Starting /dee2/code/volunteer_pipeline.sh SRR7170625 current disk space = 3091139760128 free memory = 1582060588 SRR7170625 SRAfilesize 3ff936a7b75ea20d88df5baf334dc365 SRR7170625.sra SRR7170625.sra file validated SRR7170625 is paired end SRR7170625 is conventional basespace SRR7170625 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170625_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.23875 30.0 18.0 33.0 18.0 33.0 2 29.21075 31.0 28.0 33.0 25.0 33.0 3 31.79625 33.0 31.0 33.0 29.0 33.0 4 32.25325 33.0 33.0 33.0 31.0 34.0 5 32.6835 33.0 33.0 34.0 32.0 34.0 6 37.015 38.0 37.0 38.0 35.0 38.0 7 37.358 38.0 38.0 38.0 37.0 38.0 8 37.359 38.0 38.0 38.0 37.0 38.0 9 37.4375 38.0 38.0 38.0 37.0 38.0 10-14 37.397149999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.4219 38.0 38.0 38.0 37.0 38.0 20-24 37.456 38.0 38.0 38.0 37.6 38.0 25-29 37.47795 38.0 38.0 38.0 37.4 38.0 30-34 37.490500000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.44375 38.0 38.0 38.0 37.2 38.0 40-44 37.411500000000004 38.0 38.0 38.0 37.2 38.0 45-49 37.363550000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.29460000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.176 38.0 38.0 38.0 36.2 38.0 60-64 37.163650000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.0763 38.0 38.0 38.0 36.0 38.0 70-74 37.017399999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.9503 38.0 38.0 38.0 35.6 38.0 80-84 36.822500000000005 38.0 38.0 38.0 35.2 38.0 85-89 36.76015 38.0 38.0 38.0 34.8 38.0 90-94 36.6048 38.0 38.0 38.0 34.4 38.0 95-99 36.502849999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.3803 38.0 37.8 38.0 34.0 38.0 105-109 36.182 38.0 37.2 38.0 33.4 38.0 110-114 36.0038 38.0 37.0 38.0 32.6 38.0 115-119 35.672000000000004 38.0 36.8 38.0 31.0 38.0 120-124 35.557249999999996 38.0 36.2 38.0 31.0 38.0 125-129 35.3173 38.0 36.0 38.0 29.0 38.0 130-134 34.97385 38.0 35.0 38.0 28.0 38.0 135-139 34.7305 38.0 34.2 38.0 28.0 38.0 140-144 34.01145 38.0 33.6 38.0 24.0 38.0 145-149 33.23845 38.0 33.0 38.0 20.6 38.0 150-151 28.685375 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 2.0 18 2.0 19 4.0 20 2.0 21 4.0 22 8.0 23 5.0 24 6.0 25 9.0 26 17.0 27 21.0 28 24.0 29 28.0 30 46.0 31 49.0 32 71.0 33 123.0 34 184.0 35 348.0 36 921.0 37 2120.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.46546010706092 16.314045373438695 12.643385164414989 32.57710935508539 2 19.925 25.75 37.7 16.625 3 16.1 31.45 28.925 23.525 4 20.599999999999998 36.425000000000004 22.625 20.349999999999998 5 19.924906132665832 37.12140175219024 23.554443053817273 19.39924906132666 6 15.7 36.275 25.25 22.775000000000002 7 12.325 19.55 46.475 21.65 8 18.55 20.9 29.049999999999997 31.5 9 17.7 21.15 30.85 30.3 10-14 19.325 30.115 26.900000000000002 23.66 15-19 19.33 28.79 27.67 24.21 20-24 19.085 28.645 28.355000000000004 23.915 25-29 19.255 28.52 28.26 23.965 30-34 19.1 28.765 28.405 23.73 35-39 19.46 29.044999999999998 27.515 23.98 40-44 19.64 29.145 27.650000000000002 23.565 45-49 19.93 29.104999999999997 27.275 23.69 50-54 19.355 29.65 26.965 24.03 55-59 19.2 29.275000000000002 27.474999999999998 24.05 60-64 19.61 28.749999999999996 27.55 24.09 65-69 20.035 28.765 27.834999999999997 23.365 70-74 19.805 28.65 27.675 23.87 75-79 19.84 28.04 27.994999999999997 24.125 80-84 19.955000000000002 28.215 28.044999999999998 23.785 85-89 20.075000000000003 28.28 28.015 23.630000000000003 90-94 20.03 28.305000000000003 27.529999999999998 24.135 95-99 20.075000000000003 28.365000000000002 27.93 23.630000000000003 100-104 20.605 28.845 27.105 23.445 105-109 20.345 28.155 28.18 23.32 110-114 20.695 28.005000000000003 27.765 23.535 115-119 20.935000000000002 28.365000000000002 27.26 23.44 120-124 20.9 28.165000000000003 27.495000000000005 23.44 125-129 20.34 28.315 27.62 23.724999999999998 130-134 20.655 28.52 27.365000000000002 23.46 135-139 20.419999999999998 28.285 27.389999999999997 23.905 140-144 21.215 27.700000000000003 27.145000000000003 23.94 145-149 20.89 28.24 27.08 23.79 150-151 20.525 28.625 26.487500000000004 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.5 22 3.5 23 4.0 24 5.0 25 5.0 26 7.0 27 10.0 28 13.0 29 20.0 30 24.0 31 32.5 32 46.0 33 51.0 34 61.5 35 89.0 36 106.5 37 135.5 38 156.5 39 170.5 40 186.5 41 210.0 42 242.5 43 243.5 44 262.0 45 269.0 46 251.0 47 226.5 48 200.5 49 179.0 50 162.0 51 141.5 52 110.5 53 87.5 54 66.5 55 54.0 56 44.5 57 33.0 58 25.0 59 18.0 60 13.5 61 11.0 62 7.5 63 6.0 64 3.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0897597977244 97.975 2 0.7332490518331226 1.4500000000000002 3 0.15170670037926676 0.44999999999999996 4 0.0 0.0 5 0.025284450063211124 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 3.15 0.0 0.0 0.0 0.0 124-125 3.475 0.0 0.0 0.0 0.0 126-127 3.85 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.387499999999999 0.0 0.0 0.0 0.0 132-133 4.6875 0.0 0.0 0.0 0.0 134-135 4.9625 0.0 0.0 0.0 0.0 136-137 5.1875 0.0 0.0 0.0 0.0 138-139 5.487500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTGAG 10 0.006836113 144.9625 9 >>END_MODULE SRR7170625 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170625_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.682 33.0 33.0 34.0 32.0 34.0 2 32.725 33.0 33.0 34.0 32.0 34.0 3 32.77625 33.0 33.0 34.0 32.0 34.0 4 32.72975 33.0 33.0 34.0 32.0 34.0 5 32.6915 34.0 33.0 34.0 32.0 34.0 6 36.76275 38.0 38.0 38.0 36.0 38.0 7 36.78625 38.0 38.0 38.0 36.0 38.0 8 36.938 38.0 38.0 38.0 36.0 38.0 9 36.87225 38.0 38.0 38.0 36.0 38.0 10-14 36.857600000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.89185 38.0 38.0 38.0 36.0 38.0 20-24 36.776050000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.81785 38.0 38.0 38.0 36.0 38.0 30-34 36.818200000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.7915 38.0 38.0 38.0 36.0 38.0 40-44 36.72795 38.0 38.0 38.0 36.0 38.0 45-49 36.69895 38.0 38.0 38.0 36.0 38.0 50-54 36.60795 38.0 38.0 38.0 35.4 38.0 55-59 36.527100000000004 38.0 38.0 38.0 35.0 38.0 60-64 36.55800000000001 38.0 38.0 38.0 35.0 38.0 65-69 36.46215 38.0 38.0 38.0 34.8 38.0 70-74 36.436099999999996 38.0 38.0 38.0 34.6 38.0 75-79 36.3932 38.0 38.0 38.0 34.2 38.0 80-84 36.246050000000004 38.0 38.0 38.0 34.2 38.0 85-89 36.07919999999999 38.0 38.0 38.0 33.8 38.0 90-94 35.951800000000006 38.0 38.0 38.0 33.2 38.0 95-99 35.8706 38.0 37.6 38.0 32.6 38.0 100-104 35.663599999999995 38.0 37.0 38.0 31.8 38.0 105-109 35.573249999999994 38.0 37.0 38.0 31.0 38.0 110-114 35.3438 38.0 36.8 38.0 30.0 38.0 115-119 35.14475 38.0 36.2 38.0 28.6 38.0 120-124 34.971199999999996 38.0 36.0 38.0 28.2 38.0 125-129 34.5306 38.0 35.2 38.0 26.2 38.0 130-134 34.069100000000006 38.0 33.6 38.0 23.8 38.0 135-139 33.483000000000004 38.0 33.0 38.0 20.8 38.0 140-144 32.929050000000004 38.0 33.0 38.0 17.6 38.0 145-149 31.94845 38.0 32.6 38.0 10.8 38.0 150-151 26.451375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 12.0 4 2.0 5 3.0 6 0.0 7 2.0 8 1.0 9 2.0 10 2.0 11 3.0 12 3.0 13 1.0 14 4.0 15 2.0 16 3.0 17 7.0 18 11.0 19 6.0 20 9.0 21 13.0 22 18.0 23 14.0 24 14.0 25 20.0 26 23.0 27 28.0 28 26.0 29 43.0 30 49.0 31 58.0 32 87.0 33 111.0 34 177.0 35 310.0 36 714.0 37 2210.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.0 16.950000000000003 15.925 30.125 2 24.675 22.575 35.25 17.5 3 19.375 27.575 32.25 20.8 4 25.474999999999998 34.150000000000006 21.325 19.05 5 22.900000000000002 38.75 20.424999999999997 17.925 6 17.218045112781954 39.122807017543856 24.887218045112782 18.771929824561404 7 17.100650976464696 15.673510265398097 45.99399098647972 21.231847771657485 8 21.4321482223335 20.43064596895343 28.41762643965949 29.719579369053577 9 22.8342513770656 23.460190285428144 28.16725087631447 25.53830746119179 10-14 22.90007513148009 28.199348860505886 27.362885048835462 21.537690959178562 15-19 22.768013619748636 28.245956637123832 27.930499223874616 21.055530519252915 20-24 22.647176611934324 28.89967961553865 28.15378454144974 20.299359231077293 25-29 22.67334167709637 28.44055068836045 27.97496871088861 20.91113892365457 30-34 22.76732078494193 28.15378454144974 28.374048858630356 20.704845814977972 35-39 23.28993490235353 28.14221331997997 27.85177766649975 20.716074111166748 40-44 22.779225987567674 28.088028875075192 27.762181672348106 21.370563465009024 45-49 22.784176264396592 28.41261892839259 27.96695042563846 20.83625438157236 50-54 23.765401182009416 27.241310227386556 28.26805569468096 20.725232895923067 55-59 23.72388919501077 27.265441065972045 27.791414116114808 21.21925562290237 60-64 23.73772791023843 27.61971548787818 27.564616309356843 21.07794029252655 65-69 23.17048753628992 27.505255781359494 27.930723796175794 21.393532886174793 70-74 23.062287202082913 27.86901662327258 27.783897456439018 21.28479871820549 75-79 23.216699204084698 27.401511738499273 28.302547930119637 21.07924112729639 80-84 23.62571342745569 28.28176629618504 27.470711925503156 20.621808350856114 85-89 23.045720867344382 28.479142671140266 27.783063748810655 20.692072712704693 90-94 23.876038850505658 28.18664263542605 26.945028537098224 20.99228997697006 95-99 23.67696390126671 27.887648325239073 27.66735092374706 20.76803684974716 100-104 23.734668335419272 27.0738423028786 28.400500625782225 20.7909887359199 105-109 23.814056003606673 27.365626408856386 28.292340830536496 20.527976757000452 110-114 23.096968178401404 28.87496867952894 27.30643948884991 20.721623653219744 115-119 23.731275988176943 28.11983367566755 27.508641851610644 20.640248484544863 120-124 23.9006310728238 28.388260042071522 27.7822297906441 19.928879094460584 125-129 24.26216365185148 27.664478629052464 27.910006514005108 20.163351205090947 130-134 24.47527926664329 28.407553974853478 27.160246455943494 19.956920302559737 135-139 24.032872319102026 27.465423932651834 27.921427139707355 20.580276608538785 140-144 24.628961091054954 28.374448455675893 27.286401925391097 19.71018852787806 145-149 25.311452444088655 27.848101265822784 26.952519137439335 19.88792715264922 150-151 24.353044130516317 27.953494186773348 28.066008251031377 19.62745343167896 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.5 6 1.5 7 1.0 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.5 20 1.0 21 1.0 22 3.0 23 2.5 24 2.0 25 5.0 26 4.0 27 4.0 28 11.0 29 12.5 30 14.5 31 24.0 32 27.5 33 34.0 34 48.0 35 68.0 36 89.0 37 98.5 38 119.0 39 162.0 40 183.5 41 222.0 42 253.0 43 268.5 44 286.0 45 273.5 46 248.0 47 230.5 48 229.0 49 202.0 50 173.0 51 147.0 52 110.5 53 97.0 54 93.0 55 68.5 56 41.5 57 33.5 58 28.0 59 21.0 60 17.0 61 11.0 62 8.5 63 4.0 64 2.5 65 1.5 66 1.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.25 7 0.15 8 0.15 9 0.15 10-14 0.17500000000000002 15-19 0.145 20-24 0.12 25-29 0.125 30-34 0.12 35-39 0.15 40-44 0.26 45-49 0.15 50-54 0.16999999999999998 55-59 0.185 60-64 0.18 65-69 0.11 70-74 0.13999999999999999 75-79 0.11499999999999999 80-84 0.13 85-89 0.155 90-94 0.13 95-99 0.135 100-104 0.125 105-109 0.185 110-114 0.22499999999999998 115-119 0.19499999999999998 120-124 0.16999999999999998 125-129 0.215 130-134 0.185 135-139 0.22 140-144 0.27999999999999997 145-149 0.065 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29221435793731 98.2 2 0.4802831142568251 0.95 3 0.15166835187057634 0.44999999999999996 4 0.05055611729019212 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02527805864509606 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.075 0.0 0.0 0.0 0.0 124-125 3.4 0.0 0.0 0.0 0.0 126-127 3.7874999999999996 0.0 0.0 0.0 0.0 128-129 4.0875 0.0 0.0 0.0 0.0 130-131 4.3125 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 4.9 0.0 0.0 0.0 0.0 136-137 5.1375 0.0 0.0 0.0 0.0 138-139 5.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGCCT 10 0.006830828 145.0 4 >>END_MODULE Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796387 spots for SRR7170625.sra Written 796387 spots for SRR7170625.sra Read 796404 spots for SRR7170625.sra Written 796404 spots for SRR7170625.sra SRR ids: ['SRR7170625.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lhqqppwf SRR7170625.sra spots: 15927757 blocks: [[1, 796387], [796388, 1592774], [1592775, 2389161], [2389162, 3185548], [3185549, 3981935], [3981936, 4778322], [4778323, 5574709], [5574710, 6371096], [6371097, 7167483], [7167484, 7963870], [7963871, 8760257], [8760258, 9556644], [9556645, 10353031], [10353032, 11149418], [11149419, 11945805], [11945806, 12742192], [12742193, 13538579], [13538580, 14334966], [14334967, 15131353], [15131354, 15927757]] SRR7170625 file size 5375693 SRR7170625 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170625 SRR7170625_1.fastq SRR7170625_2.fastq Input file: SRR7170625_1.fastq Paired file: SRR7170625_2.fastq trimmed: SRR7170625-trimmed-pair1.fastq, SRR7170625-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:18:49 2025 >> started Thu Feb 13 13:19:05 2025 >> done (16.396s) 15927757 read pairs processed; of these: 18413 ( 0.12%) short read pairs filtered out after trimming by size control 27285 ( 0.17%) empty read pairs filtered out after trimming by size control 15882059 (99.71%) read pairs available; of these: 8377112 (52.75%) trimmed read pairs available after processing 7504947 (47.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 12 0.00% 20 6 0.00% 21 8 0.00% 22 6 0.00% 23 13 0.00% 24 10 0.00% 25 13 0.00% 26 11 0.00% 27 8 0.00% 28 11 0.00% 29 5 0.00% 30 11 0.00% 31 26 0.00% 32 10 0.00% 33 16 0.00% 34 13 0.00% 35 14 0.00% 36 17 0.00% 37 20 0.00% 38 25 0.00% 39 28 0.00% 40 34 0.00% 41 30 0.00% 42 29 0.00% 43 43 0.00% 44 47 0.00% 45 46 0.00% 46 52 0.00% 47 86 0.00% 48 73 0.00% 49 103 0.00% 50 79 0.00% 51 129 0.00% 52 119 0.00% 53 148 0.00% 54 124 0.00% 55 155 0.00% 56 176 0.00% 57 188 0.00% 58 246 0.00% 59 244 0.00% 60 301 0.00% 61 304 0.00% 62 381 0.00% 63 396 0.00% 64 470 0.00% 65 466 0.00% 66 505 0.00% 67 617 0.00% 68 647 0.00% 69 760 0.00% 70 820 0.01% 71 974 0.01% 72 1137 0.01% 73 1313 0.01% 74 1370 0.01% 75 1643 0.01% 76 1904 0.01% 77 2232 0.01% 78 2131 0.01% 79 2250 0.01% 80 2486 0.02% 81 2810 0.02% 82 3333 0.02% 83 3814 0.02% 84 4837 0.03% 85 5322 0.03% 86 5827 0.04% 87 6086 0.04% 88 6423 0.04% 89 6854 0.04% 90 7041 0.04% 91 7591 0.05% 92 7990 0.05% 93 8943 0.06% 94 9522 0.06% 95 9879 0.06% 96 10378 0.07% 97 10749 0.07% 98 11072 0.07% 99 11841 0.07% 100 12281 0.08% 101 13007 0.08% 102 13852 0.09% 103 14447 0.09% 104 15367 0.10% 105 16301 0.10% 106 16911 0.11% 107 17367 0.11% 108 17750 0.11% 109 18445 0.12% 110 18985 0.12% 111 19808 0.12% 112 20708 0.13% 113 22054 0.14% 114 22423 0.14% 115 23840 0.15% 116 23856 0.15% 117 24759 0.16% 118 25242 0.16% 119 26451 0.17% 120 27492 0.17% 121 28520 0.18% 122 29310 0.18% 123 31035 0.20% 124 32575 0.21% 125 33930 0.21% 126 35469 0.22% 127 37115 0.23% 128 39384 0.25% 129 39749 0.25% 130 41736 0.26% 131 43627 0.27% 132 46548 0.29% 133 49293 0.31% 134 52550 0.33% 135 56171 0.35% 136 60529 0.38% 137 66017 0.42% 138 71087 0.45% 139 78229 0.49% 140 86322 0.54% 141 97015 0.61% 142 110134 0.69% 143 127392 0.80% 144 148672 0.94% 145 181895 1.15% 146 228357 1.44% 147 314421 1.98% 148 482681 3.04% 149 958107 6.03% 150 4192038 26.39% 151 7504947 47.25% 15882059 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=17 prefix-density=0.49 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=45.92 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.9 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=20 prefix-density=0.49 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=33.95 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.7 sequence=CAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCA SRR7170625 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:19:50 Started mapping on | Feb 13 13:19:50 Finished on | Feb 13 13:21:57 Mapping speed, Million of reads per hour | 450.20 Number of input reads | 15882059 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14685594 Uniquely mapped reads % | 92.47% Average mapped length | 293.95 Number of splices: Total | 14374217 Number of splices: Annotated (sjdb) | 14040080 Number of splices: GT/AG | 14101429 Number of splices: GC/AG | 217848 Number of splices: AT/AC | 9490 Number of splices: Non-canonical | 45450 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 425052 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 102293 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.10% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 787580 787580 787580 N_multimapping 425052 425052 425052 N_noFeature 582110 14375030 669007 N_ambiguous 329773 1437 105364 UnstrandedReadsAssigned:13773711 PositiveStrandReadsAssigned:309127 NegativeStrandReadsAssigned:13911223 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170625 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170625-trimmed-pair1.fastq SRR7170625-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,882,059 reads, 13,768,277 reads pseudoaligned [quant] estimated average fragment length: 264.589 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 981 rounds 52401 SRR7170625.ke.tsv 34699 SRR7170625.se.tsv 87100 total ==> SRR7170625.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.41 671 22.9289 Potri.005G024800.1.v4.1 1035 771.411 473 36.7593 Potri.004G059700.1.v4.1 961 697.459 11 0.945511 Potri.007G009000.2.v4.1 1416 1152.41 0 0 Potri.003G141000.2.v4.1 2943 2679.41 912.868 20.4249 Potri.016G087400.1.v4.1 270 75.755 740 585.616 Potri.015G069301.1.v4.1 564 307.556 0 0 Potri.010G195200.1.v4.1 1773 1509.41 441.954 17.5534 Potri.012G127500.1.v4.1 977 713.432 294 24.7051 ==> SRR7170625.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 678 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 26 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 192 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR7170625 completed mapping pipeline successfully