Starting /dee2/code/volunteer_pipeline.sh SRR7170628 current disk space = 3091030863872 free memory = 1577436084 SRR7170628 SRAfilesize 94a0a51efe0f2656bfbb4fb4b1adb57d SRR7170628.sra SRR7170628.sra file validated SRR7170628 is paired end SRR7170628 is conventional basespace SRR7170628 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170628_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.4035 31.0 25.0 33.0 18.0 33.0 2 30.882 33.0 29.0 33.0 27.0 33.0 3 31.18275 33.0 31.0 33.0 28.0 33.0 4 31.36975 33.0 31.0 33.0 29.0 33.0 5 32.40325 33.0 33.0 33.0 32.0 34.0 6 36.77725 38.0 37.0 38.0 35.0 38.0 7 37.13725 38.0 38.0 38.0 36.0 38.0 8 37.381 38.0 38.0 38.0 37.0 38.0 9 37.45375 38.0 38.0 38.0 37.0 38.0 10-14 37.3818 38.0 38.0 38.0 37.0 38.0 15-19 37.3997 38.0 38.0 38.0 37.0 38.0 20-24 37.5006 38.0 38.0 38.0 37.4 38.0 25-29 37.45185 38.0 38.0 38.0 37.2 38.0 30-34 37.46965 38.0 38.0 38.0 37.2 38.0 35-39 37.43645 38.0 38.0 38.0 37.0 38.0 40-44 37.363600000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.3877 38.0 38.0 38.0 37.0 38.0 50-54 37.25345 38.0 38.0 38.0 36.8 38.0 55-59 37.1798 38.0 38.0 38.0 36.2 38.0 60-64 37.1496 38.0 38.0 38.0 36.0 38.0 65-69 37.1048 38.0 38.0 38.0 36.0 38.0 70-74 37.0188 38.0 38.0 38.0 36.0 38.0 75-79 36.892199999999995 38.0 38.0 38.0 35.8 38.0 80-84 36.75855 38.0 38.0 38.0 35.0 38.0 85-89 36.676300000000005 38.0 38.0 38.0 34.8 38.0 90-94 36.51065 38.0 38.0 38.0 34.2 38.0 95-99 36.37325 38.0 37.8 38.0 34.0 38.0 100-104 36.251999999999995 38.0 37.4 38.0 33.8 38.0 105-109 36.1237 38.0 37.2 38.0 33.4 38.0 110-114 35.8529 38.0 37.0 38.0 32.6 38.0 115-119 35.594550000000005 38.0 36.6 38.0 30.6 38.0 120-124 35.4663 38.0 36.0 38.0 30.6 38.0 125-129 35.17165 38.0 36.0 38.0 28.2 38.0 130-134 34.8977 38.0 34.8 38.0 27.8 38.0 135-139 34.54525 38.0 34.2 38.0 26.8 38.0 140-144 33.939949999999996 38.0 33.4 38.0 24.0 38.0 145-149 33.18445 38.0 33.0 38.0 20.2 38.0 150-151 28.986874999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 1.0 15 2.0 16 1.0 17 1.0 18 6.0 19 8.0 20 1.0 21 5.0 22 3.0 23 7.0 24 7.0 25 12.0 26 14.0 27 22.0 28 22.0 29 33.0 30 35.0 31 53.0 32 84.0 33 119.0 34 201.0 35 358.0 36 863.0 37 2138.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.49745676500509 18.362156663275687 11.139369277721261 28.001017293997965 2 20.150000000000002 25.55 33.775 20.525 3 17.549999999999997 32.574999999999996 28.025 21.85 4 21.625 35.625 23.25 19.5 5 21.435717858929465 37.41870935467734 21.360680340170084 19.78489244622311 6 17.95 36.4 23.9 21.75 7 13.225000000000001 21.05 45.300000000000004 20.424999999999997 8 17.175 20.849999999999998 28.925 33.050000000000004 9 18.575 21.25 28.9 31.275 10-14 19.155 30.209999999999997 25.874999999999996 24.759999999999998 15-19 20.05 28.005000000000003 27.495000000000005 24.45 20-24 19.675 28.945 28.005000000000003 23.375 25-29 19.2 29.360000000000003 28.134999999999998 23.305 30-34 19.545 28.875 27.87 23.71 35-39 19.585 29.345 27.439999999999998 23.630000000000003 40-44 19.55 29.01 27.615000000000002 23.825 45-49 19.865 28.860000000000003 27.750000000000004 23.525 50-54 20.145 28.535 27.725 23.595 55-59 19.705000000000002 28.64 27.97 23.685000000000002 60-64 20.225 29.04 27.05 23.685000000000002 65-69 20.044999999999998 28.68 27.495000000000005 23.78 70-74 20.255000000000003 28.52 27.32 23.905 75-79 20.200000000000003 28.599999999999998 28.03 23.169999999999998 80-84 20.565 28.470000000000002 27.51 23.455000000000002 85-89 20.26 28.34 28.43 22.97 90-94 20.175 28.95 27.855 23.02 95-99 20.385 28.365000000000002 27.52 23.73 100-104 20.380000000000003 27.884999999999998 27.91 23.825 105-109 20.69 28.65 26.96 23.7 110-114 20.560000000000002 27.82 27.6 24.02 115-119 20.74 28.294999999999998 27.47 23.494999999999997 120-124 21.025 28.63 27.384999999999998 22.96 125-129 20.71 28.349999999999998 27.205000000000002 23.735 130-134 20.25 28.689999999999998 27.060000000000002 24.0 135-139 20.97 27.85 27.32 23.86 140-144 20.244999999999997 28.345 27.384999999999998 24.025 145-149 20.635 28.425 27.325 23.615 150-151 22.075 27.987499999999997 26.8 23.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.5 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 0.5 21 1.0 22 3.5 23 3.0 24 3.5 25 4.5 26 6.5 27 8.5 28 8.0 29 12.5 30 15.5 31 23.0 32 42.0 33 57.5 34 65.0 35 79.5 36 109.0 37 130.0 38 138.5 39 167.0 40 191.0 41 217.5 42 240.5 43 252.5 44 262.0 45 263.0 46 237.0 47 226.5 48 227.0 49 198.0 50 173.0 51 142.5 52 116.0 53 91.0 54 66.5 55 56.5 56 47.5 57 32.5 58 23.0 59 15.5 60 10.0 61 7.0 62 5.0 63 1.5 64 2.5 65 2.5 66 1.5 67 1.5 68 2.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29257200606368 98.25 2 0.5558362809499747 1.0999999999999999 3 0.1010611419909045 0.3 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025265285497726126 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 10 0.25 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.2625 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.6500000000000004 0.0 0.0 0.0 0.0 130-131 2.8625 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.4625 0.0 0.0 0.0 0.0 136-137 3.7375 0.0 0.0 0.0 0.0 138-139 3.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170628 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170628_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56425 33.0 33.0 34.0 32.0 34.0 2 32.63975 33.0 33.0 34.0 32.0 34.0 3 32.671 33.0 33.0 34.0 32.0 34.0 4 32.663 33.0 33.0 34.0 32.0 34.0 5 32.66375 34.0 33.0 34.0 32.0 34.0 6 36.803 38.0 38.0 38.0 36.0 38.0 7 36.706 38.0 38.0 38.0 36.0 38.0 8 36.7715 38.0 38.0 38.0 36.0 38.0 9 36.814 38.0 38.0 38.0 36.0 38.0 10-14 36.781 38.0 38.0 38.0 36.0 38.0 15-19 36.762699999999995 38.0 38.0 38.0 36.0 38.0 20-24 36.718450000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.676 38.0 38.0 38.0 35.8 38.0 30-34 36.63674999999999 38.0 38.0 38.0 35.8 38.0 35-39 36.6707 38.0 38.0 38.0 36.0 38.0 40-44 36.58820000000001 38.0 38.0 38.0 35.6 38.0 45-49 36.486599999999996 38.0 38.0 38.0 35.0 38.0 50-54 36.42255 38.0 38.0 38.0 34.4 38.0 55-59 36.35045 38.0 38.0 38.0 34.2 38.0 60-64 36.368399999999994 38.0 38.0 38.0 34.0 38.0 65-69 36.269149999999996 38.0 38.0 38.0 34.0 38.0 70-74 36.23505 38.0 38.0 38.0 34.0 38.0 75-79 36.198249999999994 38.0 38.0 38.0 34.0 38.0 80-84 36.087450000000004 38.0 38.0 38.0 33.8 38.0 85-89 35.8705 38.0 38.0 38.0 33.2 38.0 90-94 35.75235 38.0 37.4 38.0 32.6 38.0 95-99 35.64444999999999 38.0 37.2 38.0 32.2 38.0 100-104 35.42375 38.0 37.0 38.0 30.6 38.0 105-109 35.36815 38.0 37.0 38.0 30.6 38.0 110-114 35.12095 38.0 36.4 38.0 28.6 38.0 115-119 34.92405 38.0 36.0 38.0 27.8 38.0 120-124 34.7583 38.0 36.0 38.0 27.6 38.0 125-129 34.357350000000004 38.0 35.0 38.0 24.8 38.0 130-134 33.821349999999995 38.0 33.2 38.0 22.0 38.0 135-139 33.441199999999995 38.0 33.0 38.0 20.8 38.0 140-144 32.751999999999995 38.0 33.0 38.0 14.0 38.0 145-149 31.576749999999997 38.0 32.2 38.0 8.2 38.0 150-151 26.249875000000003 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 11.0 4 2.0 5 3.0 6 5.0 7 2.0 8 3.0 9 1.0 10 2.0 11 4.0 12 4.0 13 5.0 14 5.0 15 7.0 16 4.0 17 7.0 18 8.0 19 5.0 20 11.0 21 12.0 22 7.0 23 21.0 24 18.0 25 22.0 26 23.0 27 24.0 28 39.0 29 40.0 30 51.0 31 76.0 32 85.0 33 102.0 34 191.0 35 306.0 36 693.0 37 2184.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.1 16.5 15.15 23.25 2 26.05 21.625 32.9 19.425 3 20.775 26.0 32.85 20.375 4 24.65 35.025 21.675 18.65 5 24.55 36.95 20.724999999999998 17.775 6 18.463847885914436 36.40230172629472 24.34325744308231 20.79059294470853 7 16.433216608304154 16.333166583291643 44.972486243121566 22.26113056528264 8 19.759879939969984 22.436218109054526 26.76338169084542 31.040520260130066 9 21.435717858929465 24.087043521760883 28.214107053526767 26.263131565782892 10-14 22.552403822102157 28.31057081394767 27.315023262794536 21.822002101155636 15-19 22.984193677470987 28.141256502601042 27.656062424969992 21.218487394957982 20-24 22.702946031110887 27.884759665883056 28.254889211223926 21.157405091782124 25-29 23.4332016205672 27.569649377282047 27.694693142599906 21.302455859550843 30-34 22.13274646126144 28.13484719651878 28.369929475316365 21.362476866903414 35-39 22.671335667833915 28.024012006003 28.174087043521762 21.13056528264132 40-44 23.44109698728856 27.63987588829947 27.905114603142827 21.013912521269145 45-49 23.2016008004002 28.134067033516757 27.263631815907953 21.400700350175086 50-54 22.798679207524515 27.976786071642984 28.14188513107865 21.082649589753853 55-59 23.73924354612768 27.666599959975986 28.111867120272166 20.482289373624173 60-64 22.869865412518138 27.17266223044979 28.338419972982436 21.619052384049635 65-69 23.652095628688606 27.53826147844353 27.38821646493948 21.421426427928377 70-74 23.288150852798477 27.884759665883056 27.43460211073876 21.3924873705797 75-79 23.398189366278196 27.42459860951333 27.689691391987196 21.487520632221276 80-84 23.455554999749886 27.957580911410133 27.412335550997952 21.17452853784203 85-89 23.31315960586205 27.934777172010207 27.554644125443907 21.197419096683838 90-94 23.15541993897254 28.217697964083836 27.332299534790653 21.294582562152968 95-99 23.532059617885366 27.308192457737324 28.363509052715813 20.796238871661497 100-104 23.382014604381315 28.328498549564866 27.628288486545966 20.66119835950785 105-109 23.44641248874212 27.849494646252378 28.04463124186931 20.659461623136195 110-114 23.502626970227674 27.570678008506377 28.096072054040533 20.830622967225416 115-119 23.978188003401872 28.290559807894343 27.305017759767875 20.426234428935917 120-124 24.033218270048526 27.269998499174548 28.235529541247683 20.46125368952924 125-129 24.008204512481864 28.12046625644104 27.695232377807795 20.1760968532693 130-134 24.23074998749187 27.152649221994295 27.713013458748186 20.903587331765646 135-139 23.528823058446758 27.56705364291433 27.962369895916733 20.941753402722178 140-144 24.61946725415582 28.03424794712598 27.35329461245744 19.992990186260766 145-149 24.187418741874186 28.03780378037804 27.367736773677372 20.407040704070408 150-151 23.9 27.625 27.287499999999998 21.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 0.5 21 2.0 22 1.5 23 1.5 24 2.5 25 2.0 26 3.0 27 3.5 28 6.0 29 12.5 30 18.5 31 19.5 32 23.0 33 33.0 34 47.0 35 68.5 36 85.0 37 97.0 38 119.0 39 149.5 40 182.0 41 201.0 42 237.0 43 258.5 44 258.0 45 286.5 46 265.5 47 240.5 48 235.5 49 213.0 50 195.0 51 148.5 52 111.0 53 105.0 54 91.0 55 69.0 56 56.5 57 43.5 58 31.5 59 24.0 60 16.0 61 10.0 62 7.0 63 6.0 64 3.5 65 1.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.05 8 0.05 9 0.05 10-14 0.055 15-19 0.04 20-24 0.034999999999999996 25-29 0.034999999999999996 30-34 0.034999999999999996 35-39 0.05 40-44 0.09 45-49 0.05 50-54 0.06 55-59 0.06 60-64 0.065 65-69 0.03 70-74 0.034999999999999996 75-79 0.034999999999999996 80-84 0.045 85-89 0.034999999999999996 90-94 0.045 95-99 0.03 100-104 0.03 105-109 0.06999999999999999 110-114 0.075 115-119 0.055 120-124 0.055 125-129 0.055 130-134 0.065 135-139 0.08 140-144 0.13999999999999999 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8821138211382 97.3 2 0.8892276422764227 1.7500000000000002 3 0.1524390243902439 0.44999999999999996 4 0.025406504065040653 0.1 5 0.0 0.0 6 0.025406504065040653 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025406504065040653 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 10 0.25 Illumina Single End PCR Primer 1 (96% over 33bp) CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 1.7999999999999998 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.2249999999999996 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.6500000000000004 0.0 0.0 0.0 0.0 130-131 2.8625 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.8 0.0 0.0 0.0 0.0 138-139 4.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATGGT 10 0.006830828 145.0 1 >>END_MODULE Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745927 spots for SRR7170628.sra Written 745927 spots for SRR7170628.sra Read 745941 spots for SRR7170628.sra Written 745941 spots for SRR7170628.sra SRR ids: ['SRR7170628.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uycdcsca SRR7170628.sra spots: 14918554 blocks: [[1, 745927], [745928, 1491854], [1491855, 2237781], [2237782, 2983708], [2983709, 3729635], [3729636, 4475562], [4475563, 5221489], [5221490, 5967416], [5967417, 6713343], [6713344, 7459270], [7459271, 8205197], [8205198, 8951124], [8951125, 9697051], [9697052, 10442978], [10442979, 11188905], [11188906, 11934832], [11934833, 12680759], [12680760, 13426686], [13426687, 14172613], [14172614, 14918554]] SRR7170628 file size 5033708 SRR7170628 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170628 SRR7170628_1.fastq SRR7170628_2.fastq Input file: SRR7170628_1.fastq Paired file: SRR7170628_2.fastq trimmed: SRR7170628-trimmed-pair1.fastq, SRR7170628-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:22:56 2025 >> started Thu Feb 13 13:23:13 2025 >> done (16.566s) 14918554 read pairs processed; of these: 25239 ( 0.17%) short read pairs filtered out after trimming by size control 52728 ( 0.35%) empty read pairs filtered out after trimming by size control 14840587 (99.48%) read pairs available; of these: 7977170 (53.75%) trimmed read pairs available after processing 6863417 (46.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 11 0.00% 21 5 0.00% 22 8 0.00% 23 13 0.00% 24 11 0.00% 25 10 0.00% 26 9 0.00% 27 17 0.00% 28 8 0.00% 29 15 0.00% 30 13 0.00% 31 10 0.00% 32 14 0.00% 33 10 0.00% 34 14 0.00% 35 16 0.00% 36 13 0.00% 37 19 0.00% 38 25 0.00% 39 26 0.00% 40 19 0.00% 41 37 0.00% 42 40 0.00% 43 41 0.00% 44 51 0.00% 45 52 0.00% 46 70 0.00% 47 55 0.00% 48 94 0.00% 49 92 0.00% 50 131 0.00% 51 109 0.00% 52 123 0.00% 53 146 0.00% 54 172 0.00% 55 149 0.00% 56 161 0.00% 57 221 0.00% 58 217 0.00% 59 246 0.00% 60 328 0.00% 61 368 0.00% 62 375 0.00% 63 424 0.00% 64 485 0.00% 65 509 0.00% 66 580 0.00% 67 563 0.00% 68 675 0.00% 69 716 0.00% 70 817 0.01% 71 934 0.01% 72 1190 0.01% 73 1266 0.01% 74 1402 0.01% 75 1705 0.01% 76 2135 0.01% 77 2155 0.01% 78 2055 0.01% 79 2244 0.02% 80 2466 0.02% 81 2883 0.02% 82 3099 0.02% 83 3596 0.02% 84 4842 0.03% 85 5713 0.04% 86 5953 0.04% 87 6251 0.04% 88 6428 0.04% 89 6681 0.05% 90 6920 0.05% 91 7291 0.05% 92 7804 0.05% 93 8239 0.06% 94 8731 0.06% 95 9246 0.06% 96 9653 0.07% 97 9753 0.07% 98 10078 0.07% 99 10464 0.07% 100 10890 0.07% 101 11440 0.08% 102 12128 0.08% 103 12877 0.09% 104 13547 0.09% 105 14073 0.09% 106 14310 0.10% 107 15023 0.10% 108 15346 0.10% 109 15844 0.11% 110 16539 0.11% 111 17121 0.12% 112 18306 0.12% 113 18623 0.13% 114 19696 0.13% 115 20243 0.14% 116 20881 0.14% 117 21661 0.15% 118 22410 0.15% 119 22783 0.15% 120 23683 0.16% 121 24535 0.17% 122 25684 0.17% 123 27460 0.19% 124 28511 0.19% 125 29743 0.20% 126 31294 0.21% 127 33059 0.22% 128 34741 0.23% 129 35885 0.24% 130 37196 0.25% 131 39028 0.26% 132 42191 0.28% 133 44902 0.30% 134 48395 0.33% 135 52143 0.35% 136 56975 0.38% 137 61565 0.41% 138 66655 0.45% 139 74300 0.50% 140 82249 0.55% 141 93519 0.63% 142 106813 0.72% 143 123834 0.83% 144 145989 0.98% 145 179280 1.21% 146 227257 1.53% 147 312391 2.10% 148 480288 3.24% 149 946632 6.38% 150 3967704 26.74% 151 6863417 46.25% 14840587 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=16 prefix-density=0.67 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=248.16 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATG criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=1.03 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=15.50 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.1 sequence=AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7170628 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:23:56 Started mapping on | Feb 13 13:23:56 Finished on | Feb 13 13:25:48 Mapping speed, Million of reads per hour | 477.02 Number of input reads | 14840587 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13854154 Uniquely mapped reads % | 93.35% Average mapped length | 293.96 Number of splices: Total | 13811048 Number of splices: Annotated (sjdb) | 13494357 Number of splices: GT/AG | 13553182 Number of splices: GC/AG | 207401 Number of splices: AT/AC | 8388 Number of splices: Non-canonical | 42077 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368112 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 52479 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.73% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 640859 640859 640859 N_multimapping 368112 368112 368112 N_noFeature 520299 13557193 614397 N_ambiguous 304441 1098 100998 UnstrandedReadsAssigned:13029414 PositiveStrandReadsAssigned:295863 NegativeStrandReadsAssigned:13138759 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170628 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170628-trimmed-pair1.fastq SRR7170628-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,840,587 reads, 13,043,724 reads pseudoaligned [quant] estimated average fragment length: 279.011 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7170628.ke.tsv 34699 SRR7170628.se.tsv 87100 total ==> SRR7170628.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.99 930 34.8761 Potri.005G024800.1.v4.1 1035 756.989 265 22.8427 Potri.004G059700.1.v4.1 961 683.098 9 0.859708 Potri.007G009000.2.v4.1 1416 1137.99 0 0 Potri.003G141000.2.v4.1 2943 2664.99 750 18.3636 Potri.016G087400.1.v4.1 270 74.022 570.093 502.547 Potri.015G069301.1.v4.1 564 297.124 0 0 Potri.010G195200.1.v4.1 1773 1494.99 98 4.2774 Potri.012G127500.1.v4.1 977 699.066 81 7.56064 ==> SRR7170628.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 731 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170628 completed mapping pipeline successfully