Starting /dee2/code/volunteer_pipeline.sh SRR7170626 current disk space = 3090674872320 free memory = 1576546712 SRR7170626 SRAfilesize e7199c425c58efec9b6d0f0d5cd45ba7 SRR7170626.sra SRR7170626.sra file validated SRR7170626 is paired end SRR7170626 is conventional basespace SRR7170626 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170626_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.445 18.0 18.0 30.0 18.0 32.0 2 30.368 31.0 29.0 33.0 27.0 33.0 3 30.9385 33.0 30.0 33.0 27.0 33.0 4 31.66325 33.0 31.0 33.0 29.0 33.0 5 32.66325 33.0 33.0 33.0 32.0 34.0 6 37.03325 38.0 37.0 38.0 36.0 38.0 7 37.3175 38.0 38.0 38.0 37.0 38.0 8 37.36275 38.0 38.0 38.0 37.0 38.0 9 37.31575 38.0 38.0 38.0 37.0 38.0 10-14 37.30995 38.0 38.0 38.0 37.0 38.0 15-19 37.300599999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.3911 38.0 38.0 38.0 37.0 38.0 25-29 37.40585 38.0 38.0 38.0 37.0 38.0 30-34 37.380100000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.39415 38.0 38.0 38.0 37.0 38.0 40-44 37.324799999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.28189999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.12845 38.0 38.0 38.0 36.2 38.0 55-59 37.057100000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.98694999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.96325 38.0 38.0 38.0 36.0 38.0 70-74 36.85205 38.0 38.0 38.0 35.2 38.0 75-79 36.7573 38.0 38.0 38.0 34.8 38.0 80-84 36.686 38.0 38.0 38.0 34.4 38.0 85-89 36.5911 38.0 38.0 38.0 34.0 38.0 90-94 36.41435 38.0 37.8 38.0 34.0 38.0 95-99 36.294000000000004 38.0 37.0 38.0 33.8 38.0 100-104 36.1066 38.0 37.0 38.0 33.2 38.0 105-109 36.0179 38.0 37.0 38.0 32.6 38.0 110-114 35.710950000000004 38.0 36.8 38.0 31.0 38.0 115-119 35.37895 38.0 36.0 38.0 29.4 38.0 120-124 35.2718 38.0 36.0 38.0 28.6 38.0 125-129 34.9346 38.0 35.0 38.0 27.8 38.0 130-134 34.700149999999994 38.0 34.8 38.0 27.4 38.0 135-139 34.3409 38.0 34.2 38.0 24.6 38.0 140-144 33.648900000000005 38.0 33.2 38.0 22.2 38.0 145-149 32.7558 38.0 32.8 38.0 16.2 38.0 150-151 28.435875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 3.0 17 1.0 18 5.0 19 2.0 20 2.0 21 4.0 22 4.0 23 2.0 24 11.0 25 6.0 26 13.0 27 23.0 28 33.0 29 46.0 30 52.0 31 73.0 32 97.0 33 141.0 34 191.0 35 433.0 36 999.0 37 1854.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.53915275994866 19.101412066752246 13.01668806161746 27.342747111681643 2 19.900000000000002 24.275 36.325 19.5 3 16.525000000000002 32.125 27.800000000000004 23.549999999999997 4 20.5 37.1 23.400000000000002 19.0 5 20.06504878658994 38.10357768326244 22.241681260945708 19.5896922692019 6 16.75 36.3 24.349999999999998 22.6 7 13.5 19.975 45.125 21.4 8 17.7 21.525 27.525 33.25 9 16.725 21.9 30.5 30.875000000000004 10-14 19.845 29.959999999999997 26.015 24.18 15-19 19.465 29.485 27.305 23.745 20-24 19.705000000000002 28.835 27.845 23.615 25-29 19.82 29.23 27.76 23.189999999999998 30-34 19.96 28.935 28.189999999999998 22.915 35-39 19.68 29.12 27.310000000000002 23.89 40-44 19.585 28.925 27.99 23.5 45-49 19.744999999999997 29.275000000000002 27.11 23.87 50-54 19.939999999999998 28.535 27.529999999999998 23.995 55-59 20.21 28.439999999999998 28.060000000000002 23.29 60-64 20.175 28.715000000000003 27.72 23.39 65-69 20.32 28.17 27.71 23.799999999999997 70-74 19.695 28.994999999999997 27.950000000000003 23.36 75-79 20.435 28.355000000000004 27.975 23.235 80-84 20.055 28.76 26.93 24.255 85-89 20.330000000000002 28.355000000000004 27.744999999999997 23.57 90-94 20.125 29.154999999999998 27.389999999999997 23.330000000000002 95-99 19.985 28.535 27.994999999999997 23.485 100-104 20.76 28.595 27.36 23.285 105-109 21.055 28.04 27.665 23.24 110-114 20.674999999999997 28.535 27.279999999999998 23.51 115-119 20.13 28.63 27.565 23.674999999999997 120-124 20.990000000000002 28.115000000000002 27.305 23.59 125-129 20.79 28.000000000000004 27.275 23.935000000000002 130-134 21.285 28.115000000000002 27.575 23.025000000000002 135-139 20.715 28.360000000000003 27.11 23.815 140-144 21.345 27.825 27.38 23.45 145-149 20.77 28.235 27.26 23.735 150-151 20.875 28.175 27.487499999999997 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 2.0 20 2.5 21 2.5 22 2.0 23 3.0 24 7.0 25 7.5 26 5.0 27 7.0 28 14.0 29 21.0 30 25.0 31 26.0 32 36.5 33 54.0 34 64.0 35 82.0 36 103.0 37 115.5 38 139.0 39 166.0 40 177.0 41 202.0 42 247.0 43 267.0 44 270.0 45 271.5 46 268.5 47 241.0 48 209.0 49 195.0 50 167.0 51 139.0 52 113.5 53 83.0 54 63.5 55 55.0 56 45.0 57 31.0 58 18.0 59 15.5 60 14.0 61 6.0 62 3.5 63 4.0 64 1.5 65 1.0 66 2.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26804644119132 98.32499999999999 2 0.5805148914689551 1.15 3 0.10095911155981827 0.3 4 0.025239777889954566 0.1 5 0.025239777889954566 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.2625 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.7750000000000004 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.35 0.0 0.0 0.0 0.0 132-133 3.575 0.0 0.0 0.0 0.0 134-135 3.7874999999999996 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGACT 10 0.006830828 145.0 8 CTGAATC 10 0.006830828 145.0 4 >>END_MODULE SRR7170626 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170626_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61275 33.0 33.0 34.0 32.0 34.0 2 32.7335 33.0 33.0 34.0 32.0 34.0 3 32.72675 33.0 33.0 34.0 32.0 34.0 4 32.67125 34.0 33.0 34.0 32.0 34.0 5 32.702 34.0 33.0 34.0 32.0 34.0 6 36.8055 38.0 38.0 38.0 36.0 38.0 7 36.76425 38.0 38.0 38.0 36.0 38.0 8 36.80275 38.0 38.0 38.0 36.0 38.0 9 36.8375 38.0 38.0 38.0 36.0 38.0 10-14 36.8258 38.0 38.0 38.0 36.0 38.0 15-19 36.832300000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.721900000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.757799999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.64005 38.0 38.0 38.0 35.8 38.0 35-39 36.64535 38.0 38.0 38.0 35.8 38.0 40-44 36.61415000000001 38.0 38.0 38.0 35.6 38.0 45-49 36.6032 38.0 38.0 38.0 35.8 38.0 50-54 36.46005 38.0 38.0 38.0 35.2 38.0 55-59 36.376549999999995 38.0 38.0 38.0 34.4 38.0 60-64 36.42444999999999 38.0 38.0 38.0 34.8 38.0 65-69 36.33774999999999 38.0 38.0 38.0 34.2 38.0 70-74 36.3012 38.0 38.0 38.0 34.2 38.0 75-79 36.2087 38.0 38.0 38.0 34.0 38.0 80-84 36.06079999999999 38.0 38.0 38.0 33.8 38.0 85-89 35.956450000000004 38.0 38.0 38.0 33.6 38.0 90-94 35.84385 38.0 37.8 38.0 33.2 38.0 95-99 35.69075 38.0 37.4 38.0 32.6 38.0 100-104 35.469 38.0 37.0 38.0 31.0 38.0 105-109 35.3293 38.0 37.0 38.0 30.6 38.0 110-114 35.07615 38.0 36.8 38.0 28.6 38.0 115-119 34.9118 38.0 36.0 38.0 27.8 38.0 120-124 34.739850000000004 38.0 36.0 38.0 27.4 38.0 125-129 34.3454 38.0 34.8 38.0 25.4 38.0 130-134 33.818799999999996 38.0 33.4 38.0 22.8 38.0 135-139 33.36735 38.0 33.0 38.0 20.8 38.0 140-144 32.73345 38.0 33.0 38.0 14.0 38.0 145-149 31.768199999999997 38.0 32.4 38.0 8.4 38.0 150-151 26.707124999999998 34.0 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 13.0 4 5.0 5 2.0 6 6.0 7 5.0 8 4.0 9 0.0 10 3.0 11 6.0 12 5.0 13 4.0 14 9.0 15 8.0 16 5.0 17 3.0 18 13.0 19 4.0 20 7.0 21 8.0 22 7.0 23 13.0 24 13.0 25 19.0 26 13.0 27 26.0 28 30.0 29 49.0 30 56.0 31 63.0 32 88.0 33 127.0 34 175.0 35 293.0 36 692.0 37 2213.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.4 16.75 13.350000000000001 25.5 2 23.375 22.725 34.225 19.675 3 20.0 26.25 32.175 21.575 4 24.2 34.2 22.35 19.25 5 22.575 37.125 22.15 18.15 6 16.950425638457688 39.233850776164246 23.610415623435152 20.205307961942914 7 16.89189189189189 15.865865865865866 45.3953953953954 21.846846846846844 8 20.42042042042042 21.046046046046047 27.57757757757758 30.955955955955954 9 21.22122122122122 23.6986986986987 28.57857857857858 26.5015015015015 10-14 22.13935328861748 28.471318450295325 27.60036039643608 21.788967864651116 15-19 22.73750562809545 27.700235129321126 28.250537795787682 21.311721446795737 20-24 23.041128790153106 28.404883418392874 27.26408485940158 21.28990293205244 25-29 22.85099569698789 28.124687281096765 28.064645251676172 20.959671770239165 30-34 22.372898318654926 27.962369895916733 28.49279423538831 21.17193755004003 35-39 22.486362043941742 28.206796456633803 27.781392322706573 21.52544917671788 40-44 22.53267237494367 28.27600020029042 27.94051374493015 21.250813679835762 45-49 23.025723150835752 27.82003803423081 27.950155139625664 21.20408367530778 50-54 22.78778778778779 27.807807807807805 27.732732732732735 21.67167167167167 55-59 23.040344378816698 27.620382420662732 27.895685253779156 21.443587946741417 60-64 23.206687690844472 28.08229463883466 27.04610301847124 21.664914651849625 65-69 22.67020159071582 27.67745485468461 28.26271822320044 21.389625331399127 70-74 23.047676221922057 27.30001500825454 28.360598329080993 21.29171044074241 75-79 22.552403822102157 28.060433238281057 27.840312171694432 21.546850767922358 80-84 23.394036421853112 28.061837102261357 27.601560936561935 20.942565539323592 85-89 23.475258918296895 28.408465502576675 27.557912643218092 20.558362935908338 90-94 23.201240868608025 28.019613729610725 27.969578705093568 20.809566696687682 95-99 23.32516135488067 27.35277930654926 27.953169560214143 21.368889778355932 100-104 23.58150705493846 27.43920744521165 27.984589212448714 20.994696287401183 105-109 23.62216549031386 27.832006807829003 27.937127696851377 20.608700005005755 110-114 23.400420546710723 28.05647341544007 28.12656453389406 20.41654150395514 115-119 23.657474600870827 27.305940643611432 27.781392322706573 21.25519243281117 120-124 23.923923923923923 28.393393393393396 27.982982982982985 19.6996996996997 125-129 23.482004304950692 27.85703559092957 28.022225559393306 20.638734544726436 130-134 24.151566723395735 27.43017319050956 27.850635699269194 20.567624386825507 135-139 24.097531667751465 27.89766184348871 27.677364441996694 20.32744204676313 140-144 23.998397435897438 27.67928685897436 27.774439102564102 20.547876602564102 145-149 24.171042760690174 28.212053013253314 27.29682420605151 20.320080020005 150-151 23.549999999999997 28.549999999999997 27.8875 20.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.5 7 1.5 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 1.0 14 1.0 15 1.0 16 1.5 17 0.5 18 1.5 19 2.0 20 2.0 21 2.5 22 1.5 23 2.5 24 5.0 25 7.5 26 8.5 27 8.5 28 9.5 29 12.0 30 16.0 31 22.5 32 31.5 33 38.5 34 46.5 35 61.0 36 74.5 37 92.0 38 125.5 39 157.5 40 183.0 41 209.0 42 237.0 43 254.5 44 265.5 45 259.5 46 269.0 47 258.5 48 216.5 49 194.0 50 175.0 51 157.0 52 126.5 53 101.0 54 88.5 55 74.0 56 60.5 57 39.0 58 24.0 59 25.0 60 16.0 61 9.0 62 6.0 63 4.5 64 3.0 65 1.5 66 1.0 67 0.5 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.15 7 0.1 8 0.1 9 0.1 10-14 0.11 15-19 0.055 20-24 0.06999999999999999 25-29 0.06999999999999999 30-34 0.08 35-39 0.095 40-44 0.145 45-49 0.09 50-54 0.1 55-59 0.11 60-64 0.11499999999999999 65-69 0.045 70-74 0.055 75-79 0.055 80-84 0.06 85-89 0.065 90-94 0.06999999999999999 95-99 0.065 100-104 0.06999999999999999 105-109 0.11499999999999999 110-114 0.13 115-119 0.095 120-124 0.1 125-129 0.11499999999999999 130-134 0.11 135-139 0.135 140-144 0.16 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78203501649327 97.32499999999999 2 0.96422227860949 1.9 3 0.2283684344075108 0.675 4 0.025374270489723422 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.3 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.8499999999999996 0.0 0.0 0.0 0.0 128-129 3.0875 0.0 0.0 0.0 0.0 130-131 3.35 0.0 0.0 0.0 0.0 132-133 3.575 0.0 0.0 0.0 0.0 134-135 3.7874999999999996 0.0 0.0 0.0 0.0 136-137 3.975 0.0 0.0 0.0 0.0 138-139 4.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGGAT 10 0.006830828 145.0 1 AGTCCAG 10 0.006830828 145.0 5 >>END_MODULE Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805049 spots for SRR7170626.sra Written 805049 spots for SRR7170626.sra Read 805053 spots for SRR7170626.sra Written 805053 spots for SRR7170626.sra SRR ids: ['SRR7170626.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m8p4f050 SRR7170626.sra spots: 16100984 blocks: [[1, 805049], [805050, 1610098], [1610099, 2415147], [2415148, 3220196], [3220197, 4025245], [4025246, 4830294], [4830295, 5635343], [5635344, 6440392], [6440393, 7245441], [7245442, 8050490], [8050491, 8855539], [8855540, 9660588], [9660589, 10465637], [10465638, 11270686], [11270687, 12075735], [12075736, 12880784], [12880785, 13685833], [13685834, 14490882], [14490883, 15295931], [15295932, 16100984]] SRR7170626 file size 5434394 SRR7170626 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170626 SRR7170626_1.fastq SRR7170626_2.fastq Input file: SRR7170626_1.fastq Paired file: SRR7170626_2.fastq trimmed: SRR7170626-trimmed-pair1.fastq, SRR7170626-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:38:46 2025 >> started Thu Feb 13 13:39:03 2025 >> done (16.805s) 16100984 read pairs processed; of these: 31709 ( 0.20%) short read pairs filtered out after trimming by size control 38864 ( 0.24%) empty read pairs filtered out after trimming by size control 16030411 (99.56%) read pairs available; of these: 8584007 (53.55%) trimmed read pairs available after processing 7446404 (46.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 3 0.00% 21 10 0.00% 22 17 0.00% 23 9 0.00% 24 15 0.00% 25 16 0.00% 26 11 0.00% 27 12 0.00% 28 9 0.00% 29 14 0.00% 30 11 0.00% 31 12 0.00% 32 16 0.00% 33 14 0.00% 34 14 0.00% 35 10 0.00% 36 12 0.00% 37 21 0.00% 38 30 0.00% 39 30 0.00% 40 32 0.00% 41 37 0.00% 42 41 0.00% 43 33 0.00% 44 33 0.00% 45 41 0.00% 46 55 0.00% 47 70 0.00% 48 65 0.00% 49 109 0.00% 50 95 0.00% 51 117 0.00% 52 121 0.00% 53 153 0.00% 54 139 0.00% 55 159 0.00% 56 168 0.00% 57 181 0.00% 58 206 0.00% 59 223 0.00% 60 265 0.00% 61 295 0.00% 62 378 0.00% 63 444 0.00% 64 423 0.00% 65 502 0.00% 66 532 0.00% 67 519 0.00% 68 587 0.00% 69 698 0.00% 70 842 0.01% 71 895 0.01% 72 1120 0.01% 73 1202 0.01% 74 1279 0.01% 75 1521 0.01% 76 1891 0.01% 77 2080 0.01% 78 1815 0.01% 79 2186 0.01% 80 2339 0.01% 81 2661 0.02% 82 3036 0.02% 83 3336 0.02% 84 4881 0.03% 85 5906 0.04% 86 6186 0.04% 87 6220 0.04% 88 6294 0.04% 89 6918 0.04% 90 7137 0.04% 91 7378 0.05% 92 7776 0.05% 93 8381 0.05% 94 9134 0.06% 95 9245 0.06% 96 9743 0.06% 97 9974 0.06% 98 10438 0.07% 99 10745 0.07% 100 11388 0.07% 101 11890 0.07% 102 12582 0.08% 103 13258 0.08% 104 13909 0.09% 105 14700 0.09% 106 14944 0.09% 107 15687 0.10% 108 16084 0.10% 109 16664 0.10% 110 17262 0.11% 111 17956 0.11% 112 18951 0.12% 113 19972 0.12% 114 20516 0.13% 115 21006 0.13% 116 21995 0.14% 117 22673 0.14% 118 23126 0.14% 119 23726 0.15% 120 24897 0.16% 121 25812 0.16% 122 27028 0.17% 123 28663 0.18% 124 29758 0.19% 125 31311 0.20% 126 32590 0.20% 127 34637 0.22% 128 36176 0.23% 129 37249 0.23% 130 39192 0.24% 131 40950 0.26% 132 43888 0.27% 133 47040 0.29% 134 50709 0.32% 135 54323 0.34% 136 58889 0.37% 137 64531 0.40% 138 69960 0.44% 139 77308 0.48% 140 85793 0.54% 141 97249 0.61% 142 111950 0.70% 143 130492 0.81% 144 153321 0.96% 145 190830 1.19% 146 242285 1.51% 147 334507 2.09% 148 519497 3.24% 149 1030338 6.43% 150 4324968 26.98% 151 7446404 46.45% 16030411 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=15 prefix-density=0.84 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=20 fanout-score=19.71 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=7.6 sequence=TCCTCCTTGTTGTACATGCCGGGAAGTTGCACATTTGTTGGGTTGTCAGCAATGTTCATGAGGGTAGCATTAACCATCTGGTTGTTGAC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=13 prefix-density=1.01 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=127.79 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.1 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170626 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:39:47 Started mapping on | Feb 13 13:39:48 Finished on | Feb 13 13:41:35 Mapping speed, Million of reads per hour | 539.34 Number of input reads | 16030411 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15069539 Uniquely mapped reads % | 94.01% Average mapped length | 294.20 Number of splices: Total | 15002132 Number of splices: Annotated (sjdb) | 14677821 Number of splices: GT/AG | 14703087 Number of splices: GC/AG | 249983 Number of splices: AT/AC | 8419 Number of splices: Non-canonical | 40643 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 392987 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 14032 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 594422 594422 594422 N_multimapping 392987 392987 392987 N_noFeature 539149 14800380 627678 N_ambiguous 298351 1175 116947 UnstrandedReadsAssigned:14232039 PositiveStrandReadsAssigned:267984 NegativeStrandReadsAssigned:14324914 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170626 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170626-trimmed-pair1.fastq SRR7170626-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,030,411 reads, 14,240,431 reads pseudoaligned [quant] estimated average fragment length: 279.679 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR7170626.ke.tsv 34699 SRR7170626.se.tsv 87100 total ==> SRR7170626.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.32 614 22.9033 Potri.005G024800.1.v4.1 1035 756.321 149 12.7817 Potri.004G059700.1.v4.1 961 682.401 4 0.380304 Potri.007G009000.2.v4.1 1416 1137.32 0 0 Potri.003G141000.2.v4.1 2943 2664.32 895.462 21.8057 Potri.016G087400.1.v4.1 270 74.1178 592 518.214 Potri.015G069301.1.v4.1 564 296.154 0 0 Potri.010G195200.1.v4.1 1773 1494.32 13 0.564429 Potri.012G127500.1.v4.1 977 698.352 47 4.3665 ==> SRR7170626.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 855 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170626 completed mapping pipeline successfully