Starting /dee2/code/volunteer_pipeline.sh SRR7170631 current disk space = 3090998902784 free memory = 1574755984 SRR7170631 SRAfilesize dade1020996d373157d217aff466b0e6 SRR7170631.sra SRR7170631.sra file validated SRR7170631 is paired end SRR7170631 is conventional basespace SRR7170631 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170631_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.7795 25.0 18.0 32.0 18.0 33.0 2 31.012 31.0 30.0 33.0 27.0 33.0 3 31.82775 33.0 31.0 33.0 29.0 33.0 4 32.58325 33.0 33.0 33.0 32.0 34.0 5 33.02 33.0 33.0 34.0 32.0 34.0 6 37.272 38.0 38.0 38.0 36.0 38.0 7 37.4225 38.0 38.0 38.0 37.0 38.0 8 37.473 38.0 38.0 38.0 37.0 38.0 9 37.45075 38.0 38.0 38.0 37.0 38.0 10-14 37.42829999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.3721 38.0 38.0 38.0 37.0 38.0 20-24 37.4725 38.0 38.0 38.0 37.0 38.0 25-29 37.45485 38.0 38.0 38.0 37.0 38.0 30-34 37.49305 38.0 38.0 38.0 37.4 38.0 35-39 37.413 38.0 38.0 38.0 37.0 38.0 40-44 37.4148 38.0 38.0 38.0 37.0 38.0 45-49 37.4097 38.0 38.0 38.0 37.0 38.0 50-54 37.249399999999994 38.0 38.0 38.0 36.6 38.0 55-59 37.162549999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.1296 38.0 38.0 38.0 36.0 38.0 65-69 37.03335 38.0 38.0 38.0 36.0 38.0 70-74 36.9881 38.0 38.0 38.0 36.0 38.0 75-79 36.86635 38.0 38.0 38.0 35.0 38.0 80-84 36.7722 38.0 38.0 38.0 35.0 38.0 85-89 36.6638 38.0 38.0 38.0 34.6 38.0 90-94 36.579449999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.47165 38.0 38.0 38.0 34.0 38.0 100-104 36.2313 38.0 37.2 38.0 33.8 38.0 105-109 36.07705 38.0 37.0 38.0 33.2 38.0 110-114 35.833549999999995 38.0 37.0 38.0 32.0 38.0 115-119 35.5815 38.0 36.0 38.0 30.6 38.0 120-124 35.502 38.0 36.0 38.0 30.6 38.0 125-129 35.414049999999996 38.0 36.0 38.0 30.6 38.0 130-134 35.116 38.0 35.2 38.0 28.6 38.0 135-139 34.53725000000001 38.0 34.4 38.0 26.2 38.0 140-144 33.71405 38.0 33.2 38.0 22.2 38.0 145-149 33.024950000000004 38.0 33.0 38.0 19.8 38.0 150-151 28.588875 34.5 24.0 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 3.0 14 0.0 15 3.0 16 1.0 17 0.0 18 1.0 19 8.0 20 0.0 21 5.0 22 6.0 23 5.0 24 5.0 25 8.0 26 19.0 27 18.0 28 20.0 29 38.0 30 46.0 31 52.0 32 79.0 33 130.0 34 202.0 35 354.0 36 925.0 37 2071.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.728796343321484 17.826307770441847 13.45860843067547 32.9862874555612 2 18.925 26.174999999999997 36.25 18.65 3 16.5 31.125000000000004 28.299999999999997 24.075 4 21.224999999999998 36.625 22.825 19.325 5 20.485242621310658 36.36818409204602 24.16208104052026 18.98449224612306 6 16.400000000000002 34.575 25.174999999999997 23.849999999999998 7 13.325000000000001 19.375 45.775 21.525 8 17.95 21.025 29.349999999999998 31.674999999999997 9 18.075 21.8 30.099999999999998 30.025000000000002 10-14 19.72 29.275000000000002 26.665 24.34 15-19 20.205000000000002 28.105000000000004 27.944999999999997 23.745 20-24 19.42 28.765 28.144999999999996 23.669999999999998 25-29 19.67 28.599999999999998 27.615000000000002 24.115000000000002 30-34 19.564999999999998 28.82 27.93 23.685000000000002 35-39 19.869999999999997 28.425 28.165000000000003 23.54 40-44 19.84 28.470000000000002 27.76 23.93 45-49 20.365 28.560000000000002 27.595 23.48 50-54 19.875 28.465 28.315 23.345 55-59 20.165 28.34 28.1 23.395 60-64 20.015 28.439999999999998 28.405 23.14 65-69 19.994999999999997 28.035 28.38 23.59 70-74 20.13 28.765 28.110000000000003 22.994999999999997 75-79 20.294999999999998 27.744999999999997 28.425 23.535 80-84 19.975 28.804999999999996 28.08 23.14 85-89 20.16 28.48 27.615000000000002 23.745 90-94 20.085 28.810000000000002 27.779999999999998 23.325000000000003 95-99 20.65 28.51 27.68 23.16 100-104 20.305 29.12 27.315 23.26 105-109 20.775 28.32 27.365000000000002 23.54 110-114 20.455000000000002 28.08 27.650000000000002 23.815 115-119 20.935000000000002 28.64 27.435 22.99 120-124 20.805 28.389999999999997 27.544999999999998 23.26 125-129 20.235 28.499999999999996 27.51 23.755000000000003 130-134 20.695 27.765 27.54 24.0 135-139 20.880000000000003 28.144999999999996 27.105 23.87 140-144 20.66 28.475 27.02 23.845 145-149 20.52 28.67 27.075 23.735 150-151 20.1625 28.975 27.6 23.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.5 21 2.5 22 2.5 23 3.5 24 3.0 25 3.0 26 6.0 27 8.0 28 10.5 29 16.0 30 25.0 31 38.0 32 35.5 33 36.0 34 63.5 35 83.5 36 95.0 37 112.0 38 139.0 39 167.5 40 195.0 41 220.0 42 248.5 43 262.5 44 251.5 45 263.0 46 273.0 47 262.5 48 245.5 49 208.5 50 160.5 51 131.5 52 113.5 53 83.0 54 59.0 55 46.0 56 36.5 57 28.5 58 20.0 59 13.0 60 6.5 61 6.5 62 5.0 63 2.0 64 1.0 65 0.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52213279678068 98.925 2 0.4024144869215292 0.8 3 0.025150905432595575 0.075 4 0.05030181086519115 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.35 0.0 0.0 0.0 0.0 124-125 2.6125 0.0 0.0 0.0 0.0 126-127 2.875 0.0 0.0 0.0 0.0 128-129 3.025 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.8 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAAAC 10 0.006832588 144.9875 2 TCAGTTT 10 0.006832588 144.9875 2 TCTCTCT 10 0.006832588 144.9875 5 >>END_MODULE SRR7170631 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170631_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.793 33.0 33.0 34.0 32.0 34.0 2 32.887 33.0 33.0 34.0 32.0 34.0 3 32.9625 34.0 33.0 34.0 32.0 34.0 4 32.90925 34.0 33.0 34.0 32.0 34.0 5 32.93325 34.0 33.0 34.0 32.0 34.0 6 37.1035 38.0 38.0 38.0 37.0 38.0 7 37.177 38.0 38.0 38.0 37.0 38.0 8 37.22575 38.0 38.0 38.0 37.0 38.0 9 37.1575 38.0 38.0 38.0 37.0 38.0 10-14 37.1102 38.0 38.0 38.0 37.0 38.0 15-19 37.05725 38.0 38.0 38.0 36.8 38.0 20-24 37.0717 38.0 38.0 38.0 37.0 38.0 25-29 36.9685 38.0 38.0 38.0 36.6 38.0 30-34 36.931799999999996 38.0 38.0 38.0 36.2 38.0 35-39 36.96874999999999 38.0 38.0 38.0 36.8 38.0 40-44 36.9342 38.0 38.0 38.0 36.2 38.0 45-49 36.9077 38.0 38.0 38.0 36.2 38.0 50-54 36.83325000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.7962 38.0 38.0 38.0 36.0 38.0 60-64 36.786500000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.66645 38.0 38.0 38.0 35.2 38.0 70-74 36.67635 38.0 38.0 38.0 35.6 38.0 75-79 36.60565 38.0 38.0 38.0 35.2 38.0 80-84 36.522800000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.41385 38.0 38.0 38.0 34.4 38.0 90-94 36.27705 38.0 38.0 38.0 34.0 38.0 95-99 36.210750000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.02115 38.0 38.0 38.0 33.6 38.0 105-109 35.92185 38.0 37.4 38.0 33.2 38.0 110-114 35.65725 38.0 37.0 38.0 31.8 38.0 115-119 35.52445 38.0 37.0 38.0 31.0 38.0 120-124 35.45745 38.0 37.0 38.0 31.0 38.0 125-129 35.12949999999999 38.0 36.0 38.0 29.4 38.0 130-134 34.601350000000004 38.0 35.2 38.0 27.6 38.0 135-139 34.178549999999994 38.0 33.6 38.0 25.4 38.0 140-144 33.54065 38.0 33.0 38.0 21.6 38.0 145-149 32.4644 38.0 33.0 38.0 12.0 38.0 150-151 27.117125 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 2.0 4 4.0 5 3.0 6 3.0 7 3.0 8 1.0 9 3.0 10 2.0 11 4.0 12 2.0 13 4.0 14 5.0 15 2.0 16 4.0 17 3.0 18 2.0 19 9.0 20 12.0 21 8.0 22 9.0 23 11.0 24 11.0 25 10.0 26 18.0 27 20.0 28 24.0 29 21.0 30 35.0 31 49.0 32 75.0 33 110.0 34 149.0 35 289.0 36 694.0 37 2386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.699999999999996 16.05 14.575 28.675 2 23.400000000000002 24.125 35.6 16.875 3 20.175 25.724999999999998 32.9 21.2 4 23.75 34.925 21.75 19.575 5 22.1 38.5 20.775 18.625 6 17.675 37.3 24.349999999999998 20.674999999999997 7 17.1 15.625 46.525 20.75 8 19.900000000000002 21.575 29.175 29.349999999999998 9 22.275 22.1 29.375 26.25 10-14 21.98 28.815 27.339999999999996 21.865000000000002 15-19 22.17 27.74 28.475 21.615000000000002 20-24 22.685 28.975 27.805000000000003 20.535 25-29 22.095000000000002 28.665000000000003 28.475 20.765 30-34 22.994999999999997 28.34 28.115000000000002 20.549999999999997 35-39 22.54 28.055000000000003 28.244999999999997 21.16 40-44 22.475 27.675 28.51 21.34 45-49 23.085 28.055000000000003 28.115000000000002 20.745 50-54 22.695 27.715 28.52 21.07 55-59 23.115 28.465 27.68 20.74 60-64 22.655 27.839999999999996 28.560000000000002 20.945 65-69 22.79 28.000000000000004 28.16 21.05 70-74 22.905 27.845 28.189999999999998 21.060000000000002 75-79 23.465 28.27 27.750000000000004 20.515 80-84 22.830000000000002 28.375 28.110000000000003 20.685000000000002 85-89 22.814999999999998 28.03 27.800000000000004 21.355 90-94 23.075000000000003 27.950000000000003 28.02 20.955 95-99 22.81 28.255000000000003 28.265 20.669999999999998 100-104 23.41 27.97 28.115000000000002 20.505000000000003 105-109 23.305 28.105000000000004 28.065 20.525 110-114 23.515 27.665 28.83 19.99 115-119 23.77 28.07 28.105000000000004 20.055 120-124 23.419999999999998 27.72 28.199999999999996 20.66 125-129 23.785 28.005000000000003 28.12 20.09 130-134 23.9 28.38 27.6 20.119999999999997 135-139 23.59 28.065 27.55 20.794999999999998 140-144 24.735 27.700000000000003 27.435 20.13 145-149 24.09 28.749999999999996 27.150000000000002 20.01 150-151 24.55 27.375 28.0875 19.9875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.5 18 2.0 19 3.0 20 2.5 21 0.5 22 2.0 23 1.5 24 1.5 25 3.0 26 6.0 27 10.0 28 14.0 29 11.0 30 13.0 31 26.5 32 31.5 33 39.5 34 55.5 35 66.0 36 82.5 37 105.5 38 126.0 39 167.5 40 221.0 41 241.0 42 261.5 43 268.0 44 255.0 45 285.5 46 282.5 47 251.0 48 227.5 49 180.0 50 150.0 51 131.5 52 98.5 53 84.0 54 74.5 55 52.0 56 42.5 57 38.5 58 29.5 59 17.5 60 8.5 61 6.5 62 8.0 63 5.0 64 1.5 65 1.0 66 0.5 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14206409285894 98.225 2 0.8074690890739339 1.6 3 0.025233409033560434 0.075 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.3875000000000002 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.8499999999999996 0.0 0.0 0.0 0.0 128-129 3.025 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.4875 0.0 0.0 0.0 0.0 136-137 3.8 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710599 spots for SRR7170631.sra Written 710599 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra Read 710597 spots for SRR7170631.sra Written 710597 spots for SRR7170631.sra SRR ids: ['SRR7170631.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yanbmg6j SRR7170631.sra spots: 14211942 blocks: [[1, 710597], [710598, 1421194], [1421195, 2131791], [2131792, 2842388], [2842389, 3552985], [3552986, 4263582], [4263583, 4974179], [4974180, 5684776], [5684777, 6395373], [6395374, 7105970], [7105971, 7816567], [7816568, 8527164], [8527165, 9237761], [9237762, 9948358], [9948359, 10658955], [10658956, 11369552], [11369553, 12080149], [12080150, 12790746], [12790747, 13501343], [13501344, 14211942]] SRR7170631 file size 4794260 SRR7170631 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170631 SRR7170631_1.fastq SRR7170631_2.fastq Input file: SRR7170631_1.fastq Paired file: SRR7170631_2.fastq trimmed: SRR7170631-trimmed-pair1.fastq, SRR7170631-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:24:37 2025 >> started Thu Feb 13 13:24:54 2025 >> done (16.459s) 14211942 read pairs processed; of these: 13751 ( 0.10%) short read pairs filtered out after trimming by size control 17228 ( 0.12%) empty read pairs filtered out after trimming by size control 14180963 (99.78%) read pairs available; of these: 7674558 (54.12%) trimmed read pairs available after processing 6506405 (45.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 13 0.00% 20 8 0.00% 21 4 0.00% 22 6 0.00% 23 15 0.00% 24 10 0.00% 25 9 0.00% 26 7 0.00% 27 8 0.00% 28 5 0.00% 29 5 0.00% 30 10 0.00% 31 6 0.00% 32 6 0.00% 33 9 0.00% 34 15 0.00% 35 17 0.00% 36 16 0.00% 37 12 0.00% 38 17 0.00% 39 19 0.00% 40 19 0.00% 41 24 0.00% 42 22 0.00% 43 18 0.00% 44 32 0.00% 45 26 0.00% 46 49 0.00% 47 48 0.00% 48 64 0.00% 49 61 0.00% 50 76 0.00% 51 69 0.00% 52 93 0.00% 53 102 0.00% 54 89 0.00% 55 111 0.00% 56 115 0.00% 57 177 0.00% 58 174 0.00% 59 214 0.00% 60 223 0.00% 61 251 0.00% 62 249 0.00% 63 267 0.00% 64 334 0.00% 65 365 0.00% 66 365 0.00% 67 410 0.00% 68 505 0.00% 69 543 0.00% 70 621 0.00% 71 649 0.00% 72 858 0.01% 73 935 0.01% 74 1021 0.01% 75 1161 0.01% 76 1412 0.01% 77 1402 0.01% 78 1520 0.01% 79 1667 0.01% 80 1861 0.01% 81 2084 0.01% 82 2332 0.02% 83 2615 0.02% 84 3575 0.03% 85 4203 0.03% 86 4384 0.03% 87 4617 0.03% 88 4912 0.03% 89 5218 0.04% 90 5324 0.04% 91 5781 0.04% 92 6177 0.04% 93 6656 0.05% 94 6892 0.05% 95 7448 0.05% 96 7682 0.05% 97 8064 0.06% 98 8560 0.06% 99 9063 0.06% 100 9415 0.07% 101 9964 0.07% 102 10462 0.07% 103 10848 0.08% 104 11483 0.08% 105 12094 0.09% 106 12638 0.09% 107 13015 0.09% 108 13444 0.09% 109 14095 0.10% 110 14653 0.10% 111 15289 0.11% 112 16039 0.11% 113 16585 0.12% 114 16947 0.12% 115 17766 0.13% 116 18559 0.13% 117 19236 0.14% 118 19834 0.14% 119 20318 0.14% 120 21538 0.15% 121 22293 0.16% 122 23313 0.16% 123 24832 0.18% 124 25544 0.18% 125 26494 0.19% 126 27675 0.20% 127 28673 0.20% 128 30241 0.21% 129 31854 0.22% 130 33463 0.24% 131 35338 0.25% 132 37702 0.27% 133 40068 0.28% 134 42910 0.30% 135 46475 0.33% 136 50106 0.35% 137 55021 0.39% 138 60443 0.43% 139 66242 0.47% 140 74626 0.53% 141 83877 0.59% 142 96854 0.68% 143 112682 0.79% 144 136003 0.96% 145 171314 1.21% 146 217897 1.54% 147 306574 2.16% 148 481979 3.40% 149 961372 6.78% 150 3884458 27.39% 151 6506405 45.88% 14180963 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.54 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.15 sequence-density-rank=18 fanout-score=21.56 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=8.4 sequence=TCCTCCTTGTTGTACATGCCGGGAAGTTGCACATTTGTTGGGTTGTCAGCAATGTTCATGAGGGTAGCATTAACCATCTGGTTGTTGAC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=11 prefix-density=0.76 prefix-fanout=2.5 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=47.15 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170631 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:25:40 Started mapping on | Feb 13 13:25:40 Finished on | Feb 13 13:27:13 Mapping speed, Million of reads per hour | 548.94 Number of input reads | 14180963 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13392120 Uniquely mapped reads % | 94.44% Average mapped length | 294.55 Number of splices: Total | 13353173 Number of splices: Annotated (sjdb) | 13063587 Number of splices: GT/AG | 13098910 Number of splices: GC/AG | 211698 Number of splices: AT/AC | 7725 Number of splices: Non-canonical | 34840 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356773 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 37407 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 446433 446433 446433 N_multimapping 356773 356773 356773 N_noFeature 546199 13167260 632950 N_ambiguous 231030 885 92388 UnstrandedReadsAssigned:12614891 PositiveStrandReadsAssigned:223975 NegativeStrandReadsAssigned:12666782 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170631 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170631-trimmed-pair1.fastq SRR7170631-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,180,963 reads, 12,652,441 reads pseudoaligned [quant] estimated average fragment length: 283.723 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,240 rounds 52401 SRR7170631.ke.tsv 34699 SRR7170631.se.tsv 87100 total ==> SRR7170631.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.28 556 24.9231 Potri.005G024800.1.v4.1 1035 752.277 98 10.1332 Potri.004G059700.1.v4.1 961 678.415 18 2.06383 Potri.007G009000.2.v4.1 1416 1133.28 0 0 Potri.003G141000.2.v4.1 2943 2660.28 609.411 17.8189 Potri.016G087400.1.v4.1 270 73.9334 485 510.267 Potri.015G069301.1.v4.1 564 294.485 0 0 Potri.010G195200.1.v4.1 1773 1490.28 21 1.0961 Potri.012G127500.1.v4.1 977 694.35 133 14.8994 ==> SRR7170631.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 974 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7170631 completed mapping pipeline successfully