Starting /dee2/code/volunteer_pipeline.sh SRR7170634 current disk space = 3091405398016 free memory = 1482447196 SRR7170634 SRAfilesize 604f24fbac6ce6a0db8d106ae58187c3 SRR7170634.sra SRR7170634.sra file validated SRR7170634 is paired end SRR7170634 is conventional basespace SRR7170634 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170634_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.498 18.0 18.0 18.0 18.0 32.0 2 25.449 27.0 25.0 27.0 18.0 30.0 3 24.42875 25.0 18.0 29.0 18.0 31.0 4 28.16525 29.0 27.0 31.0 25.0 33.0 5 30.2565 32.0 30.0 33.0 25.0 33.0 6 34.7625 37.0 34.0 38.0 29.0 38.0 7 36.28125 38.0 36.0 38.0 33.0 38.0 8 36.42675 38.0 36.0 38.0 34.0 38.0 9 36.98525 38.0 38.0 38.0 35.0 38.0 10-14 37.17625 38.0 38.0 38.0 36.0 38.0 15-19 37.324749999999995 38.0 38.0 38.0 36.8 38.0 20-24 37.516149999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.530899999999995 38.0 38.0 38.0 37.4 38.0 30-34 37.5203 38.0 38.0 38.0 37.4 38.0 35-39 37.488800000000005 38.0 38.0 38.0 37.4 38.0 40-44 37.4381 38.0 38.0 38.0 37.0 38.0 45-49 37.426249999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.349199999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.2297 38.0 38.0 38.0 36.4 38.0 60-64 37.19605 38.0 38.0 38.0 36.0 38.0 65-69 37.1471 38.0 38.0 38.0 36.0 38.0 70-74 37.05985 38.0 38.0 38.0 36.0 38.0 75-79 36.8962 38.0 38.0 38.0 35.4 38.0 80-84 36.92999999999999 38.0 38.0 38.0 35.2 38.0 85-89 36.809749999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.6244 38.0 38.0 38.0 34.2 38.0 95-99 36.45 38.0 37.6 38.0 33.8 38.0 100-104 36.288500000000006 38.0 37.4 38.0 33.6 38.0 105-109 36.275150000000004 38.0 37.0 38.0 33.8 38.0 110-114 36.0596 38.0 37.0 38.0 33.0 38.0 115-119 35.707899999999995 38.0 36.4 38.0 31.0 38.0 120-124 35.5857 38.0 36.2 38.0 30.6 38.0 125-129 35.41065 38.0 36.0 38.0 30.0 38.0 130-134 35.311449999999994 38.0 35.6 38.0 29.6 38.0 135-139 35.05930000000001 38.0 35.0 38.0 28.2 38.0 140-144 34.4773 38.0 34.6 38.0 26.2 38.0 145-149 33.55115 38.0 33.0 38.0 23.2 38.0 150-151 28.77225 34.5 24.0 37.5 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 3.0 19 5.0 20 3.0 21 0.0 22 2.0 23 4.0 24 4.0 25 8.0 26 7.0 27 10.0 28 16.0 29 32.0 30 61.0 31 63.0 32 83.0 33 135.0 34 231.0 35 394.0 36 1248.0 37 1687.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.807926829268293 36.9410569105691 11.585365853658537 30.665650406504064 2 20.974999999999998 27.025 36.449999999999996 15.55 3 19.825 29.975 27.425 22.775000000000002 4 20.625 36.475 21.6 21.3 5 22.54190642982237 36.27720790592945 22.566925193895422 18.613960470352765 6 15.875 36.225 26.325 21.575 7 13.425 19.1 46.025 21.45 8 18.675 20.275000000000002 28.275 32.775 9 17.925 20.724999999999998 31.55 29.799999999999997 10-14 18.96 30.555 26.35 24.135 15-19 19.765 28.655 28.1 23.48 20-24 19.335 28.675 27.815 24.175 25-29 19.455 28.904999999999998 28.26 23.380000000000003 30-34 19.919999999999998 28.685 27.905 23.49 35-39 19.830000000000002 29.195 27.37 23.605 40-44 19.855 29.235 27.685 23.225 45-49 19.715 28.810000000000002 27.834999999999997 23.64 50-54 19.744999999999997 28.425 27.965 23.865 55-59 19.755 28.475 27.810000000000002 23.96 60-64 20.075000000000003 28.765 27.584999999999997 23.575 65-69 20.345 28.42 27.560000000000002 23.674999999999997 70-74 20.195 27.825 28.07 23.91 75-79 19.755 28.76 27.48 24.005000000000003 80-84 20.01 28.01 28.000000000000004 23.98 85-89 20.05 28.585 28.189999999999998 23.175 90-94 19.744999999999997 28.675 28.105000000000004 23.474999999999998 95-99 20.035 28.04 28.139999999999997 23.785 100-104 20.4 28.610000000000003 27.884999999999998 23.105 105-109 19.895 28.050000000000004 28.470000000000002 23.585 110-114 20.65 28.53 27.005000000000003 23.815 115-119 20.555 28.945 27.04 23.46 120-124 20.810000000000002 28.09 27.71 23.39 125-129 20.625 28.415000000000003 27.18 23.78 130-134 20.580000000000002 28.645 26.985 23.79 135-139 20.395 28.005000000000003 27.51 24.09 140-144 20.51 28.075 27.74 23.674999999999997 145-149 20.544999999999998 28.355000000000004 27.33 23.77 150-151 20.355088772193046 28.507126781695426 27.294323580895224 23.843460865216304 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.5 20 1.0 21 0.5 22 1.0 23 1.5 24 3.0 25 4.5 26 8.0 27 10.0 28 12.5 29 18.5 30 24.5 31 35.5 32 42.0 33 52.0 34 75.5 35 95.0 36 97.0 37 119.0 38 166.0 39 184.0 40 196.0 41 215.5 42 229.5 43 251.5 44 261.5 45 255.5 46 257.0 47 237.5 48 206.5 49 191.5 50 163.0 51 124.0 52 104.0 53 89.0 54 66.0 55 59.0 56 45.0 57 24.5 58 19.5 59 14.5 60 11.0 61 8.0 62 5.5 63 4.5 64 1.5 65 0.0 66 0.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.554016620498615 1.0999999999999999 3 0.0503651473180559 0.15 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.037500000000000006 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.1 0.0 0.0 0.025 0.0 88-89 0.125 0.0 0.0 0.025 0.0 90-91 0.125 0.0 0.0 0.025 0.0 92-93 0.2 0.0 0.0 0.025 0.0 94-95 0.25 0.0 0.0 0.025 0.0 96-97 0.25 0.0 0.0 0.025 0.0 98-99 0.275 0.0 0.0 0.025 0.0 100-101 0.3125 0.0 0.0 0.025 0.0 102-103 0.325 0.0 0.0 0.025 0.0 104-105 0.3375 0.0 0.0 0.025 0.0 106-107 0.4375 0.0 0.0 0.025 0.0 108-109 0.5625 0.0 0.0 0.025 0.0 110-111 0.7250000000000001 0.0 0.0 0.025 0.0 112-113 0.875 0.0 0.0 0.025 0.0 114-115 1.025 0.0 0.0 0.025 0.0 116-117 1.15 0.0 0.0 0.025 0.0 118-119 1.3125 0.0 0.0 0.025 0.0 120-121 1.525 0.0 0.0 0.025 0.0 122-123 1.7375 0.0 0.0 0.025 0.0 124-125 2.0125 0.0 0.0 0.025 0.0 126-127 2.1125 0.0 0.0 0.025 0.0 128-129 2.3 0.0 0.0 0.025 0.0 130-131 2.4375 0.0 0.0 0.025 0.0 132-133 2.7249999999999996 0.0 0.0 0.025 0.0 134-135 3.0375 0.0 0.0 0.025 0.0 136-137 3.25 0.0 0.0 0.025 0.0 138-139 3.575 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTTCT 10 0.006830828 145.0 3 GTTGGGG 10 0.006830828 145.0 1 CTTCCAC 10 0.006830828 145.0 6 >>END_MODULE SRR7170634 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170634_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74475 33.0 33.0 34.0 32.0 34.0 2 32.8515 33.0 33.0 34.0 32.0 34.0 3 32.86775 34.0 33.0 34.0 32.0 34.0 4 32.71675 33.0 33.0 34.0 32.0 34.0 5 32.7545 33.0 33.0 34.0 32.0 34.0 6 36.89625 38.0 38.0 38.0 36.0 38.0 7 36.97875 38.0 38.0 38.0 36.0 38.0 8 37.019 38.0 38.0 38.0 36.0 38.0 9 37.03725 38.0 38.0 38.0 36.0 38.0 10-14 37.037949999999995 38.0 38.0 38.0 36.4 38.0 15-19 37.0309 38.0 38.0 38.0 36.0 38.0 20-24 36.9824 38.0 38.0 38.0 36.0 38.0 25-29 36.94755 38.0 38.0 38.0 36.0 38.0 30-34 36.9337 38.0 38.0 38.0 36.0 38.0 35-39 36.9326 38.0 38.0 38.0 36.0 38.0 40-44 36.94045 38.0 38.0 38.0 36.0 38.0 45-49 36.90839999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.727050000000006 38.0 38.0 38.0 35.4 38.0 55-59 36.7087 38.0 38.0 38.0 35.0 38.0 60-64 36.68915 38.0 38.0 38.0 35.0 38.0 65-69 36.7033 38.0 38.0 38.0 35.0 38.0 70-74 36.62475 38.0 38.0 38.0 35.0 38.0 75-79 36.589600000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.50555 38.0 38.0 38.0 34.2 38.0 85-89 36.424549999999996 38.0 38.0 38.0 34.2 38.0 90-94 36.34545000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.2336 38.0 38.0 38.0 34.0 38.0 100-104 36.0328 38.0 37.8 38.0 33.0 38.0 105-109 35.888999999999996 38.0 37.2 38.0 32.8 38.0 110-114 35.68525 38.0 37.0 38.0 31.8 38.0 115-119 35.502199999999995 38.0 36.8 38.0 31.0 38.0 120-124 35.36865 38.0 36.4 38.0 30.6 38.0 125-129 35.075199999999995 38.0 36.0 38.0 28.8 38.0 130-134 34.63605 38.0 35.0 38.0 27.2 38.0 135-139 34.24065 38.0 33.6 38.0 25.2 38.0 140-144 33.66215 38.0 33.0 38.0 22.2 38.0 145-149 32.798350000000006 38.0 33.0 38.0 16.4 38.0 150-151 27.57725 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 3.0 5 0.0 6 1.0 7 0.0 8 3.0 9 3.0 10 0.0 11 3.0 12 0.0 13 4.0 14 3.0 15 2.0 16 6.0 17 3.0 18 5.0 19 8.0 20 8.0 21 6.0 22 9.0 23 12.0 24 12.0 25 15.0 26 22.0 27 22.0 28 25.0 29 37.0 30 53.0 31 77.0 32 88.0 33 106.0 34 164.0 35 305.0 36 677.0 37 2309.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.75 16.525000000000002 15.725 31.0 2 22.875 25.05 36.15 15.925 3 19.875 28.000000000000004 31.45 20.674999999999997 4 23.599999999999998 34.925 21.675 19.8 5 23.175 37.025000000000006 22.15 17.65 6 17.675 37.1 25.174999999999997 20.05 7 15.975 15.725 46.425 21.875 8 19.8 22.375 28.4 29.425 9 22.025 24.3 27.950000000000003 25.724999999999998 10-14 22.55 28.93 27.065 21.455 15-19 22.259999999999998 28.205000000000002 27.994999999999997 21.54 20-24 22.605 28.265 28.78 20.349999999999998 25-29 22.645 28.63 27.98 20.745 30-34 22.445 28.084999999999997 28.42 21.05 35-39 22.66 28.32 28.09 20.93 40-44 23.075000000000003 28.005000000000003 27.644999999999996 21.275 45-49 22.36 27.955000000000002 28.53 21.154999999999998 50-54 22.509999999999998 27.715 28.470000000000002 21.305 55-59 22.935 27.41 28.235 21.42 60-64 23.0 27.315 28.285 21.4 65-69 23.62 27.750000000000004 27.505000000000003 21.125 70-74 23.34 28.37 27.265 21.025 75-79 23.32 28.395 27.900000000000002 20.385 80-84 23.36 27.98 27.839999999999996 20.82 85-89 23.315 27.589999999999996 28.255000000000003 20.84 90-94 23.345 27.97 28.205000000000002 20.48 95-99 23.185 27.935 27.634999999999998 21.245 100-104 23.995 27.455000000000002 27.625 20.925 105-109 23.155 28.560000000000002 27.095000000000002 21.19 110-114 23.515 28.189999999999998 28.08 20.215 115-119 23.64 28.065 27.85 20.445 120-124 23.445 27.845 27.955000000000002 20.755000000000003 125-129 23.78 27.875 28.299999999999997 20.044999999999998 130-134 23.995 27.91 27.74 20.355 135-139 23.150000000000002 27.82 28.084999999999997 20.945 140-144 24.435000000000002 27.884999999999998 27.49 20.19 145-149 23.78 27.534999999999997 27.855 20.830000000000002 150-151 23.625 27.650000000000002 28.287499999999998 20.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 2.5 24 2.5 25 1.5 26 3.0 27 3.5 28 7.5 29 12.5 30 20.5 31 27.0 32 28.5 33 36.5 34 53.0 35 65.0 36 82.0 37 106.0 38 143.5 39 191.5 40 207.5 41 218.0 42 255.0 43 264.0 44 273.0 45 272.5 46 248.5 47 235.0 48 221.5 49 204.5 50 171.5 51 135.5 52 111.5 53 90.5 54 73.5 55 60.0 56 40.5 57 34.0 58 25.5 59 17.5 60 14.5 61 9.5 62 8.0 63 7.0 64 4.0 65 2.0 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1141483168818 97.89999999999999 2 0.6580612503163756 1.3 3 0.12655024044545685 0.375 4 0.07593014426727411 0.3 5 0.02531004808909137 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.7250000000000001 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.7625 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.4625 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 3.0 0.0 0.0 0.0 0.0 136-137 3.225 0.0 0.0 0.0 0.0 138-139 3.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCTTC 10 0.006830828 145.0 2 >>END_MODULE Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910360 spots for SRR7170634.sra Written 910360 spots for SRR7170634.sra Read 910366 spots for SRR7170634.sra Written 910366 spots for SRR7170634.sra SRR ids: ['SRR7170634.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__bhe8c_1 SRR7170634.sra spots: 18207206 blocks: [[1, 910360], [910361, 1820720], [1820721, 2731080], [2731081, 3641440], [3641441, 4551800], [4551801, 5462160], [5462161, 6372520], [6372521, 7282880], [7282881, 8193240], [8193241, 9103600], [9103601, 10013960], [10013961, 10924320], [10924321, 11834680], [11834681, 12745040], [12745041, 13655400], [13655401, 14565760], [14565761, 15476120], [15476121, 16386480], [16386481, 17296840], [17296841, 18207206]] SRR7170634 file size 6148124 SRR7170634 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170634 SRR7170634_1.fastq SRR7170634_2.fastq Input file: SRR7170634_1.fastq Paired file: SRR7170634_2.fastq trimmed: SRR7170634-trimmed-pair1.fastq, SRR7170634-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:02:07 2025 >> started Thu Feb 13 13:02:28 2025 >> done (20.796s) 18207206 read pairs processed; of these: 9653 ( 0.05%) short read pairs filtered out after trimming by size control 30306 ( 0.17%) empty read pairs filtered out after trimming by size control 18167247 (99.78%) read pairs available; of these: 9179488 (50.53%) trimmed read pairs available after processing 8987759 (49.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 6 0.00% 21 5 0.00% 22 5 0.00% 23 5 0.00% 24 8 0.00% 25 9 0.00% 26 5 0.00% 27 5 0.00% 28 6 0.00% 29 9 0.00% 30 4 0.00% 31 51 0.00% 32 7 0.00% 33 7 0.00% 34 10 0.00% 35 9 0.00% 36 10 0.00% 37 22 0.00% 38 26 0.00% 39 27 0.00% 40 17 0.00% 41 22 0.00% 42 25 0.00% 43 18 0.00% 44 27 0.00% 45 22 0.00% 46 35 0.00% 47 45 0.00% 48 42 0.00% 49 48 0.00% 50 59 0.00% 51 75 0.00% 52 77 0.00% 53 68 0.00% 54 90 0.00% 55 72 0.00% 56 109 0.00% 57 113 0.00% 58 125 0.00% 59 153 0.00% 60 156 0.00% 61 169 0.00% 62 227 0.00% 63 244 0.00% 64 240 0.00% 65 277 0.00% 66 334 0.00% 67 344 0.00% 68 400 0.00% 69 386 0.00% 70 508 0.00% 71 558 0.00% 72 624 0.00% 73 740 0.00% 74 860 0.00% 75 1024 0.01% 76 1494 0.01% 77 1579 0.01% 78 1254 0.01% 79 1373 0.01% 80 1520 0.01% 81 1649 0.01% 82 1956 0.01% 83 2339 0.01% 84 3054 0.02% 85 3457 0.02% 86 3647 0.02% 87 3991 0.02% 88 4241 0.02% 89 4448 0.02% 90 4725 0.03% 91 5185 0.03% 92 5634 0.03% 93 5953 0.03% 94 6291 0.03% 95 7026 0.04% 96 7302 0.04% 97 7680 0.04% 98 7966 0.04% 99 8405 0.05% 100 9019 0.05% 101 9532 0.05% 102 10235 0.06% 103 10945 0.06% 104 11364 0.06% 105 12226 0.07% 106 12869 0.07% 107 13199 0.07% 108 13545 0.07% 109 14265 0.08% 110 14911 0.08% 111 15700 0.09% 112 16733 0.09% 113 17778 0.10% 114 18675 0.10% 115 19409 0.11% 116 19917 0.11% 117 20599 0.11% 118 21582 0.12% 119 22142 0.12% 120 23344 0.13% 121 24061 0.13% 122 25328 0.14% 123 27174 0.15% 124 28604 0.16% 125 29827 0.16% 126 31389 0.17% 127 32586 0.18% 128 34564 0.19% 129 36028 0.20% 130 37945 0.21% 131 40156 0.22% 132 42973 0.24% 133 45688 0.25% 134 49816 0.27% 135 53408 0.29% 136 58557 0.32% 137 63714 0.35% 138 69657 0.38% 139 77222 0.43% 140 87424 0.48% 141 98142 0.54% 142 112101 0.62% 143 134308 0.74% 144 160523 0.88% 145 196752 1.08% 146 254822 1.40% 147 354039 1.95% 148 556588 3.06% 149 1109962 6.11% 150 4867385 26.79% 151 8987759 49.47% 18167247 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=26 prefix-density=0.38 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=35.79 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=11.1 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=28 prefix-density=0.40 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=14 fanout-score=18.27 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=7.9 sequence=AAGAAAGCTTACCCTAAC SRR7170634 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:03:12 Started mapping on | Feb 13 13:03:12 Finished on | Feb 13 13:05:54 Mapping speed, Million of reads per hour | 403.72 Number of input reads | 18167247 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16836840 Uniquely mapped reads % | 92.68% Average mapped length | 295.65 Number of splices: Total | 17180667 Number of splices: Annotated (sjdb) | 16785872 Number of splices: GT/AG | 16861732 Number of splices: GC/AG | 255913 Number of splices: AT/AC | 10230 Number of splices: Non-canonical | 52792 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 489048 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 50058 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.27% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 853035 853035 853035 N_multimapping 489048 489048 489048 N_noFeature 628638 16571369 704502 N_ambiguous 317734 1115 127521 UnstrandedReadsAssigned:15890468 PositiveStrandReadsAssigned:264356 NegativeStrandReadsAssigned:16004817 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170634 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170634-trimmed-pair1.fastq SRR7170634-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,167,247 reads, 15,894,800 reads pseudoaligned [quant] estimated average fragment length: 286.946 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52401 SRR7170634.ke.tsv 34699 SRR7170634.se.tsv 87100 total ==> SRR7170634.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.05 1094 34.3511 Potri.005G024800.1.v4.1 1035 749.054 277 20.1118 Potri.004G059700.1.v4.1 961 675.118 6 0.483344 Potri.007G009000.2.v4.1 1416 1130.05 0 0 Potri.003G141000.2.v4.1 2943 2657.05 934.635 19.1305 Potri.016G087400.1.v4.1 270 69.9899 796 618.533 Potri.015G069301.1.v4.1 564 289.558 0 0 Potri.010G195200.1.v4.1 1773 1487.05 501 18.323 Potri.012G127500.1.v4.1 977 691.095 158 12.4338 ==> SRR7170634.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 744 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 264 Potri.001G212900.v4.1 206 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 47 SRR7170634 completed mapping pipeline successfully