATTTAGGAGGGGCAATAACATCCTCGTCATATGTGACGCTTATACTCCTGCTGGCGAGCCAATTCCGACAAATAAGAGATGTGATGCTGCTAAGATATTCAGCCATCCTGATGTTGTTG SRR7170624 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:30:14 Started mapping on | Feb 13 12:30:15 Finished on | Feb 13 12:33:34 Mapping speed, Million of reads per hour | 363.53 Number of input reads | 20095135 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18801721 Uniquely mapped reads % | 93.56% Average mapped length | 294.66 Number of splices: Total | 19035150 Number of splices: Annotated (sjdb) | 18574863 Number of splices: GT/AG | 18689132 Number of splices: GC/AG | 271175 Number of splices: AT/AC | 10723 Number of splices: Non-canonical | 64120 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 595757 % of reads mapped to multiple loci | 2.96% Number of reads mapped to too many loci | 63629 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 716041 716041 716041 N_multimapping 595757 595757 595757 N_noFeature 765531 18517333 857401 N_ambiguous 353524 1632 159964 UnstrandedReadsAssigned:17682666 PositiveStrandReadsAssigned:282756 NegativeStrandReadsAssigned:17784356 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170624 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170624-trimmed-pair1.fastq SRR7170624-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,095,135 reads, 17,634,327 reads pseudoaligned [quant] estimated average fragment length: 278.333 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR7170624.ke.tsv 34699 SRR7170624.se.tsv 87100 total ==> SRR7170624.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.67 1887 60.1587 Potri.005G024800.1.v4.1 1035 757.667 622 45.557 Potri.004G059700.1.v4.1 961 683.794 3 0.243466 Potri.007G009000.2.v4.1 1416 1138.67 0 0 Potri.003G141000.2.v4.1 2943 2665.67 1467.87 30.558 Potri.016G087400.1.v4.1 270 72.7534 1289 983.2 Potri.015G069301.1.v4.1 564 296.947 0 0 Potri.010G195200.1.v4.1 1773 1495.67 1352.98 50.1993 Potri.012G127500.1.v4.1 977 699.745 145 11.4993 ==> SRR7170624.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 503 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 289 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 141 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR7170624 completed mapping pipeline successfully