Starting /dee2/code/volunteer_pipeline.sh SRR7170627 current disk space = 3090796011520 free memory = 1582084804 SRR7170627 SRAfilesize 0fbdbf53bab552b23fe152d20402bbfb SRR7170627.sra SRR7170627.sra file validated SRR7170627 is paired end SRR7170627 is conventional basespace SRR7170627 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170627_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.4675 30.0 18.0 33.0 18.0 33.0 2 30.25725 31.0 29.0 33.0 27.0 33.0 3 29.92725 31.0 29.0 33.0 25.0 33.0 4 30.7255 31.0 31.0 33.0 28.0 33.0 5 32.45325 33.0 33.0 33.0 32.0 33.0 6 36.6705 38.0 37.0 38.0 34.0 38.0 7 37.216 38.0 38.0 38.0 36.0 38.0 8 37.4535 38.0 38.0 38.0 37.0 38.0 9 37.44075 38.0 38.0 38.0 37.0 38.0 10-14 37.4112 38.0 38.0 38.0 37.0 38.0 15-19 37.457499999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.5351 38.0 38.0 38.0 37.8 38.0 25-29 37.53565 38.0 38.0 38.0 38.0 38.0 30-34 37.52375 38.0 38.0 38.0 38.0 38.0 35-39 37.52655 38.0 38.0 38.0 38.0 38.0 40-44 37.45895 38.0 38.0 38.0 37.0 38.0 45-49 37.4486 38.0 38.0 38.0 37.0 38.0 50-54 37.37515 38.0 38.0 38.0 37.0 38.0 55-59 37.358450000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.25599999999999 38.0 38.0 38.0 36.8 38.0 65-69 37.25064999999999 38.0 38.0 38.0 36.4 38.0 70-74 37.16330000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.008399999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.95615 38.0 38.0 38.0 35.8 38.0 85-89 36.9272 38.0 38.0 38.0 36.0 38.0 90-94 36.79525 38.0 38.0 38.0 35.4 38.0 95-99 36.63334999999999 38.0 38.0 38.0 34.6 38.0 100-104 36.5269 38.0 38.0 38.0 34.0 38.0 105-109 36.44015 38.0 38.0 38.0 34.0 38.0 110-114 36.2456 38.0 37.6 38.0 34.0 38.0 115-119 35.940999999999995 38.0 37.0 38.0 32.4 38.0 120-124 35.9063 38.0 37.0 38.0 32.6 38.0 125-129 35.7936 38.0 36.6 38.0 32.4 38.0 130-134 35.62675 38.0 36.0 38.0 31.6 38.0 135-139 35.312400000000004 38.0 36.0 38.0 31.0 38.0 140-144 34.84705 38.0 34.6 38.0 28.2 38.0 145-149 34.09715 38.0 33.6 38.0 25.8 38.0 150-151 30.063249999999996 35.5 27.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 3.0 19 9.0 20 4.0 21 2.0 22 4.0 23 5.0 24 6.0 25 5.0 26 12.0 27 16.0 28 23.0 29 18.0 30 44.0 31 44.0 32 72.0 33 102.0 34 139.0 35 263.0 36 770.0 37 2455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.52217997465146 15.766793409378959 13.38403041825095 38.326996197718636 2 18.575 25.75 38.45 17.224999999999998 3 17.325 29.349999999999998 28.025 25.3 4 21.0 35.625 21.125 22.25 5 19.804462271245924 38.5058912008022 23.89069942341439 17.798947104537476 6 16.025 36.6 26.0 21.375 7 11.95 18.85 47.425 21.775 8 17.75 20.875 28.95 32.425 9 17.974999999999998 21.275 31.075000000000003 29.675 10-14 18.84 30.385 26.240000000000002 24.535 15-19 19.830000000000002 28.610000000000003 27.73 23.830000000000002 20-24 19.56 28.46 28.03 23.95 25-29 19.715 28.875 27.67 23.74 30-34 19.375 29.235 27.355 24.035 35-39 20.255000000000003 28.76 26.935 24.05 40-44 20.22 28.910000000000004 27.565 23.305 45-49 20.995 28.244999999999997 27.134999999999998 23.625 50-54 20.44 28.660000000000004 27.305 23.595 55-59 19.689999999999998 29.14 27.48 23.69 60-64 20.255000000000003 28.425 27.384999999999998 23.935000000000002 65-69 20.415 28.970000000000002 27.200000000000003 23.415 70-74 20.27 28.71 27.77 23.25 75-79 20.544999999999998 27.900000000000002 27.6 23.955000000000002 80-84 20.465 28.000000000000004 27.495000000000005 24.04 85-89 20.035 28.225 27.029999999999998 24.709999999999997 90-94 21.099999999999998 28.075 27.43 23.395 95-99 21.005 28.285 26.939999999999998 23.77 100-104 20.495 28.415000000000003 27.72 23.369999999999997 105-109 20.48 27.944999999999997 27.07 24.505 110-114 21.029999999999998 27.92 26.99 24.060000000000002 115-119 21.07 28.084999999999997 27.339999999999996 23.505000000000003 120-124 20.885 27.76 27.46 23.895 125-129 20.645 27.694999999999997 27.18 24.48 130-134 20.849999999999998 27.639999999999997 27.400000000000002 24.11 135-139 21.035 27.705000000000002 27.495000000000005 23.765 140-144 21.105 27.52 27.105 24.27 145-149 20.69 28.165000000000003 26.900000000000002 24.245 150-151 21.43839899937461 27.567229518449032 26.67917448405253 24.315196998123827 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 2.5 22 3.5 23 3.5 24 3.0 25 2.5 26 7.0 27 11.0 28 15.0 29 19.0 30 25.5 31 29.5 32 33.5 33 50.5 34 68.0 35 83.5 36 103.0 37 122.5 38 135.0 39 152.5 40 180.5 41 194.0 42 223.0 43 244.5 44 243.0 45 244.0 46 252.0 47 241.5 48 211.5 49 190.0 50 173.5 51 159.0 52 130.0 53 99.5 54 75.0 55 71.0 56 62.5 57 44.0 58 28.0 59 18.5 60 15.0 61 8.5 62 8.0 63 4.5 64 1.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67515923566879 96.825 2 0.9936305732484076 1.95 3 0.22929936305732482 0.675 4 0.025477707006369425 0.1 5 0.025477707006369425 0.125 6 0.025477707006369425 0.15 7 0.025477707006369425 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 2 (97% over 37bp) CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 6 0.15 No Hit CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0125 0.0 76-77 0.075 0.0 0.0 0.025 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.0875 0.0 0.0 0.025 0.0 82-83 0.1375 0.0 0.0 0.025 0.0 84-85 0.21250000000000002 0.0 0.0 0.025 0.0 86-87 0.275 0.0 0.0 0.025 0.0 88-89 0.3375 0.0 0.0 0.025 0.0 90-91 0.3875 0.0 0.0 0.025 0.0 92-93 0.5125 0.0 0.0 0.025 0.0 94-95 0.7125 0.0 0.0 0.025 0.0 96-97 0.825 0.0 0.0 0.025 0.0 98-99 0.925 0.0 0.0 0.025 0.0 100-101 1.0625 0.0 0.0 0.025 0.0 102-103 1.2000000000000002 0.0 0.0 0.025 0.0 104-105 1.35 0.0 0.0 0.025 0.0 106-107 1.525 0.0 0.0 0.025 0.0 108-109 1.5875 0.0 0.0 0.025 0.0 110-111 1.7875 0.0 0.0 0.025 0.0 112-113 1.9125 0.0 0.0 0.025 0.0 114-115 2.075 0.0 0.0 0.025 0.0 116-117 2.2125 0.0 0.0 0.025 0.0 118-119 2.375 0.0 0.0 0.025 0.0 120-121 2.5 0.0 0.0 0.025 0.0 122-123 2.775 0.0 0.0 0.025 0.0 124-125 3.1875 0.0 0.0 0.025 0.0 126-127 3.5250000000000004 0.0 0.0 0.025 0.0 128-129 3.8 0.0 0.0 0.025 0.0 130-131 3.9875 0.0 0.0 0.025 0.0 132-133 4.262499999999999 0.0 0.0 0.025 0.0 134-135 4.6 0.0 0.0 0.025 0.0 136-137 4.9 0.0 0.0 0.025 0.0 138-139 5.2875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGCTT 10 0.0063298983 148.6923 1 ACGCTTT 10 0.0068343505 144.975 2 TCCCAGG 10 0.0068343505 144.975 145 AACAACT 10 0.0068343505 144.975 2 TTCGCAC 10 0.0068343505 144.975 7 CGCTTTC 10 0.0068343505 144.975 3 CGCACCT 10 0.0068343505 144.975 9 GCTTTCG 10 0.0068343505 144.975 4 AAAAAAA 115 0.0025567936 10.085217 80-84 >>END_MODULE SRR7170627 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170627_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.621 33.0 33.0 34.0 32.0 34.0 2 32.8595 33.0 33.0 34.0 32.0 34.0 3 32.90175 34.0 33.0 34.0 32.0 34.0 4 32.764 34.0 33.0 34.0 32.0 34.0 5 32.81375 34.0 33.0 34.0 32.0 34.0 6 36.9835 38.0 38.0 38.0 36.0 38.0 7 36.992 38.0 38.0 38.0 36.0 38.0 8 36.9825 38.0 38.0 38.0 36.0 38.0 9 36.92625 38.0 38.0 38.0 36.0 38.0 10-14 36.9545 38.0 38.0 38.0 36.0 38.0 15-19 36.8992 38.0 38.0 38.0 35.8 38.0 20-24 36.9653 38.0 38.0 38.0 36.0 38.0 25-29 36.9159 38.0 38.0 38.0 36.0 38.0 30-34 36.90235 38.0 38.0 38.0 36.2 38.0 35-39 37.0157 38.0 38.0 38.0 36.4 38.0 40-44 36.9747 38.0 38.0 38.0 36.0 38.0 45-49 36.87185000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.80905 38.0 38.0 38.0 36.0 38.0 55-59 36.84425 38.0 38.0 38.0 36.0 38.0 60-64 36.83175 38.0 38.0 38.0 36.0 38.0 65-69 36.7687 38.0 38.0 38.0 35.6 38.0 70-74 36.77405 38.0 38.0 38.0 36.0 38.0 75-79 36.68265 38.0 38.0 38.0 35.6 38.0 80-84 36.536649999999995 38.0 38.0 38.0 34.8 38.0 85-89 36.549549999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.39535 38.0 38.0 38.0 34.2 38.0 95-99 36.357600000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.12465 38.0 38.0 38.0 33.8 38.0 105-109 36.079049999999995 38.0 37.8 38.0 33.6 38.0 110-114 35.8581 38.0 37.2 38.0 32.6 38.0 115-119 35.681599999999996 38.0 37.0 38.0 31.2 38.0 120-124 35.64970000000001 38.0 37.0 38.0 31.6 38.0 125-129 35.1835 38.0 36.0 38.0 29.2 38.0 130-134 34.8898 38.0 35.8 38.0 28.0 38.0 135-139 34.5715 38.0 35.4 38.0 26.8 38.0 140-144 33.89315 38.0 33.4 38.0 23.4 38.0 145-149 33.29015 38.0 33.0 38.0 18.8 38.0 150-151 27.896625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 7.0 4 2.0 5 0.0 6 0.0 7 2.0 8 4.0 9 1.0 10 3.0 11 1.0 12 0.0 13 2.0 14 4.0 15 4.0 16 3.0 17 4.0 18 3.0 19 6.0 20 7.0 21 8.0 22 9.0 23 5.0 24 10.0 25 25.0 26 29.0 27 20.0 28 26.0 29 44.0 30 48.0 31 64.0 32 76.0 33 85.0 34 135.0 35 266.0 36 649.0 37 2446.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.5 13.8 16.05 32.65 2 23.7 24.2 35.875 16.225 3 20.125 25.324999999999996 32.2 22.35 4 24.25 34.75 20.775 20.225 5 22.625 38.550000000000004 21.6 17.224999999999998 6 16.825000000000003 37.824999999999996 24.65 20.7 7 16.675 14.6 46.650000000000006 22.075 8 21.375 21.349999999999998 26.55 30.725 9 22.400000000000002 22.875 28.775000000000002 25.95 10-14 22.509999999999998 28.16 27.625 21.705 15-19 23.200000000000003 27.944999999999997 27.355 21.5 20-24 22.825 27.900000000000002 28.025 21.25 25-29 23.005 28.365000000000002 27.045 21.584999999999997 30-34 22.835 27.575 27.744999999999997 21.845 35-39 23.095 28.04 27.785 21.08 40-44 23.13 27.79 27.49 21.59 45-49 22.994999999999997 27.52 27.71 21.775 50-54 23.39 27.935 27.455000000000002 21.22 55-59 23.765 26.71 27.584999999999997 21.94 60-64 23.285 27.38 27.63 21.705 65-69 23.45 26.805 27.544999999999998 22.2 70-74 23.46 27.345000000000002 27.245 21.95 75-79 23.365 27.36 27.750000000000004 21.525 80-84 23.905 27.62 27.275 21.2 85-89 23.59 28.125 26.915 21.37 90-94 23.53 28.1 27.1 21.27 95-99 23.65 28.01 27.395000000000003 20.945 100-104 23.955000000000002 28.49 26.450000000000003 21.105 105-109 23.380000000000003 27.77 28.04 20.810000000000002 110-114 24.055 27.98 26.810000000000002 21.154999999999998 115-119 24.21 27.83 27.255000000000003 20.705000000000002 120-124 24.055 27.595 27.41 20.94 125-129 24.47 27.11 27.555000000000003 20.865000000000002 130-134 24.39 27.355 27.87 20.385 135-139 24.485 27.765 26.82 20.93 140-144 24.58 28.115000000000002 27.060000000000002 20.244999999999997 145-149 25.09 27.455000000000002 26.950000000000003 20.505000000000003 150-151 25.7 27.3125 26.8375 20.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 1.5 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 1.0 25 2.0 26 3.0 27 5.5 28 9.5 29 10.0 30 12.0 31 19.0 32 24.5 33 24.0 34 35.0 35 56.0 36 82.0 37 105.0 38 122.5 39 152.0 40 183.0 41 210.0 42 228.5 43 237.5 44 259.5 45 274.0 46 242.0 47 231.0 48 237.0 49 211.0 50 178.5 51 152.0 52 135.5 53 118.0 54 101.0 55 81.0 56 71.0 57 63.5 58 44.0 59 27.5 60 13.0 61 8.5 62 9.5 63 6.5 64 3.0 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4918200408998 96.325 2 1.2014314928425358 2.35 3 0.15337423312883436 0.44999999999999996 4 0.051124744376278126 0.2 5 0.025562372188139063 0.125 6 0.025562372188139063 0.15 7 0.0 0.0 8 0.051124744376278126 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 8 0.2 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 8 0.2 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 33bp) CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2000000000000002 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.475 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 3.1624999999999996 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 3.7625 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.55 0.0 0.0 0.0 0.0 136-137 4.9 0.0 0.0 0.0 0.0 138-139 5.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTCAT 10 0.006830828 145.0 1 GTCATGC 10 0.006830828 145.0 3 TGCAAAA 10 0.006830828 145.0 7 GGTCATG 10 0.006830828 145.0 2 TCATGCA 10 0.006830828 145.0 4 >>END_MODULE Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971585 spots for SRR7170627.sra Written 971585 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra Read 971576 spots for SRR7170627.sra Written 971576 spots for SRR7170627.sra SRR ids: ['SRR7170627.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_umoeuzsg SRR7170627.sra spots: 19431529 blocks: [[1, 971576], [971577, 1943152], [1943153, 2914728], [2914729, 3886304], [3886305, 4857880], [4857881, 5829456], [5829457, 6801032], [6801033, 7772608], [7772609, 8744184], [8744185, 9715760], [9715761, 10687336], [10687337, 11658912], [11658913, 12630488], [12630489, 13602064], [13602065, 14573640], [14573641, 15545216], [15545217, 16516792], [16516793, 17488368], [17488369, 18459944], [18459945, 19431529]] SRR7170627 file size 6563007 SRR7170627 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170627 SRR7170627_1.fastq SRR7170627_2.fastq Input file: SRR7170627_1.fastq Paired file: SRR7170627_2.fastq trimmed: SRR7170627-trimmed-pair1.fastq, SRR7170627-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:33:36 2025 >> started Thu Feb 13 13:33:56 2025 >> done (20.299s) 19431529 read pairs processed; of these: 14753 ( 0.08%) short read pairs filtered out after trimming by size control 43007 ( 0.22%) empty read pairs filtered out after trimming by size control 19373769 (99.70%) read pairs available; of these: 9315725 (48.08%) trimmed read pairs available after processing 10058044 (51.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 4 0.00% 20 5 0.00% 21 8 0.00% 22 7 0.00% 23 14 0.00% 24 12 0.00% 25 14 0.00% 26 13 0.00% 27 11 0.00% 28 12 0.00% 29 14 0.00% 30 10 0.00% 31 12 0.00% 32 12 0.00% 33 22 0.00% 34 14 0.00% 35 20 0.00% 36 26 0.00% 37 26 0.00% 38 27 0.00% 39 36 0.00% 40 44 0.00% 41 52 0.00% 42 51 0.00% 43 64 0.00% 44 72 0.00% 45 68 0.00% 46 83 0.00% 47 96 0.00% 48 121 0.00% 49 130 0.00% 50 145 0.00% 51 177 0.00% 52 173 0.00% 53 169 0.00% 54 221 0.00% 55 203 0.00% 56 241 0.00% 57 264 0.00% 58 328 0.00% 59 325 0.00% 60 382 0.00% 61 407 0.00% 62 519 0.00% 63 532 0.00% 64 561 0.00% 65 644 0.00% 66 674 0.00% 67 687 0.00% 68 773 0.00% 69 843 0.00% 70 1019 0.01% 71 1185 0.01% 72 1449 0.01% 73 1542 0.01% 74 1787 0.01% 75 2116 0.01% 76 2942 0.02% 77 2762 0.01% 78 2373 0.01% 79 2652 0.01% 80 2870 0.01% 81 3256 0.02% 82 3758 0.02% 83 4245 0.02% 84 5406 0.03% 85 6091 0.03% 86 6523 0.03% 87 6831 0.04% 88 7327 0.04% 89 7619 0.04% 90 7914 0.04% 91 8582 0.04% 92 9370 0.05% 93 10209 0.05% 94 10712 0.06% 95 11406 0.06% 96 12062 0.06% 97 12446 0.06% 98 12781 0.07% 99 13170 0.07% 100 14114 0.07% 101 14721 0.08% 102 15773 0.08% 103 16859 0.09% 104 17416 0.09% 105 18427 0.10% 106 19320 0.10% 107 20003 0.10% 108 20220 0.10% 109 21161 0.11% 110 21751 0.11% 111 22575 0.12% 112 23612 0.12% 113 25072 0.13% 114 26130 0.13% 115 26812 0.14% 116 27418 0.14% 117 28146 0.15% 118 29241 0.15% 119 29241 0.15% 120 30395 0.16% 121 31378 0.16% 122 32832 0.17% 123 34576 0.18% 124 36136 0.19% 125 36990 0.19% 126 38780 0.20% 127 39837 0.21% 128 41216 0.21% 129 42928 0.22% 130 44156 0.23% 131 46381 0.24% 132 48578 0.25% 133 51599 0.27% 134 55183 0.28% 135 57896 0.30% 136 62252 0.32% 137 66526 0.34% 138 71257 0.37% 139 77719 0.40% 140 85351 0.44% 141 95412 0.49% 142 108402 0.56% 143 124489 0.64% 144 144218 0.74% 145 174953 0.90% 146 224354 1.16% 147 312843 1.61% 148 487876 2.52% 149 971714 5.02% 150 5009702 25.86% 151 10058044 51.92% 19373769 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=26 prefix-density=0.71 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=33.78 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.2 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=22 prefix-density=0.63 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.23 sequence-density-rank=17 fanout-score=11.59 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=5.6 sequence=GAGCTTGAAGCTG SRR7170627 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:34:45 Started mapping on | Feb 13 13:34:46 Finished on | Feb 13 13:38:11 Mapping speed, Million of reads per hour | 340.22 Number of input reads | 19373769 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17818818 Uniquely mapped reads % | 91.97% Average mapped length | 294.85 Number of splices: Total | 17820847 Number of splices: Annotated (sjdb) | 17435856 Number of splices: GT/AG | 17480096 Number of splices: GC/AG | 283391 Number of splices: AT/AC | 12130 Number of splices: Non-canonical | 45230 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463696 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 35771 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.39% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1107735 1107735 1107735 N_multimapping 463696 463696 463696 N_noFeature 607074 17438340 686977 N_ambiguous 422100 980 121118 UnstrandedReadsAssigned:16789644 PositiveStrandReadsAssigned:379498 NegativeStrandReadsAssigned:17010723 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170627 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170627-trimmed-pair1.fastq SRR7170627-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,373,769 reads, 16,883,321 reads pseudoaligned [quant] estimated average fragment length: 269.831 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR7170627.ke.tsv 34699 SRR7170627.se.tsv 87100 total ==> SRR7170627.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.17 852 20.8034 Potri.005G024800.1.v4.1 1035 766.169 474 26.4229 Potri.004G059700.1.v4.1 961 692.221 6 0.370197 Potri.007G009000.2.v4.1 1416 1147.17 0 0 Potri.003G141000.2.v4.1 2943 2674.17 623 9.95007 Potri.016G087400.1.v4.1 270 75.2634 1065 604.356 Potri.015G069301.1.v4.1 564 303.86 0 0 Potri.010G195200.1.v4.1 1773 1504.17 96 2.72585 Potri.012G127500.1.v4.1 977 708.19 99 5.97052 ==> SRR7170627.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 735 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 524 Potri.001G212900.v4.1 33 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 30 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR7170627 completed mapping pipeline successfully