Starting /dee2/code/volunteer_pipeline.sh SRR7170629 current disk space = 3091051380736 free memory = 1575982636 SRR7170629 SRAfilesize c37eadbc3b45ed8ec9bd965c0c93c0b4 SRR7170629.sra SRR7170629.sra file validated SRR7170629 is paired end SRR7170629 is conventional basespace SRR7170629 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170629_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.746 30.0 18.0 33.0 18.0 33.0 2 30.548 31.0 29.0 33.0 27.0 33.0 3 30.29275 31.0 29.0 33.0 27.0 33.0 4 31.0185 33.0 31.0 33.0 28.0 33.0 5 32.4815 33.0 33.0 33.0 32.0 34.0 6 36.73625 38.0 37.0 38.0 34.0 38.0 7 37.21775 38.0 38.0 38.0 36.0 38.0 8 37.43675 38.0 38.0 38.0 37.0 38.0 9 37.458 38.0 38.0 38.0 37.0 38.0 10-14 37.4626 38.0 38.0 38.0 37.0 38.0 15-19 37.4926 38.0 38.0 38.0 37.4 38.0 20-24 37.56225 38.0 38.0 38.0 38.0 38.0 25-29 37.544349999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.548500000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.525999999999996 38.0 38.0 38.0 37.8 38.0 40-44 37.4893 38.0 38.0 38.0 37.6 38.0 45-49 37.4585 38.0 38.0 38.0 37.6 38.0 50-54 37.3842 38.0 38.0 38.0 37.0 38.0 55-59 37.36794999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.320550000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.26395 38.0 38.0 38.0 37.0 38.0 70-74 37.22170000000001 38.0 38.0 38.0 36.4 38.0 75-79 37.08665 38.0 38.0 38.0 36.2 38.0 80-84 37.0353 38.0 38.0 38.0 36.0 38.0 85-89 36.9989 38.0 38.0 38.0 36.0 38.0 90-94 36.84545 38.0 38.0 38.0 35.4 38.0 95-99 36.70215 38.0 38.0 38.0 34.8 38.0 100-104 36.56935 38.0 38.0 38.0 34.4 38.0 105-109 36.57745 38.0 38.0 38.0 34.2 38.0 110-114 36.38015 38.0 38.0 38.0 34.0 38.0 115-119 36.1477 38.0 37.6 38.0 33.6 38.0 120-124 36.08154999999999 38.0 37.0 38.0 33.4 38.0 125-129 36.03845 38.0 37.0 38.0 33.0 38.0 130-134 35.78335 38.0 36.4 38.0 31.8 38.0 135-139 35.517849999999996 38.0 36.0 38.0 31.0 38.0 140-144 34.94200000000001 38.0 35.4 38.0 28.8 38.0 145-149 34.34315 38.0 33.8 38.0 27.6 38.0 150-151 30.7095 35.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 3.0 19 8.0 20 3.0 21 5.0 22 4.0 23 5.0 24 3.0 25 7.0 26 10.0 27 9.0 28 22.0 29 26.0 30 37.0 31 39.0 32 64.0 33 91.0 34 139.0 35 243.0 36 698.0 37 2578.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.97876643073812 18.174924165824063 12.158746208291204 30.687563195146613 2 17.875 26.650000000000002 35.5 19.975 3 17.349999999999998 30.75 29.225 22.675 4 20.325 36.625 23.325000000000003 19.725 5 20.566842237271132 38.274391773263105 22.121896162528216 19.036869826937547 6 17.349999999999998 36.325 24.099999999999998 22.225 7 11.799999999999999 20.625 44.875 22.7 8 16.75 21.65 28.4 33.2 9 16.45 23.1 30.025000000000002 30.425 10-14 18.595 30.349999999999998 25.935000000000002 25.119999999999997 15-19 20.0 28.744999999999997 27.36 23.895 20-24 19.395 29.675 27.575 23.355 25-29 19.355 28.849999999999998 27.46 24.335 30-34 18.965 29.255 28.07 23.71 35-39 19.744999999999997 28.33 27.400000000000002 24.525 40-44 19.655 28.860000000000003 27.534999999999997 23.95 45-49 19.43 29.315 27.589999999999996 23.665 50-54 19.84 28.64 27.529999999999998 23.990000000000002 55-59 19.425 28.189999999999998 28.205000000000002 24.18 60-64 19.72 29.075 27.560000000000002 23.645 65-69 19.735 28.845 27.700000000000003 23.72 70-74 19.7 29.785 27.05 23.465 75-79 19.509999999999998 29.475 27.310000000000002 23.705000000000002 80-84 20.200000000000003 28.515 27.544999999999998 23.74 85-89 19.919999999999998 28.64 27.605 23.835 90-94 20.119999999999997 28.53 27.644999999999996 23.705000000000002 95-99 19.919999999999998 28.675 27.615000000000002 23.79 100-104 20.535 28.625 27.395000000000003 23.445 105-109 20.405 29.03 27.205000000000002 23.36 110-114 20.68 28.65 27.644999999999996 23.025000000000002 115-119 20.755000000000003 28.54 27.229999999999997 23.474999999999998 120-124 20.294999999999998 28.265 27.639999999999997 23.799999999999997 125-129 20.355 28.660000000000004 26.974999999999998 24.01 130-134 20.349999999999998 28.395 27.26 23.995 135-139 20.225 28.375 27.589999999999996 23.810000000000002 140-144 20.175 28.384999999999998 27.384999999999998 24.055 145-149 20.515 28.68 27.445000000000004 23.36 150-151 21.188986232790988 27.83479349186483 26.921151439299123 24.055068836045056 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.0 23 2.0 24 3.0 25 2.5 26 6.0 27 12.0 28 16.5 29 21.5 30 23.0 31 28.5 32 37.0 33 52.0 34 74.0 35 83.0 36 93.5 37 115.5 38 133.0 39 160.0 40 191.5 41 221.5 42 255.0 43 264.0 44 263.5 45 259.5 46 254.0 47 256.5 48 230.5 49 192.0 50 166.5 51 133.5 52 101.5 53 86.0 54 68.5 55 47.5 56 36.0 57 28.5 58 21.5 59 17.0 60 13.0 61 7.0 62 6.0 63 4.0 64 1.5 65 1.0 66 0.5 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.325 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47089947089947 98.7 2 0.45351473922902497 0.8999999999999999 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02519526329050139 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 10 0.25 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.3624999999999998 0.0 0.0 0.0 0.0 120-121 1.4500000000000002 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.7625000000000002 0.0 0.0 0.0 0.0 128-129 1.925 0.0 0.0 0.0 0.0 130-131 2.2249999999999996 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 2.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170629 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170629_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4225 33.0 33.0 34.0 31.0 34.0 2 32.56625 33.0 33.0 34.0 31.0 34.0 3 32.634 33.0 33.0 34.0 32.0 34.0 4 32.443 33.0 33.0 34.0 31.0 34.0 5 32.45725 33.0 33.0 34.0 31.0 34.0 6 36.4525 38.0 38.0 38.0 34.0 38.0 7 36.65125 38.0 38.0 38.0 35.0 38.0 8 36.537 38.0 38.0 38.0 34.0 38.0 9 36.5425 38.0 38.0 38.0 34.0 38.0 10-14 36.56075 38.0 38.0 38.0 34.8 38.0 15-19 36.443599999999996 38.0 38.0 38.0 34.4 38.0 20-24 36.51635 38.0 38.0 38.0 35.0 38.0 25-29 36.435950000000005 38.0 38.0 38.0 34.4 38.0 30-34 36.40835 38.0 38.0 38.0 34.4 38.0 35-39 36.49445 38.0 38.0 38.0 35.0 38.0 40-44 36.50335 38.0 38.0 38.0 34.8 38.0 45-49 36.417950000000005 38.0 38.0 38.0 34.8 38.0 50-54 36.3384 38.0 38.0 38.0 34.0 38.0 55-59 36.26205 38.0 38.0 38.0 34.0 38.0 60-64 36.319649999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.2025 38.0 38.0 38.0 34.0 38.0 70-74 36.22195 38.0 38.0 38.0 34.0 38.0 75-79 36.1314 38.0 38.0 38.0 33.8 38.0 80-84 35.9388 38.0 38.0 38.0 33.0 38.0 85-89 35.8423 38.0 38.0 38.0 33.0 38.0 90-94 35.6977 38.0 37.8 38.0 32.2 38.0 95-99 35.65065 38.0 37.6 38.0 31.6 38.0 100-104 35.48125 38.0 37.0 38.0 30.6 38.0 105-109 35.4643 38.0 37.0 38.0 31.0 38.0 110-114 35.1747 38.0 36.8 38.0 29.2 38.0 115-119 34.997949999999996 38.0 36.4 38.0 28.0 38.0 120-124 34.8206 38.0 36.0 38.0 28.0 38.0 125-129 34.36475 38.0 35.2 38.0 23.8 38.0 130-134 33.94175 38.0 34.4 38.0 22.6 38.0 135-139 33.6584 38.0 33.6 38.0 21.0 38.0 140-144 33.0226 38.0 33.0 38.0 15.0 38.0 145-149 32.47045 38.0 33.0 38.0 10.6 38.0 150-151 27.168 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 10.0 4 3.0 5 8.0 6 3.0 7 0.0 8 6.0 9 0.0 10 3.0 11 3.0 12 4.0 13 6.0 14 6.0 15 5.0 16 6.0 17 8.0 18 13.0 19 7.0 20 15.0 21 13.0 22 19.0 23 18.0 24 14.0 25 27.0 26 23.0 27 26.0 28 40.0 29 41.0 30 63.0 31 57.0 32 80.0 33 134.0 34 139.0 35 282.0 36 592.0 37 2315.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.4 16.55 15.15 23.9 2 24.075 21.825 34.300000000000004 19.8 3 19.825 25.224999999999998 34.449999999999996 20.5 4 22.825 34.699999999999996 23.425 19.05 5 23.1 36.075 22.425 18.4 6 17.974999999999998 36.325 24.725 20.974999999999998 7 17.299999999999997 16.675 44.6 21.425 8 20.75 22.775000000000002 26.75 29.725 9 21.525 24.05 29.15 25.275 10-14 22.68 28.26 27.715 21.345 15-19 22.470000000000002 26.995 28.685 21.85 20-24 22.775000000000002 27.889999999999997 28.03 21.305 25-29 22.830000000000002 28.244999999999997 28.12 20.805 30-34 23.09 28.15 28.000000000000004 20.76 35-39 23.415 27.79 27.715 21.08 40-44 23.244999999999997 28.28 27.560000000000002 20.915 45-49 23.44 27.744999999999997 27.735 21.08 50-54 23.01 28.125 27.875 20.990000000000002 55-59 23.235 28.28 27.555000000000003 20.93 60-64 22.96 28.18 27.889999999999997 20.97 65-69 22.985 27.705000000000002 28.52 20.79 70-74 23.785 27.785 27.82 20.61 75-79 23.015 28.494999999999997 28.02 20.47 80-84 22.71 27.650000000000002 28.665000000000003 20.974999999999998 85-89 23.425 27.689999999999998 28.34 20.544999999999998 90-94 23.455000000000002 28.4 27.644999999999996 20.5 95-99 22.99 27.694999999999997 28.89 20.424999999999997 100-104 23.799999999999997 27.810000000000002 27.794999999999998 20.595 105-109 23.195 28.000000000000004 28.749999999999996 20.055 110-114 23.105 27.810000000000002 28.310000000000002 20.775 115-119 23.68 27.750000000000004 27.644999999999996 20.925 120-124 23.66 27.49 28.23 20.62 125-129 23.415 28.12 27.994999999999997 20.47 130-134 23.724999999999998 27.77 28.285 20.22 135-139 23.97 27.365000000000002 28.549999999999997 20.115 140-144 24.03 27.245 28.725 20.0 145-149 24.465 27.54 28.185 19.81 150-151 24.099549774887443 27.48874437218609 27.726363181590795 20.68534267133567 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 2.0 20 2.5 21 1.0 22 3.0 23 4.0 24 3.0 25 3.0 26 4.0 27 8.5 28 13.0 29 14.5 30 17.0 31 21.0 32 25.5 33 37.5 34 49.0 35 62.0 36 87.0 37 114.0 38 126.5 39 145.5 40 181.5 41 216.0 42 239.0 43 263.5 44 285.0 45 286.5 46 283.0 47 256.5 48 220.0 49 193.0 50 164.5 51 135.0 52 119.0 53 100.0 54 74.5 55 67.0 56 52.0 57 33.5 58 26.5 59 18.5 60 11.0 61 10.5 62 8.0 63 3.5 64 2.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39393939393939 98.4 2 0.45454545454545453 0.8999999999999999 3 0.07575757575757576 0.22499999999999998 4 0.025252525252525252 0.1 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025252525252525252 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 10 0.25 Illumina Single End PCR Primer 1 (96% over 33bp) TCACACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.3624999999999998 0.0 0.0 0.0 0.0 120-121 1.4500000000000002 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.6375 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.2125 0.0 0.0 0.0 0.0 132-133 2.3625 0.0 0.0 0.0 0.0 134-135 2.5875 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839682 spots for SRR7170629.sra Written 839682 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra Read 839670 spots for SRR7170629.sra Written 839670 spots for SRR7170629.sra SRR ids: ['SRR7170629.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g3v06_xj SRR7170629.sra spots: 16793412 blocks: [[1, 839670], [839671, 1679340], [1679341, 2519010], [2519011, 3358680], [3358681, 4198350], [4198351, 5038020], [5038021, 5877690], [5877691, 6717360], [6717361, 7557030], [7557031, 8396700], [8396701, 9236370], [9236371, 10076040], [10076041, 10915710], [10915711, 11755380], [11755381, 12595050], [12595051, 13434720], [13434721, 14274390], [14274391, 15114060], [15114061, 15953730], [15953731, 16793412]] SRR7170629 file size 5669035 SRR7170629 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170629 SRR7170629_1.fastq SRR7170629_2.fastq Input file: SRR7170629_1.fastq Paired file: SRR7170629_2.fastq trimmed: SRR7170629-trimmed-pair1.fastq, SRR7170629-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:22:18 2025 >> started Thu Feb 13 13:22:44 2025 >> done (26.031s) 16793412 read pairs processed; of these: 26670 ( 0.16%) short read pairs filtered out after trimming by size control 54411 ( 0.32%) empty read pairs filtered out after trimming by size control 16712331 (99.52%) read pairs available; of these: 8015093 (47.96%) trimmed read pairs available after processing 8697238 (52.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 10 0.00% 21 6 0.00% 22 13 0.00% 23 3 0.00% 24 9 0.00% 25 9 0.00% 26 6 0.00% 27 12 0.00% 28 9 0.00% 29 11 0.00% 30 23 0.00% 31 15 0.00% 32 16 0.00% 33 12 0.00% 34 10 0.00% 35 10 0.00% 36 10 0.00% 37 9 0.00% 38 16 0.00% 39 14 0.00% 40 13 0.00% 41 18 0.00% 42 28 0.00% 43 21 0.00% 44 16 0.00% 45 24 0.00% 46 31 0.00% 47 25 0.00% 48 51 0.00% 49 48 0.00% 50 40 0.00% 51 60 0.00% 52 69 0.00% 53 70 0.00% 54 91 0.00% 55 63 0.00% 56 62 0.00% 57 84 0.00% 58 105 0.00% 59 116 0.00% 60 127 0.00% 61 147 0.00% 62 167 0.00% 63 183 0.00% 64 207 0.00% 65 224 0.00% 66 258 0.00% 67 274 0.00% 68 339 0.00% 69 388 0.00% 70 407 0.00% 71 524 0.00% 72 607 0.00% 73 650 0.00% 74 742 0.00% 75 850 0.01% 76 1031 0.01% 77 1019 0.01% 78 1077 0.01% 79 1269 0.01% 80 1409 0.01% 81 1631 0.01% 82 1864 0.01% 83 2205 0.01% 84 3540 0.02% 85 4500 0.03% 86 4584 0.03% 87 4880 0.03% 88 5150 0.03% 89 5432 0.03% 90 5654 0.03% 91 5860 0.04% 92 6455 0.04% 93 6706 0.04% 94 6887 0.04% 95 7342 0.04% 96 7820 0.05% 97 7922 0.05% 98 8223 0.05% 99 8765 0.05% 100 9242 0.06% 101 9597 0.06% 102 10485 0.06% 103 10892 0.07% 104 11683 0.07% 105 12429 0.07% 106 12596 0.08% 107 13177 0.08% 108 13770 0.08% 109 14458 0.09% 110 14826 0.09% 111 15738 0.09% 112 16591 0.10% 113 17272 0.10% 114 18153 0.11% 115 18569 0.11% 116 19553 0.12% 117 20286 0.12% 118 20747 0.12% 119 21426 0.13% 120 22566 0.14% 121 23444 0.14% 122 24068 0.14% 123 25807 0.15% 124 27295 0.16% 125 28714 0.17% 126 30071 0.18% 127 31183 0.19% 128 32861 0.20% 129 34473 0.21% 130 35947 0.22% 131 37750 0.23% 132 40578 0.24% 133 43427 0.26% 134 47153 0.28% 135 49700 0.30% 136 53856 0.32% 137 57917 0.35% 138 63052 0.38% 139 69634 0.42% 140 77023 0.46% 141 87789 0.53% 142 100010 0.60% 143 116049 0.69% 144 136130 0.81% 145 165314 0.99% 146 211418 1.27% 147 290698 1.74% 148 447650 2.68% 149 867116 5.19% 150 4316314 25.83% 151 8697238 52.04% 16712331 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=50.33 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.3 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=14 prefix-density=0.78 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=15.26 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.1 sequence=CATCCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR7170629 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:23:26 Started mapping on | Feb 13 13:23:26 Finished on | Feb 13 13:25:12 Mapping speed, Million of reads per hour | 567.59 Number of input reads | 16712331 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15672223 Uniquely mapped reads % | 93.78% Average mapped length | 295.33 Number of splices: Total | 15606272 Number of splices: Annotated (sjdb) | 15265537 Number of splices: GT/AG | 15317910 Number of splices: GC/AG | 237105 Number of splices: AT/AC | 9462 Number of splices: Non-canonical | 41795 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430859 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 46695 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 639097 639097 639097 N_multimapping 430859 430859 430859 N_noFeature 566596 15436100 642912 N_ambiguous 272921 1127 112524 UnstrandedReadsAssigned:14832706 PositiveStrandReadsAssigned:234996 NegativeStrandReadsAssigned:14916787 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170629 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170629-trimmed-pair1.fastq SRR7170629-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,712,331 reads, 14,883,110 reads pseudoaligned [quant] estimated average fragment length: 286.063 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7170629.ke.tsv 34699 SRR7170629.se.tsv 87100 total ==> SRR7170629.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.94 1234 44.7128 Potri.005G024800.1.v4.1 1035 749.937 393 32.9054 Potri.004G059700.1.v4.1 961 676.065 4 0.37151 Potri.007G009000.2.v4.1 1416 1130.94 0 0 Potri.003G141000.2.v4.1 2943 2657.94 782 18.474 Potri.016G087400.1.v4.1 270 70.3303 748 667.819 Potri.015G069301.1.v4.1 564 291.553 0 0 Potri.010G195200.1.v4.1 1773 1487.94 69 2.91182 Potri.012G127500.1.v4.1 977 691.991 483 43.8274 ==> SRR7170629.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1274 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 89 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7170629 completed mapping pipeline successfully