Starting /dee2/code/volunteer_pipeline.sh SRR7170630 current disk space = 3090679631872 free memory = 1574490624 SRR7170630 SRAfilesize 5a137eb9930df6e1c334f1384a95b2cd SRR7170630.sra SRR7170630.sra file validated SRR7170630 is paired end SRR7170630 is conventional basespace SRR7170630 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170630_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.6725 32.0 18.0 33.0 18.0 33.0 2 29.371 31.0 28.0 33.0 18.0 33.0 3 31.11775 33.0 30.0 33.0 27.0 33.0 4 31.6725 33.0 31.0 33.0 29.0 34.0 5 32.21025 33.0 33.0 33.0 31.0 34.0 6 36.24325 38.0 37.0 38.0 33.0 38.0 7 36.86175 38.0 38.0 38.0 35.0 38.0 8 37.10925 38.0 38.0 38.0 36.0 38.0 9 37.209 38.0 38.0 38.0 36.0 38.0 10-14 37.2602 38.0 38.0 38.0 36.6 38.0 15-19 37.23145 38.0 38.0 38.0 36.6 38.0 20-24 37.12645 38.0 38.0 38.0 36.0 38.0 25-29 37.13195 38.0 38.0 38.0 36.2 38.0 30-34 37.10835 38.0 38.0 38.0 36.2 38.0 35-39 37.1983 38.0 38.0 38.0 36.4 38.0 40-44 37.077749999999995 38.0 38.0 38.0 36.0 38.0 45-49 37.0109 38.0 38.0 38.0 35.8 38.0 50-54 36.851549999999996 38.0 38.0 38.0 35.2 38.0 55-59 36.753949999999996 38.0 38.0 38.0 34.8 38.0 60-64 36.768150000000006 38.0 38.0 38.0 34.8 38.0 65-69 36.5249 38.0 38.0 38.0 34.0 38.0 70-74 36.539300000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.28535 38.0 37.2 38.0 33.2 38.0 80-84 36.173350000000006 38.0 37.0 38.0 32.8 38.0 85-89 36.138349999999996 38.0 37.0 38.0 33.0 38.0 90-94 35.756699999999995 38.0 37.0 38.0 30.6 38.0 95-99 35.7 38.0 36.8 38.0 30.4 38.0 100-104 35.498000000000005 38.0 36.0 38.0 29.0 38.0 105-109 35.348749999999995 38.0 36.0 38.0 28.8 38.0 110-114 35.27565 38.0 36.0 38.0 28.4 38.0 115-119 35.13945 38.0 35.8 38.0 28.2 38.0 120-124 34.79665 38.0 35.2 38.0 26.8 38.0 125-129 34.28724999999999 38.0 34.2 38.0 24.4 38.0 130-134 34.1342 38.0 34.0 38.0 23.2 38.0 135-139 33.343 38.0 33.0 38.0 19.0 38.0 140-144 32.511449999999996 37.8 31.8 38.0 14.0 38.0 145-149 31.28745 37.0 30.8 38.0 8.4 38.0 150-151 24.8845 32.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 1.0 16 4.0 17 2.0 18 3.0 19 5.0 20 8.0 21 3.0 22 11.0 23 10.0 24 15.0 25 21.0 26 27.0 27 34.0 28 47.0 29 56.0 30 59.0 31 115.0 32 127.0 33 177.0 34 266.0 35 444.0 36 997.0 37 1564.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.187877197585934 15.980057727630543 8.50170558908423 31.330359485699294 2 17.75 24.65 38.675 18.925 3 16.025 31.924999999999997 27.05 25.0 4 21.325 34.975 22.6 21.099999999999998 5 20.275000000000002 37.1 24.4 18.224999999999998 6 15.475 36.05 26.25 22.225 7 13.025 19.2 46.675 21.099999999999998 8 17.075000000000003 20.95 29.525000000000002 32.45 9 17.0 21.025 31.225 30.75 10-14 19.11 29.64 26.340000000000003 24.91 15-19 19.655 28.575 27.800000000000004 23.97 20-24 19.62 27.99 28.505000000000003 23.885 25-29 19.48 28.384999999999998 28.03 24.104999999999997 30-34 20.075000000000003 28.610000000000003 27.77 23.544999999999998 35-39 19.555 28.84 28.095 23.51 40-44 19.735 28.355000000000004 28.15 23.76 45-49 19.85 28.050000000000004 28.035 24.065 50-54 20.169999999999998 28.744999999999997 27.97 23.115 55-59 20.085 28.49 27.725 23.7 60-64 19.875 28.17 28.4 23.555 65-69 20.169999999999998 28.735 27.439999999999998 23.655 70-74 20.06 28.93 27.884999999999998 23.125 75-79 20.315 28.79 27.389999999999997 23.505000000000003 80-84 20.064999999999998 28.04 28.044999999999998 23.849999999999998 85-89 20.330000000000002 28.29 27.605 23.775 90-94 20.305 28.744999999999997 27.705000000000002 23.244999999999997 95-99 20.755000000000003 28.32 27.765 23.16 100-104 20.505000000000003 28.62 27.765 23.11 105-109 20.555 28.189999999999998 27.275 23.98 110-114 20.549999999999997 28.08 28.01 23.36 115-119 20.13 28.560000000000002 27.515 23.794999999999998 120-124 20.635 28.485 27.250000000000004 23.630000000000003 125-129 20.24 28.74 27.384999999999998 23.635 130-134 20.91 28.225 27.49 23.375 135-139 21.215 28.050000000000004 27.384999999999998 23.35 140-144 21.2 28.15 27.32 23.330000000000002 145-149 20.974999999999998 27.950000000000003 27.245 23.830000000000002 150-151 21.3625 27.0 26.875 24.762500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 2.0 20 2.5 21 0.5 22 0.5 23 2.5 24 3.5 25 4.0 26 4.0 27 8.5 28 14.5 29 17.0 30 19.5 31 26.0 32 38.5 33 49.5 34 68.0 35 86.0 36 102.5 37 122.0 38 134.5 39 163.5 40 194.0 41 217.5 42 238.0 43 253.5 44 268.5 45 262.5 46 274.5 47 261.5 48 207.0 49 187.5 50 165.0 51 139.0 52 111.0 53 76.0 54 66.5 55 52.5 56 45.0 57 36.5 58 16.5 59 12.5 60 12.5 61 8.0 62 4.5 63 4.0 64 3.0 65 4.5 66 3.0 67 2.0 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.2874999999999996 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 3.975 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.6 0.0 0.0 0.0 0.0 136-137 4.737500000000001 0.0 0.0 0.0 0.0 138-139 4.949999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170630 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170630_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.392 33.0 33.0 34.0 31.0 34.0 2 32.50625 33.0 33.0 34.0 31.0 34.0 3 32.5995 33.0 33.0 34.0 31.0 34.0 4 32.22875 33.0 33.0 34.0 31.0 34.0 5 32.34225 33.0 33.0 34.0 31.0 34.0 6 36.4465 38.0 38.0 38.0 34.0 38.0 7 36.6535 38.0 38.0 38.0 35.0 38.0 8 36.4235 38.0 38.0 38.0 34.0 38.0 9 36.55125 38.0 38.0 38.0 34.0 38.0 10-14 36.454750000000004 38.0 38.0 38.0 34.0 38.0 15-19 36.33970000000001 38.0 38.0 38.0 34.0 38.0 20-24 36.37005 38.0 38.0 38.0 34.0 38.0 25-29 36.27374999999999 38.0 38.0 38.0 34.0 38.0 30-34 36.299249999999994 38.0 38.0 38.0 34.0 38.0 35-39 36.1677 38.0 38.0 38.0 33.4 38.0 40-44 36.11084999999999 38.0 38.0 38.0 33.2 38.0 45-49 36.044200000000004 38.0 37.8 38.0 32.6 38.0 50-54 35.96895000000001 38.0 37.8 38.0 32.4 38.0 55-59 35.99975 38.0 37.8 38.0 33.0 38.0 60-64 35.8272 38.0 37.4 38.0 31.4 38.0 65-69 35.8549 38.0 37.2 38.0 31.8 38.0 70-74 35.799699999999994 38.0 37.2 38.0 31.4 38.0 75-79 35.67275 38.0 37.0 38.0 30.6 38.0 80-84 35.46515000000001 38.0 37.0 38.0 29.4 38.0 85-89 35.387750000000004 38.0 37.0 38.0 28.8 38.0 90-94 35.106899999999996 38.0 36.2 38.0 28.6 38.0 95-99 35.01325 38.0 36.0 38.0 28.2 38.0 100-104 34.8093 38.0 36.0 38.0 27.0 38.0 105-109 34.619600000000005 38.0 35.4 38.0 26.0 38.0 110-114 34.38145 38.0 35.2 38.0 24.4 38.0 115-119 33.97215 38.0 34.4 38.0 22.2 38.0 120-124 33.6377 38.0 33.6 38.0 19.4 38.0 125-129 33.130599999999994 38.0 33.0 38.0 15.0 38.0 130-134 32.6109 38.0 32.6 38.0 14.6 38.0 135-139 31.899700000000003 38.0 31.0 38.0 13.0 38.0 140-144 30.686400000000003 36.4 29.0 38.0 10.0 38.0 145-149 29.3796 36.0 27.4 38.0 2.0 38.0 150-151 23.567375 31.0 7.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 5.0 4 7.0 5 2.0 6 1.0 7 3.0 8 5.0 9 1.0 10 2.0 11 2.0 12 7.0 13 6.0 14 5.0 15 5.0 16 2.0 17 7.0 18 13.0 19 16.0 20 7.0 21 16.0 22 20.0 23 27.0 24 36.0 25 30.0 26 47.0 27 41.0 28 68.0 29 69.0 30 79.0 31 94.0 32 135.0 33 182.0 34 241.0 35 396.0 36 796.0 37 1613.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.225 15.0 13.100000000000001 29.675 2 22.2 24.025 36.199999999999996 17.575 3 19.35 27.075 31.85 21.725 4 22.6 36.425000000000004 20.875 20.1 5 21.525 39.225 21.55 17.7 6 17.375 38.675 22.975 20.974999999999998 7 17.549999999999997 15.425 45.6 21.425 8 19.0 21.45 27.975 31.574999999999996 9 21.9 23.400000000000002 28.425 26.275 10-14 21.875 28.59 27.265 22.27 15-19 22.96 27.589999999999996 28.205000000000002 21.245 20-24 22.37 28.360000000000003 28.34 20.93 25-29 22.36 28.910000000000004 27.955000000000002 20.775 30-34 22.475 28.050000000000004 28.025 21.45 35-39 22.12 28.365000000000002 28.395 21.12 40-44 22.36 28.22 28.095 21.325 45-49 22.48 28.29 28.275 20.955 50-54 22.42 27.725 28.549999999999997 21.305 55-59 22.79 27.66 28.199999999999996 21.349999999999998 60-64 22.905 28.015 27.58 21.5 65-69 22.895 27.834999999999997 27.955000000000002 21.315 70-74 22.78 28.110000000000003 28.18 20.93 75-79 22.955000000000002 27.825 28.189999999999998 21.029999999999998 80-84 23.105 28.035 27.76 21.099999999999998 85-89 23.095 28.02 27.74 21.145 90-94 22.825 28.965000000000003 27.650000000000002 20.560000000000002 95-99 22.62 28.76 27.87 20.75 100-104 23.615 28.144999999999996 27.615000000000002 20.625 105-109 23.565 28.134999999999998 27.845 20.455000000000002 110-114 23.665 27.58 28.18 20.575 115-119 23.445 27.689999999999998 28.544999999999998 20.32 120-124 23.630000000000003 27.595 27.6 21.175 125-129 23.39 27.905 27.889999999999997 20.815 130-134 23.71 27.365000000000002 28.185 20.74 135-139 24.145 27.3 28.105000000000004 20.45 140-144 24.275 27.625 27.685 20.415 145-149 24.025 27.825 28.02 20.13 150-151 24.349999999999998 27.6125 27.8875 20.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 2.0 23 2.5 24 2.0 25 5.5 26 6.5 27 6.0 28 7.0 29 12.0 30 23.0 31 29.0 32 37.5 33 42.0 34 52.5 35 72.5 36 90.5 37 118.0 38 136.0 39 170.0 40 192.5 41 199.0 42 243.0 43 254.0 44 261.5 45 279.0 46 271.5 47 248.0 48 217.0 49 196.0 50 173.5 51 141.5 52 109.0 53 97.0 54 82.5 55 57.5 56 42.5 57 36.0 58 21.0 59 14.0 60 13.5 61 8.5 62 8.0 63 6.0 64 2.5 65 1.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37011841773746 98.6 2 0.5291005291005291 1.05 3 0.05039052658100278 0.15 4 0.05039052658100278 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.0625 0.0 0.0 0.025 0.0 78-79 0.0875 0.0 0.0 0.025 0.0 80-81 0.125 0.0 0.0 0.025 0.0 82-83 0.125 0.0 0.0 0.025 0.0 84-85 0.16249999999999998 0.0 0.0 0.025 0.0 86-87 0.1875 0.0 0.0 0.025 0.0 88-89 0.25 0.0 0.0 0.025 0.0 90-91 0.275 0.0 0.0 0.025 0.0 92-93 0.4125 0.0 0.0 0.025 0.0 94-95 0.575 0.0 0.0 0.025 0.0 96-97 0.7 0.0 0.0 0.025 0.0 98-99 0.8375 0.0 0.0 0.025 0.0 100-101 0.95 0.0 0.0 0.025 0.0 102-103 1.0125 0.0 0.0 0.025 0.0 104-105 1.0875 0.0 0.0 0.025 0.0 106-107 1.25 0.0 0.0 0.025 0.0 108-109 1.3624999999999998 0.0 0.0 0.025 0.0 110-111 1.5375 0.0 0.0 0.025 0.0 112-113 1.625 0.0 0.0 0.025 0.0 114-115 1.7875 0.0 0.0 0.025 0.0 116-117 1.9375 0.0 0.0 0.025 0.0 118-119 2.2 0.0 0.0 0.025 0.0 120-121 2.4875 0.0 0.0 0.025 0.0 122-123 2.75 0.0 0.0 0.025 0.0 124-125 2.925 0.0 0.0 0.025 0.0 126-127 3.2874999999999996 0.0 0.0 0.025 0.0 128-129 3.7 0.0 0.0 0.025 0.0 130-131 4.0 0.0 0.0 0.025 0.0 132-133 4.3125 0.0 0.0 0.025 0.0 134-135 4.6125 0.0 0.0 0.025 0.0 136-137 4.762499999999999 0.0 0.0 0.025 0.0 138-139 4.975 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898388 spots for SRR7170630.sra Written 898388 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra Read 898384 spots for SRR7170630.sra Written 898384 spots for SRR7170630.sra SRR ids: ['SRR7170630.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jhjg2tbi SRR7170630.sra spots: 17967684 blocks: [[1, 898384], [898385, 1796768], [1796769, 2695152], [2695153, 3593536], [3593537, 4491920], [4491921, 5390304], [5390305, 6288688], [6288689, 7187072], [7187073, 8085456], [8085457, 8983840], [8983841, 9882224], [9882225, 10780608], [10780609, 11678992], [11678993, 12577376], [12577377, 13475760], [13475761, 14374144], [14374145, 15272528], [15272529, 16170912], [16170913, 17069296], [17069297, 17967684]] SRR7170630 file size 6066958 SRR7170630 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170630 SRR7170630_1.fastq SRR7170630_2.fastq Input file: SRR7170630_1.fastq Paired file: SRR7170630_2.fastq trimmed: SRR7170630-trimmed-pair1.fastq, SRR7170630-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:39:57 2025 >> started Thu Feb 13 13:40:19 2025 >> done (22.127s) 17967684 read pairs processed; of these: 27571 ( 0.15%) short read pairs filtered out after trimming by size control 38242 ( 0.21%) empty read pairs filtered out after trimming by size control 17901871 (99.63%) read pairs available; of these: 11339320 (63.34%) trimmed read pairs available after processing 6562551 (36.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 2 0.00% 20 14 0.00% 21 7 0.00% 22 7 0.00% 23 3 0.00% 24 9 0.00% 25 7 0.00% 26 8 0.00% 27 16 0.00% 28 14 0.00% 29 11 0.00% 30 15 0.00% 31 19 0.00% 32 8 0.00% 33 15 0.00% 34 20 0.00% 35 17 0.00% 36 20 0.00% 37 23 0.00% 38 29 0.00% 39 22 0.00% 40 33 0.00% 41 41 0.00% 42 44 0.00% 43 44 0.00% 44 39 0.00% 45 51 0.00% 46 42 0.00% 47 77 0.00% 48 80 0.00% 49 99 0.00% 50 105 0.00% 51 128 0.00% 52 117 0.00% 53 159 0.00% 54 150 0.00% 55 186 0.00% 56 201 0.00% 57 240 0.00% 58 291 0.00% 59 299 0.00% 60 330 0.00% 61 401 0.00% 62 478 0.00% 63 521 0.00% 64 535 0.00% 65 604 0.00% 66 705 0.00% 67 737 0.00% 68 789 0.00% 69 956 0.01% 70 997 0.01% 71 1207 0.01% 72 1420 0.01% 73 1501 0.01% 74 1706 0.01% 75 1819 0.01% 76 2058 0.01% 77 2268 0.01% 78 2464 0.01% 79 2675 0.01% 80 3050 0.02% 81 3511 0.02% 82 3833 0.02% 83 4562 0.03% 84 5915 0.03% 85 6728 0.04% 86 7151 0.04% 87 7494 0.04% 88 7650 0.04% 89 8103 0.05% 90 8347 0.05% 91 9034 0.05% 92 9628 0.05% 93 10325 0.06% 94 11046 0.06% 95 11577 0.06% 96 12139 0.07% 97 12511 0.07% 98 13198 0.07% 99 13450 0.08% 100 14122 0.08% 101 15091 0.08% 102 16033 0.09% 103 16763 0.09% 104 17491 0.10% 105 18630 0.10% 106 18933 0.11% 107 19772 0.11% 108 20282 0.11% 109 20936 0.12% 110 21806 0.12% 111 22980 0.13% 112 23902 0.13% 113 25021 0.14% 114 26631 0.15% 115 27678 0.15% 116 28362 0.16% 117 30053 0.17% 118 31071 0.17% 119 32022 0.18% 120 33661 0.19% 121 35013 0.20% 122 36930 0.21% 123 39989 0.22% 124 41981 0.23% 125 43983 0.25% 126 46771 0.26% 127 49925 0.28% 128 52346 0.29% 129 56143 0.31% 130 59945 0.33% 131 64617 0.36% 132 69403 0.39% 133 75190 0.42% 134 82777 0.46% 135 90520 0.51% 136 99958 0.56% 137 109030 0.61% 138 121111 0.68% 139 135335 0.76% 140 151975 0.85% 141 170732 0.95% 142 193539 1.08% 143 224216 1.25% 144 263265 1.47% 145 314511 1.76% 146 398414 2.23% 147 525164 2.93% 148 791594 4.42% 149 1475669 8.24% 150 4841891 27.05% 151 6562551 36.66% 17901871 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.63 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=14.35 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=2.8 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=23 prefix-density=0.49 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=50.38 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.0 sequence=TTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7170630 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:41:00 Started mapping on | Feb 13 13:41:01 Finished on | Feb 13 13:42:51 Mapping speed, Million of reads per hour | 585.88 Number of input reads | 17901871 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16769830 Uniquely mapped reads % | 93.68% Average mapped length | 292.23 Number of splices: Total | 16522813 Number of splices: Annotated (sjdb) | 16116653 Number of splices: GT/AG | 16218791 Number of splices: GC/AG | 239391 Number of splices: AT/AC | 9294 Number of splices: Non-canonical | 55337 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 479069 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 81475 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 679578 679578 679578 N_multimapping 479069 479069 479069 N_noFeature 715682 16469618 831342 N_ambiguous 328511 1670 142954 UnstrandedReadsAssigned:15725637 PositiveStrandReadsAssigned:298542 NegativeStrandReadsAssigned:15795534 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170630 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170630-trimmed-pair1.fastq SRR7170630-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,901,871 reads, 15,732,398 reads pseudoaligned [quant] estimated average fragment length: 272.925 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7170630.ke.tsv 34699 SRR7170630.se.tsv 87100 total ==> SRR7170630.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.08 920 30.8234 Potri.005G024800.1.v4.1 1035 763.075 238 18.2459 Potri.004G059700.1.v4.1 961 689.136 15 1.27333 Potri.007G009000.2.v4.1 1416 1144.08 0 0 Potri.003G141000.2.v4.1 2943 2671.08 681.331 14.922 Potri.016G087400.1.v4.1 270 74.1316 957.571 755.655 Potri.015G069301.1.v4.1 564 301.454 0 0 Potri.010G195200.1.v4.1 1773 1501.08 40 1.55888 Potri.012G127500.1.v4.1 977 705.115 253 20.9902 ==> SRR7170630.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 948 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 343 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR7170630 completed mapping pipeline successfully