Starting /dee2/code/volunteer_pipeline.sh SRR7170633 current disk space = 3091576950784 free memory = 1436397196 SRR7170633 SRAfilesize 5c500e3cd06adaa5ae3ee3f4e371f4ee SRR7170633.sra SRR7170633.sra file validated SRR7170633 is paired end SRR7170633 is conventional basespace SRR7170633 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170633_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.0095 18.0 18.0 25.0 18.0 32.0 2 25.23475 27.0 25.0 28.0 18.0 31.0 3 25.06275 25.0 18.0 29.0 18.0 31.0 4 28.276 29.0 27.0 31.0 25.0 33.0 5 30.4045 32.0 31.0 33.0 25.0 33.0 6 35.30075 37.0 35.0 38.0 31.0 38.0 7 36.629 38.0 37.0 38.0 34.0 38.0 8 36.78125 38.0 37.0 38.0 34.0 38.0 9 37.14975 38.0 38.0 38.0 36.0 38.0 10-14 37.254650000000005 38.0 38.0 38.0 36.2 38.0 15-19 37.325750000000006 38.0 38.0 38.0 36.6 38.0 20-24 37.512150000000005 38.0 38.0 38.0 37.2 38.0 25-29 37.496449999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.422149999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.4548 38.0 38.0 38.0 37.2 38.0 40-44 37.351350000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.29875 38.0 38.0 38.0 37.0 38.0 50-54 37.20235 38.0 38.0 38.0 36.2 38.0 55-59 37.144099999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.1155 38.0 38.0 38.0 36.0 38.0 65-69 37.0634 38.0 38.0 38.0 35.8 38.0 70-74 36.92295 38.0 38.0 38.0 35.4 38.0 75-79 36.701499999999996 38.0 38.0 38.0 34.8 38.0 80-84 36.6962 38.0 38.0 38.0 34.8 38.0 85-89 36.5163 38.0 38.0 38.0 34.4 38.0 90-94 36.3834 38.0 38.0 38.0 33.8 38.0 95-99 36.31165 38.0 37.8 38.0 33.8 38.0 100-104 36.04795 38.0 37.0 38.0 33.0 38.0 105-109 36.022400000000005 38.0 37.0 38.0 33.0 38.0 110-114 35.89715 38.0 37.0 38.0 32.6 38.0 115-119 35.6027 38.0 36.4 38.0 30.6 38.0 120-124 35.518950000000004 38.0 36.0 38.0 30.6 38.0 125-129 35.172399999999996 38.0 35.8 38.0 28.8 38.0 130-134 34.614549999999994 38.0 35.0 38.0 27.0 38.0 135-139 33.93885 38.0 33.8 38.0 22.8 38.0 140-144 33.236700000000006 38.0 33.2 38.0 19.0 38.0 145-149 32.560649999999995 38.0 33.0 38.0 15.2 38.0 150-151 28.619500000000002 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 6.0 19 12.0 20 6.0 21 6.0 22 6.0 23 7.0 24 10.0 25 10.0 26 17.0 27 24.0 28 27.0 29 42.0 30 53.0 31 61.0 32 90.0 33 155.0 34 221.0 35 423.0 36 1162.0 37 1660.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.968580994076746 26.088076229719288 11.408704609837754 28.53463816636621 2 20.95 24.575 34.925 19.55 3 18.15 31.15 28.025 22.675 4 20.875 34.775 22.125 22.225 5 21.305326331582897 36.809202300575144 23.355838959739934 18.529632408102024 6 17.175 34.65 25.624999999999996 22.55 7 13.675 20.7 43.225 22.400000000000002 8 18.325 21.4 27.375 32.9 9 17.724999999999998 22.0 29.325000000000003 30.95 10-14 19.345000000000002 30.104999999999997 25.845000000000002 24.705 15-19 19.79 28.9 27.29 24.02 20-24 19.98 29.395 26.655 23.97 25-29 19.09 29.12 27.450000000000003 24.34 30-34 19.825 28.685 27.605 23.885 35-39 20.4 28.775000000000002 26.72 24.104999999999997 40-44 19.865 28.54 27.445000000000004 24.15 45-49 20.825 28.025 27.415 23.735 50-54 20.305 28.285 27.474999999999998 23.935000000000002 55-59 20.330000000000002 28.07 27.400000000000002 24.2 60-64 19.86 28.115000000000002 27.250000000000004 24.775 65-69 19.57 28.335 27.785 24.310000000000002 70-74 20.1 28.645 27.445000000000004 23.810000000000002 75-79 20.544999999999998 28.095 27.279999999999998 24.08 80-84 19.79 28.634999999999998 27.505000000000003 24.07 85-89 20.349999999999998 28.26 27.6 23.79 90-94 20.1 28.720000000000002 27.060000000000002 24.12 95-99 20.599999999999998 27.87 27.705000000000002 23.825 100-104 19.675 28.475 27.500000000000004 24.349999999999998 105-109 20.375 28.025 27.525 24.075 110-114 20.23 27.93 27.465 24.375 115-119 20.74 28.044999999999998 27.125 24.09 120-124 20.605 28.26 26.96 24.175 125-129 20.79 27.58 27.834999999999997 23.794999999999998 130-134 21.035 27.634999999999998 27.18 24.15 135-139 20.75 27.825 27.295 24.13 140-144 21.14 27.73 26.61 24.52 145-149 21.135 27.584999999999997 26.634999999999998 24.645 150-151 20.5375 28.3875 26.400000000000002 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 5.0 26 6.0 27 5.5 28 10.5 29 15.0 30 27.5 31 36.5 32 37.5 33 49.5 34 72.5 35 90.0 36 101.0 37 112.0 38 132.0 39 161.0 40 166.0 41 179.0 42 212.5 43 236.0 44 254.0 45 247.0 46 230.5 47 237.0 48 227.5 49 205.0 50 189.0 51 167.5 52 127.5 53 95.0 54 83.5 55 72.5 56 62.5 57 52.0 58 36.0 59 17.5 60 10.5 61 9.5 62 6.5 63 2.0 64 1.0 65 2.0 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.56630824372759 96.25 2 1.0496671786994367 2.0500000000000003 3 0.2048131080389145 0.6 4 0.10240655401945725 0.4 5 0.0 0.0 6 0.025601638504864313 0.15 7 0.025601638504864313 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025601638504864313 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 15 0.375 TruSeq Adapter, Index 6 (97% over 36bp) GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 7 0.17500000000000002 No Hit CTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.9500000000000002 0.0 0.0 0.0 0.0 118-119 2.225 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 3.025 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.1 0.0 0.0 0.0 0.0 134-135 4.4375 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAGTT 10 0.006836113 144.9625 7 GTACAGT 10 0.006836113 144.9625 6 TCTGCCT 10 0.006836113 144.9625 7 ATATCTG 10 0.006836113 144.9625 4 ATCTGCC 10 0.006836113 144.9625 6 AGTACAG 20 3.5913987E-4 108.72187 5 TTTTTTT 65 0.0076506594 13.381154 70-74 >>END_MODULE SRR7170633 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170633_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63525 33.0 33.0 34.0 32.0 34.0 2 32.7675 33.0 33.0 34.0 32.0 34.0 3 32.76525 33.0 33.0 34.0 32.0 34.0 4 32.65875 33.0 33.0 34.0 32.0 34.0 5 32.66075 33.0 33.0 34.0 32.0 34.0 6 36.85825 38.0 38.0 38.0 36.0 38.0 7 36.85525 38.0 38.0 38.0 36.0 38.0 8 36.8185 38.0 38.0 38.0 36.0 38.0 9 36.81775 38.0 38.0 38.0 36.0 38.0 10-14 36.852500000000006 38.0 38.0 38.0 35.8 38.0 15-19 36.84475 38.0 38.0 38.0 36.0 38.0 20-24 36.743 38.0 38.0 38.0 35.4 38.0 25-29 36.70805 38.0 38.0 38.0 35.0 38.0 30-34 36.637950000000004 38.0 38.0 38.0 34.8 38.0 35-39 36.6723 38.0 38.0 38.0 35.2 38.0 40-44 36.71925 38.0 38.0 38.0 35.4 38.0 45-49 36.5475 38.0 38.0 38.0 34.8 38.0 50-54 36.52175 38.0 38.0 38.0 34.4 38.0 55-59 36.383950000000006 38.0 38.0 38.0 34.0 38.0 60-64 36.3845 38.0 38.0 38.0 34.0 38.0 65-69 36.36405 38.0 38.0 38.0 34.0 38.0 70-74 36.32235000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.207049999999995 38.0 38.0 38.0 33.8 38.0 80-84 35.98395000000001 38.0 38.0 38.0 32.8 38.0 85-89 35.79305 38.0 37.4 38.0 32.0 38.0 90-94 35.70915 38.0 37.0 38.0 31.2 38.0 95-99 35.529450000000004 38.0 37.0 38.0 30.6 38.0 100-104 35.274 38.0 36.6 38.0 29.6 38.0 105-109 35.1969 38.0 36.6 38.0 29.2 38.0 110-114 35.0624 38.0 36.0 38.0 28.4 38.0 115-119 34.73715 38.0 35.8 38.0 26.4 38.0 120-124 34.4893 38.0 35.4 38.0 24.8 38.0 125-129 33.902499999999996 38.0 34.0 38.0 21.8 38.0 130-134 33.50385 38.0 33.0 38.0 21.0 38.0 135-139 33.27225 38.0 33.0 38.0 19.8 38.0 140-144 32.481199999999994 38.0 33.0 38.0 14.0 38.0 145-149 31.230200000000004 38.0 31.2 38.0 8.0 38.0 150-151 26.036875000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 8.0 4 0.0 5 2.0 6 5.0 7 3.0 8 0.0 9 1.0 10 0.0 11 0.0 12 3.0 13 5.0 14 6.0 15 4.0 16 9.0 17 6.0 18 9.0 19 14.0 20 16.0 21 10.0 22 15.0 23 11.0 24 19.0 25 30.0 26 32.0 27 31.0 28 50.0 29 57.0 30 48.0 31 92.0 32 101.0 33 138.0 34 199.0 35 315.0 36 710.0 37 2046.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.225 17.075000000000003 13.925 27.775 2 23.974999999999998 23.849999999999998 32.95 19.225 3 20.175 26.974999999999998 32.1 20.75 4 22.5 35.85 21.625 20.025000000000002 5 23.150000000000002 37.175000000000004 22.0 17.675 6 18.075 37.325 23.7 20.9 7 17.424999999999997 16.075 44.125 22.375 8 20.95 22.35 26.05 30.65 9 21.625 24.975 27.150000000000002 26.25 10-14 22.89 28.744999999999997 26.775 21.59 15-19 23.45 27.24 28.439999999999998 20.87 20-24 23.095 27.47 28.34 21.095 25-29 23.345 27.935 27.715 21.005 30-34 22.869999999999997 27.779999999999998 28.33 21.02 35-39 22.645 27.095000000000002 28.42 21.84 40-44 23.095 27.29 28.285 21.33 45-49 22.770000000000003 27.98 27.77 21.48 50-54 23.31 27.150000000000002 27.950000000000003 21.59 55-59 23.685000000000002 26.950000000000003 27.72 21.645 60-64 23.205000000000002 27.145000000000003 27.49 22.16 65-69 23.53 27.455000000000002 27.255000000000003 21.759999999999998 70-74 23.115 27.750000000000004 26.840000000000003 22.295 75-79 23.26 27.355 27.405 21.98 80-84 23.674999999999997 27.62 27.224999999999998 21.48 85-89 24.240000000000002 27.639999999999997 26.945000000000004 21.175 90-94 23.575 27.77 27.229999999999997 21.425 95-99 23.785 27.21 27.41 21.595 100-104 24.33 27.529999999999998 27.485 20.655 105-109 24.69 27.065 27.595 20.65 110-114 24.099999999999998 27.565 27.389999999999997 20.945 115-119 24.295 27.705000000000002 27.215 20.785 120-124 24.21 27.215 27.644999999999996 20.93 125-129 24.725 27.58 27.04 20.655 130-134 24.959999999999997 27.1 26.915 21.025 135-139 25.575 27.384999999999998 26.590000000000003 20.45 140-144 24.545 27.355 27.38 20.72 145-149 24.945 27.675 27.13 20.25 150-151 24.975 27.0625 27.9375 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.5 23 1.5 24 2.0 25 2.5 26 5.0 27 8.0 28 9.0 29 11.0 30 12.5 31 15.0 32 20.5 33 30.5 34 41.5 35 49.5 36 67.5 37 90.5 38 122.0 39 154.5 40 171.5 41 195.0 42 221.5 43 250.0 44 278.5 45 281.5 46 260.5 47 236.0 48 225.5 49 227.5 50 188.0 51 149.5 52 141.5 53 118.0 54 103.0 55 87.0 56 65.0 57 45.0 58 28.5 59 22.0 60 16.0 61 10.0 62 10.5 63 8.0 64 3.5 65 3.0 66 2.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18087318087319 94.45 2 1.1694386694386696 2.25 3 0.2858627858627859 0.8250000000000001 4 0.07796257796257797 0.3 5 0.10395010395010396 0.5 6 0.05197505197505198 0.3 7 0.02598752598752599 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.10395010395010396 1.2 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 15 0.375 Illumina Single End PCR Primer 1 (96% over 32bp) TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 13 0.325 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 10 0.25 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 10 0.25 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 7 0.17500000000000002 No Hit GTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGC 6 0.15 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 6 0.15 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 5 0.125 No Hit CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 5 0.125 No Hit GTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTG 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.1 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.7125 0.0 0.0 0.0 0.0 130-131 3.95 0.0 0.0 0.0 0.0 132-133 4.175 0.0 0.0 0.0 0.0 134-135 4.5 0.0 0.0 0.0 0.0 136-137 4.7625 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACAGT 10 0.006830828 145.0 145 TCTCAGT 10 0.006830828 145.0 1 >>END_MODULE Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801116 spots for SRR7170633.sra Written 801116 spots for SRR7170633.sra Read 801133 spots for SRR7170633.sra Written 801133 spots for SRR7170633.sra SRR ids: ['SRR7170633.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4bik83z1 SRR7170633.sra spots: 16022337 blocks: [[1, 801116], [801117, 1602232], [1602233, 2403348], [2403349, 3204464], [3204465, 4005580], [4005581, 4806696], [4806697, 5607812], [5607813, 6408928], [6408929, 7210044], [7210045, 8011160], [8011161, 8812276], [8812277, 9613392], [9613393, 10414508], [10414509, 11215624], [11215625, 12016740], [12016741, 12817856], [12817857, 13618972], [13618973, 14420088], [14420089, 15221204], [15221205, 16022337]] SRR7170633 file size 5407743 SRR7170633 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170633 SRR7170633_1.fastq SRR7170633_2.fastq Input file: SRR7170633_1.fastq Paired file: SRR7170633_2.fastq trimmed: SRR7170633-trimmed-pair1.fastq, SRR7170633-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:52:15 2025 >> started Thu Feb 13 12:52:32 2025 >> done (17.072s) 16022337 read pairs processed; of these: 25030 ( 0.16%) short read pairs filtered out after trimming by size control 73072 ( 0.46%) empty read pairs filtered out after trimming by size control 15924235 (99.39%) read pairs available; of these: 8308216 (52.17%) trimmed read pairs available after processing 7616019 (47.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 5 0.00% 21 8 0.00% 22 1 0.00% 23 7 0.00% 24 9 0.00% 25 14 0.00% 26 12 0.00% 27 12 0.00% 28 12 0.00% 29 12 0.00% 30 19 0.00% 31 20 0.00% 32 11 0.00% 33 12 0.00% 34 16 0.00% 35 15 0.00% 36 26 0.00% 37 34 0.00% 38 27 0.00% 39 23 0.00% 40 34 0.00% 41 50 0.00% 42 33 0.00% 43 36 0.00% 44 51 0.00% 45 59 0.00% 46 65 0.00% 47 101 0.00% 48 92 0.00% 49 94 0.00% 50 91 0.00% 51 125 0.00% 52 139 0.00% 53 131 0.00% 54 150 0.00% 55 153 0.00% 56 157 0.00% 57 179 0.00% 58 201 0.00% 59 249 0.00% 60 265 0.00% 61 323 0.00% 62 325 0.00% 63 397 0.00% 64 422 0.00% 65 460 0.00% 66 508 0.00% 67 559 0.00% 68 578 0.00% 69 637 0.00% 70 764 0.00% 71 881 0.01% 72 1067 0.01% 73 1255 0.01% 74 1466 0.01% 75 1921 0.01% 76 3232 0.02% 77 2905 0.02% 78 2013 0.01% 79 2233 0.01% 80 2409 0.02% 81 2759 0.02% 82 3061 0.02% 83 3514 0.02% 84 4648 0.03% 85 5522 0.03% 86 5971 0.04% 87 6621 0.04% 88 6331 0.04% 89 6694 0.04% 90 7021 0.04% 91 7386 0.05% 92 7859 0.05% 93 8657 0.05% 94 9044 0.06% 95 9712 0.06% 96 10017 0.06% 97 10226 0.06% 98 10759 0.07% 99 11162 0.07% 100 11458 0.07% 101 12299 0.08% 102 13010 0.08% 103 13659 0.09% 104 14331 0.09% 105 15276 0.10% 106 15746 0.10% 107 15988 0.10% 108 16654 0.10% 109 17497 0.11% 110 18149 0.11% 111 18650 0.12% 112 19607 0.12% 113 21030 0.13% 114 21822 0.14% 115 22040 0.14% 116 22668 0.14% 117 23716 0.15% 118 24230 0.15% 119 24681 0.15% 120 26209 0.16% 121 27075 0.17% 122 27963 0.18% 123 30200 0.19% 124 31360 0.20% 125 32432 0.20% 126 34008 0.21% 127 35919 0.23% 128 37792 0.24% 129 38618 0.24% 130 40431 0.25% 131 42255 0.27% 132 45040 0.28% 133 47946 0.30% 134 51598 0.32% 135 54830 0.34% 136 58859 0.37% 137 63756 0.40% 138 69717 0.44% 139 76066 0.48% 140 83658 0.53% 141 94785 0.60% 142 108017 0.68% 143 125546 0.79% 144 148056 0.93% 145 180715 1.13% 146 228681 1.44% 147 320259 2.01% 148 486630 3.06% 149 964670 6.06% 150 4168537 26.18% 151 7616019 47.83% 15924235 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=15 prefix-density=0.80 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.15 sequence-density-rank=21 fanout-score=23.45 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=8.7 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=13 prefix-density=0.92 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=34.49 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=1.8 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7170633 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:53:19 Started mapping on | Feb 13 12:53:20 Finished on | Feb 13 12:55:25 Mapping speed, Million of reads per hour | 458.62 Number of input reads | 15924235 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14890378 Uniquely mapped reads % | 93.51% Average mapped length | 294.34 Number of splices: Total | 15565501 Number of splices: Annotated (sjdb) | 15272201 Number of splices: GT/AG | 15285659 Number of splices: GC/AG | 228671 Number of splices: AT/AC | 9814 Number of splices: Non-canonical | 41357 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394132 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 26039 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 660413 660413 660413 N_multimapping 394132 394132 394132 N_noFeature 396265 14474824 471868 N_ambiguous 447197 946 106759 UnstrandedReadsAssigned:14046916 PositiveStrandReadsAssigned:414608 NegativeStrandReadsAssigned:14311751 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170633 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170633-trimmed-pair1.fastq SRR7170633-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,924,235 reads, 14,129,222 reads pseudoaligned [quant] estimated average fragment length: 269.765 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7170633.ke.tsv 34699 SRR7170633.se.tsv 87100 total ==> SRR7170633.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.24 698 17.2936 Potri.005G024800.1.v4.1 1035 766.235 465 26.3009 Potri.004G059700.1.v4.1 961 692.288 10 0.626026 Potri.007G009000.2.v4.1 1416 1147.24 0 0 Potri.003G141000.2.v4.1 2943 2674.24 871.543 14.1244 Potri.016G087400.1.v4.1 270 74.2789 1289.76 752.529 Potri.015G069301.1.v4.1 564 303.669 0 0 Potri.010G195200.1.v4.1 1773 1504.24 124 3.57261 Potri.012G127500.1.v4.1 977 708.278 62 3.79374 ==> SRR7170633.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 362 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 415 Potri.001G212900.v4.1 29 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR7170633 completed mapping pipeline successfully