Starting /dee2/code/volunteer_pipeline.sh SRR7170632 current disk space = 3090988679168 free memory = 1575907612 SRR7170632 SRAfilesize 1d73ed45a36ca5cf93c9d97d2792fea1 SRR7170632.sra SRR7170632.sra file validated SRR7170632 is paired end SRR7170632 is conventional basespace SRR7170632 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170632_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.64225 18.0 18.0 18.0 18.0 32.0 2 25.19175 27.0 25.0 27.0 18.0 30.0 3 25.41875 27.0 25.0 29.0 18.0 31.0 4 28.4455 29.0 27.0 31.0 25.0 33.0 5 29.7395 31.0 29.0 33.0 25.0 33.0 6 35.484 37.0 35.0 38.0 31.0 38.0 7 36.73675 38.0 37.0 38.0 34.0 38.0 8 36.7895 38.0 37.0 38.0 34.0 38.0 9 37.162 38.0 38.0 38.0 36.0 38.0 10-14 37.29559999999999 38.0 38.0 38.0 36.6 38.0 15-19 37.369899999999994 38.0 38.0 38.0 36.8 38.0 20-24 37.544349999999994 38.0 38.0 38.0 37.6 38.0 25-29 37.55895 38.0 38.0 38.0 38.0 38.0 30-34 37.523399999999995 38.0 38.0 38.0 37.4 38.0 35-39 37.52115 38.0 38.0 38.0 37.0 38.0 40-44 37.4948 38.0 38.0 38.0 37.2 38.0 45-49 37.4503 38.0 38.0 38.0 37.0 38.0 50-54 37.3502 38.0 38.0 38.0 37.0 38.0 55-59 37.21435 38.0 38.0 38.0 36.2 38.0 60-64 37.1991 38.0 38.0 38.0 36.0 38.0 65-69 37.161500000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.02034999999999 38.0 38.0 38.0 35.8 38.0 75-79 36.8392 38.0 38.0 38.0 35.2 38.0 80-84 36.72725 38.0 38.0 38.0 35.0 38.0 85-89 36.6826 38.0 38.0 38.0 35.0 38.0 90-94 36.58820000000001 38.0 38.0 38.0 34.6 38.0 95-99 36.4232 38.0 38.0 38.0 34.0 38.0 100-104 36.20025 38.0 37.2 38.0 33.8 38.0 105-109 36.15565 38.0 37.0 38.0 33.6 38.0 110-114 35.92745 38.0 37.0 38.0 33.0 38.0 115-119 35.671749999999996 38.0 36.4 38.0 31.0 38.0 120-124 35.51965 38.0 36.0 38.0 30.6 38.0 125-129 35.390550000000005 38.0 36.0 38.0 30.6 38.0 130-134 35.12475 38.0 35.4 38.0 28.8 38.0 135-139 34.91645 38.0 35.2 38.0 28.2 38.0 140-144 34.29675 38.0 34.6 38.0 25.4 38.0 145-149 33.3247 38.0 33.2 38.0 20.6 38.0 150-151 28.472625 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 2.0 17 0.0 18 3.0 19 18.0 20 3.0 21 0.0 22 3.0 23 7.0 24 5.0 25 4.0 26 3.0 27 15.0 28 27.0 29 28.0 30 41.0 31 64.0 32 79.0 33 136.0 34 201.0 35 414.0 36 1190.0 37 1753.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.7026060296372 31.936637710781806 12.800204394481348 29.560551865099644 2 19.675 27.375 36.625 16.325 3 18.475 30.349999999999998 28.9 22.275 4 19.8 36.125 23.325000000000003 20.75 5 21.13028257064266 37.35933983495874 22.755688922230558 18.754688672168044 6 15.75 36.15 25.3 22.8 7 12.3 21.325 45.6 20.775 8 17.224999999999998 23.125 27.800000000000004 31.85 9 18.95 23.375 30.075000000000003 27.6 10-14 19.064999999999998 30.745 26.185000000000002 24.005000000000003 15-19 19.259999999999998 30.085 27.185 23.47 20-24 19.32 29.799999999999997 27.065 23.815 25-29 19.555 29.68 27.450000000000003 23.315 30-34 19.38 29.294999999999998 28.185 23.14 35-39 19.35 29.78 27.689999999999998 23.18 40-44 19.66 29.265 28.105000000000004 22.97 45-49 20.150000000000002 29.465000000000003 27.42 22.965 50-54 20.285 29.37 27.235 23.11 55-59 20.419999999999998 28.725 27.169999999999998 23.685000000000002 60-64 20.185 29.38 27.839999999999996 22.595000000000002 65-69 19.939999999999998 28.444999999999997 28.139999999999997 23.474999999999998 70-74 19.675 30.06 26.865 23.400000000000002 75-79 19.765 29.160000000000004 27.235 23.84 80-84 19.985 29.37 26.919999999999998 23.724999999999998 85-89 19.415 29.060000000000002 27.42 24.104999999999997 90-94 19.509999999999998 28.73 27.63 24.13 95-99 20.27 29.145 27.22 23.365 100-104 20.395 28.4 27.055 24.15 105-109 19.950000000000003 28.555000000000003 27.575 23.919999999999998 110-114 20.419999999999998 28.694999999999997 26.889999999999997 23.995 115-119 20.555 28.625 26.97 23.849999999999998 120-124 20.34 28.000000000000004 27.97 23.69 125-129 20.7 28.360000000000003 27.025 23.915 130-134 20.485 28.37 27.62 23.525 135-139 20.5 28.144999999999996 26.93 24.425 140-144 20.59 28.444999999999997 26.765 24.2 145-149 20.41 28.275 27.115000000000002 24.2 150-151 20.025000000000002 28.5625 27.0625 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 2.0 22 1.5 23 4.0 24 7.5 25 8.5 26 11.0 27 15.0 28 18.5 29 30.0 30 35.5 31 39.5 32 58.5 33 71.5 34 78.0 35 94.0 36 123.0 37 147.5 38 157.0 39 170.5 40 178.0 41 190.5 42 220.0 43 227.0 44 234.5 45 238.5 46 234.0 47 232.5 48 222.5 49 182.0 50 150.0 51 131.5 52 104.0 53 94.0 54 78.5 55 60.5 56 48.5 57 33.0 58 16.5 59 13.0 60 12.0 61 7.5 62 5.5 63 3.5 64 1.5 65 2.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75286332400101 97.0 2 0.9671672181216595 1.9 3 0.20361415118350726 0.6 4 0.025451768897938407 0.1 5 0.025451768897938407 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025451768897938407 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 7 (97% over 35bp) AATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 9 (97% over 35bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7250000000000001 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.5375 0.0 0.0 0.0 0.0 128-129 3.7625 0.0 0.0 0.0 0.0 130-131 4.0 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.675 0.0 0.0 0.0 0.0 136-137 4.9625 0.0 0.0 0.0 0.0 138-139 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170632 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170632_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59425 33.0 33.0 34.0 32.0 34.0 2 32.80125 33.0 33.0 34.0 32.0 34.0 3 32.858 34.0 33.0 34.0 32.0 34.0 4 32.81025 34.0 33.0 34.0 32.0 34.0 5 32.88675 34.0 33.0 34.0 32.0 34.0 6 37.028 38.0 38.0 38.0 36.0 38.0 7 37.05775 38.0 38.0 38.0 36.0 38.0 8 37.0495 38.0 38.0 38.0 36.0 38.0 9 36.9425 38.0 38.0 38.0 36.0 38.0 10-14 36.9985 38.0 38.0 38.0 36.0 38.0 15-19 36.98645 38.0 38.0 38.0 36.0 38.0 20-24 36.97265 38.0 38.0 38.0 36.0 38.0 25-29 36.89235 38.0 38.0 38.0 36.0 38.0 30-34 36.86925 38.0 38.0 38.0 36.0 38.0 35-39 36.915800000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.8427 38.0 38.0 38.0 36.0 38.0 45-49 36.81034999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.731950000000005 38.0 38.0 38.0 35.0 38.0 55-59 36.6564 38.0 38.0 38.0 35.0 38.0 60-64 36.658899999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.70405000000001 38.0 38.0 38.0 35.0 38.0 70-74 36.66675 38.0 38.0 38.0 35.0 38.0 75-79 36.600500000000004 38.0 38.0 38.0 34.8 38.0 80-84 36.30505000000001 38.0 38.0 38.0 34.2 38.0 85-89 36.2182 38.0 38.0 38.0 34.0 38.0 90-94 36.15725 38.0 38.0 38.0 33.8 38.0 95-99 35.992149999999995 38.0 37.8 38.0 33.2 38.0 100-104 35.81085 38.0 37.0 38.0 31.8 38.0 105-109 35.7299 38.0 37.0 38.0 32.0 38.0 110-114 35.45505 38.0 36.8 38.0 30.2 38.0 115-119 35.0572 38.0 36.0 38.0 28.6 38.0 120-124 35.18115 38.0 36.0 38.0 29.2 38.0 125-129 34.8673 38.0 35.6 38.0 28.2 38.0 130-134 34.51395 38.0 34.8 38.0 26.6 38.0 135-139 34.045249999999996 38.0 33.4 38.0 23.8 38.0 140-144 33.44154999999999 38.0 33.0 38.0 20.8 38.0 145-149 32.38185 38.0 33.0 38.0 11.0 38.0 150-151 26.70225 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 2.0 5 1.0 6 3.0 7 1.0 8 1.0 9 4.0 10 3.0 11 2.0 12 0.0 13 0.0 14 0.0 15 3.0 16 3.0 17 5.0 18 2.0 19 15.0 20 10.0 21 8.0 22 6.0 23 13.0 24 17.0 25 18.0 26 16.0 27 20.0 28 41.0 29 43.0 30 61.0 31 84.0 32 79.0 33 124.0 34 189.0 35 287.0 36 662.0 37 2267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.5 15.975 15.725 30.8 2 24.2 23.974999999999998 34.9 16.925 3 20.525 27.325 32.824999999999996 19.325 4 24.975 35.625 20.724999999999998 18.675 5 23.674999999999997 36.475 21.45 18.4 6 19.36452339254441 36.42732049036778 24.618463847885916 19.5896922692019 7 18.3591795897949 16.3831915957979 43.82191095547774 21.435717858929465 8 20.290217663247436 23.44258193645234 26.720040030022517 29.54716037027771 9 23.88694347173587 22.961480740370185 28.01400700350175 25.137568784392194 10-14 23.232778027915355 28.58071939566762 26.574616038821354 21.61188653759568 15-19 23.763317161006352 27.914770169559343 27.51463012054219 20.80728254889211 20-24 23.72686343171586 28.009004502251127 27.41870935467734 20.845422711355678 25-29 23.695663048371767 28.112650692811762 27.177229753389025 21.014456505427443 30-34 23.050372667700465 28.01260567255265 28.507828522835275 20.42919313691161 35-39 24.105668684645018 27.64296792915395 27.222694751588534 21.028668634612497 40-44 24.208156117087814 27.5806855141356 27.23042281711284 20.98073555166375 45-49 23.75687843921961 27.848924462231118 27.358679339669834 21.03551775887944 50-54 23.97959183673469 27.34093637454982 27.495998399359745 21.183473389355743 55-59 23.53412047228337 27.396437862717633 27.941765059035422 21.12767660596358 60-64 23.272800040022013 26.969833408374605 27.780279153534444 21.977087398068935 65-69 24.298504476566798 26.95443405191817 27.51463012054219 21.232431350972842 70-74 23.22348352252838 28.824323648547285 27.219082862429367 20.733109966494975 75-79 23.83834342019707 27.494623118091333 27.879757915270343 20.787275546441254 80-84 23.10077519379845 27.596899224806204 28.267066766691674 21.035258814703674 85-89 24.157247174152246 27.41322396719016 27.52325697709313 20.90627188156447 90-94 24.46489297859572 27.640528105621126 27.020404080816164 20.874174834966993 95-99 23.294999999999998 27.83 28.12 20.755000000000003 100-104 24.026201310065503 27.51637581879094 27.78138906945347 20.676033801690085 105-109 23.822146643993197 27.76332899869961 28.288486545963785 20.1260378113434 110-114 23.44758568926695 28.036027020265198 28.03102326745059 20.485364023017265 115-119 24.646090740833376 27.137211745285377 27.68745935671052 20.529238157170727 120-124 24.493674051107668 27.51412711906786 27.97919687953193 20.013001950292544 125-129 24.111027756939237 27.51187796949237 28.247061765441362 20.130032508127034 130-134 24.763714557183576 27.649147372105816 27.76916537480622 19.817972695904384 135-139 24.61600040026017 27.703006954520436 27.758042727773052 19.92294991744634 140-144 24.1819273491444 27.549284499149408 28.15971179825878 20.109076353447414 145-149 24.485 27.865000000000002 27.894999999999996 19.755 150-151 24.8 26.450000000000003 28.462500000000002 20.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 1.0 14 1.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 2.5 24 3.0 25 4.0 26 5.5 27 5.5 28 7.0 29 10.0 30 14.0 31 16.5 32 23.5 33 36.0 34 47.5 35 54.5 36 61.5 37 82.0 38 106.0 39 160.5 40 195.5 41 202.5 42 231.5 43 245.0 44 268.5 45 271.5 46 263.0 47 254.5 48 219.5 49 209.5 50 190.0 51 156.5 52 135.5 53 102.0 54 88.5 55 89.0 56 64.5 57 49.5 58 37.5 59 26.0 60 21.5 61 11.0 62 8.0 63 5.0 64 1.5 65 1.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.05 8 0.075 9 0.05 10-14 0.055 15-19 0.034999999999999996 20-24 0.05 25-29 0.045 30-34 0.045 35-39 0.065 40-44 0.075 45-49 0.05 50-54 0.04 55-59 0.06 60-64 0.055 65-69 0.034999999999999996 70-74 0.015 75-79 0.034999999999999996 80-84 0.025 85-89 0.03 90-94 0.02 95-99 0.0 100-104 0.005 105-109 0.03 110-114 0.075 115-119 0.045 120-124 0.015 125-129 0.025 130-134 0.015 135-139 0.065 140-144 0.06999999999999999 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88012216849071 97.125 2 0.814456604734029 1.6 3 0.22906592008144566 0.675 4 0.050903537795876815 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025451768897938407 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 16 0.4 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.225 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.9 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 3.9625 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.5375 0.0 0.0 0.0 0.0 134-135 4.925 0.0 0.0 0.0 0.0 136-137 5.1875 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793252 spots for SRR7170632.sra Written 793252 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra Read 793246 spots for SRR7170632.sra Written 793246 spots for SRR7170632.sra SRR ids: ['SRR7170632.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g5trwvb1 SRR7170632.sra spots: 15864926 blocks: [[1, 793246], [793247, 1586492], [1586493, 2379738], [2379739, 3172984], [3172985, 3966230], [3966231, 4759476], [4759477, 5552722], [5552723, 6345968], [6345969, 7139214], [7139215, 7932460], [7932461, 8725706], [8725707, 9518952], [9518953, 10312198], [10312199, 11105444], [11105445, 11898690], [11898691, 12691936], [12691937, 13485182], [13485183, 14278428], [14278429, 15071674], [15071675, 15864926]] SRR7170632 file size 5354402 SRR7170632 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170632 SRR7170632_1.fastq SRR7170632_2.fastq Input file: SRR7170632_1.fastq Paired file: SRR7170632_2.fastq trimmed: SRR7170632-trimmed-pair1.fastq, SRR7170632-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:25:45 2025 >> started Thu Feb 13 13:26:02 2025 >> done (17.154s) 15864926 read pairs processed; of these: 14290 ( 0.09%) short read pairs filtered out after trimming by size control 86683 ( 0.55%) empty read pairs filtered out after trimming by size control 15763953 (99.36%) read pairs available; of these: 8170329 (51.83%) trimmed read pairs available after processing 7593624 (48.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 10 0.00% 20 7 0.00% 21 6 0.00% 22 3 0.00% 23 7 0.00% 24 12 0.00% 25 10 0.00% 26 9 0.00% 27 7 0.00% 28 6 0.00% 29 8 0.00% 30 15 0.00% 31 12 0.00% 32 21 0.00% 33 21 0.00% 34 7 0.00% 35 20 0.00% 36 19 0.00% 37 25 0.00% 38 41 0.00% 39 33 0.00% 40 49 0.00% 41 30 0.00% 42 45 0.00% 43 34 0.00% 44 55 0.00% 45 73 0.00% 46 90 0.00% 47 113 0.00% 48 93 0.00% 49 123 0.00% 50 135 0.00% 51 145 0.00% 52 162 0.00% 53 154 0.00% 54 189 0.00% 55 174 0.00% 56 221 0.00% 57 229 0.00% 58 276 0.00% 59 294 0.00% 60 325 0.00% 61 402 0.00% 62 464 0.00% 63 502 0.00% 64 575 0.00% 65 580 0.00% 66 599 0.00% 67 663 0.00% 68 704 0.00% 69 746 0.00% 70 944 0.01% 71 1069 0.01% 72 1296 0.01% 73 1407 0.01% 74 1692 0.01% 75 2130 0.01% 76 3241 0.02% 77 3802 0.02% 78 2425 0.02% 79 2463 0.02% 80 2714 0.02% 81 3128 0.02% 82 3387 0.02% 83 4105 0.03% 84 4913 0.03% 85 5680 0.04% 86 5877 0.04% 87 6244 0.04% 88 6570 0.04% 89 6851 0.04% 90 7320 0.05% 91 7945 0.05% 92 8691 0.06% 93 9395 0.06% 94 9866 0.06% 95 10565 0.07% 96 10791 0.07% 97 11316 0.07% 98 11593 0.07% 99 12275 0.08% 100 12784 0.08% 101 13510 0.09% 102 14624 0.09% 103 15340 0.10% 104 16246 0.10% 105 16772 0.11% 106 17819 0.11% 107 18265 0.12% 108 18549 0.12% 109 19026 0.12% 110 19709 0.13% 111 20500 0.13% 112 22014 0.14% 113 23466 0.15% 114 24049 0.15% 115 24751 0.16% 116 25050 0.16% 117 25850 0.16% 118 26546 0.17% 119 26780 0.17% 120 27801 0.18% 121 29069 0.18% 122 30342 0.19% 123 32206 0.20% 124 33703 0.21% 125 34715 0.22% 126 35841 0.23% 127 37075 0.24% 128 38399 0.24% 129 40114 0.25% 130 41685 0.26% 131 43458 0.28% 132 45864 0.29% 133 48641 0.31% 134 51915 0.33% 135 55393 0.35% 136 58899 0.37% 137 63622 0.40% 138 68438 0.43% 139 75194 0.48% 140 82011 0.52% 141 92429 0.59% 142 105371 0.67% 143 120945 0.77% 144 138764 0.88% 145 172414 1.09% 146 221705 1.41% 147 314645 2.00% 148 468091 2.97% 149 902868 5.73% 150 4078820 25.87% 151 7593624 48.17% 15763953 reads passed initial QC criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=11 prefix-density=1.13 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=34.55 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=4.6 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGAT criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=11 prefix-density=0.93 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.36 sequence-density-rank=15 fanout-score=12.04 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=4.7 sequence=AGCAATGGCAGCA SRR7170632 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:26:42 Started mapping on | Feb 13 13:26:43 Finished on | Feb 13 13:28:27 Mapping speed, Million of reads per hour | 545.68 Number of input reads | 15763953 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14773481 Uniquely mapped reads % | 93.72% Average mapped length | 293.95 Number of splices: Total | 13235227 Number of splices: Annotated (sjdb) | 12937175 Number of splices: GT/AG | 12960308 Number of splices: GC/AG | 227582 Number of splices: AT/AC | 11116 Number of splices: Non-canonical | 36221 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418448 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 32004 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.35% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 586828 586828 586828 N_multimapping 418448 418448 418448 N_noFeature 458970 14466851 532527 N_ambiguous 359585 1101 126002 UnstrandedReadsAssigned:13954926 PositiveStrandReadsAssigned:305529 NegativeStrandReadsAssigned:14114952 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170632 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170632-trimmed-pair1.fastq SRR7170632-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,763,953 reads, 14,072,734 reads pseudoaligned [quant] estimated average fragment length: 257.21 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR7170632.ke.tsv 34699 SRR7170632.se.tsv 87100 total ==> SRR7170632.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.79 255.471 7.81347 Potri.005G024800.1.v4.1 1035 778.79 174 12.0389 Potri.004G059700.1.v4.1 961 704.834 11 0.840934 Potri.007G009000.2.v4.1 1416 1159.79 0 0 Potri.003G141000.2.v4.1 2943 2686.79 496 9.94728 Potri.016G087400.1.v4.1 270 76.1133 1092 773.07 Potri.015G069301.1.v4.1 564 313.54 0 0 Potri.010G195200.1.v4.1 1773 1516.79 13 0.461822 Potri.012G127500.1.v4.1 977 720.828 135 10.0916 ==> SRR7170632.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 188 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 368 Potri.001G212900.v4.1 550 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170632 completed mapping pipeline successfully