Starting /dee2/code/volunteer_pipeline.sh SRR7170635 current disk space = 3091256561664 free memory = 1437453912 SRR7170635 SRAfilesize c6d794e4bd125790043045f33864af5b SRR7170635.sra SRR7170635.sra file validated SRR7170635 is paired end SRR7170635 is conventional basespace SRR7170635 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170635_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.49725 18.0 18.0 28.0 18.0 32.0 2 25.68725 27.0 25.0 29.0 18.0 31.0 3 24.65975 25.0 18.0 29.0 18.0 31.0 4 28.6645 29.0 27.0 31.0 25.0 33.0 5 30.22 32.0 30.0 33.0 25.0 33.0 6 35.90725 37.0 36.0 38.0 33.0 38.0 7 36.92 38.0 37.0 38.0 35.0 38.0 8 36.9175 38.0 38.0 38.0 35.0 38.0 9 37.109 38.0 38.0 38.0 36.0 38.0 10-14 37.2456 38.0 38.0 38.0 36.2 38.0 15-19 37.3558 38.0 38.0 38.0 37.0 38.0 20-24 37.5214 38.0 38.0 38.0 37.6 38.0 25-29 37.48825 38.0 38.0 38.0 37.4 38.0 30-34 37.472199999999994 38.0 38.0 38.0 37.6 38.0 35-39 37.4625 38.0 38.0 38.0 37.6 38.0 40-44 37.39585 38.0 38.0 38.0 37.0 38.0 45-49 37.39405 38.0 38.0 38.0 37.0 38.0 50-54 37.2605 38.0 38.0 38.0 37.0 38.0 55-59 37.28755 38.0 38.0 38.0 36.8 38.0 60-64 37.20215 38.0 38.0 38.0 36.0 38.0 65-69 37.1514 38.0 38.0 38.0 36.0 38.0 70-74 37.112700000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.9912 38.0 38.0 38.0 36.0 38.0 80-84 36.99575 38.0 38.0 38.0 36.0 38.0 85-89 36.88995 38.0 38.0 38.0 35.6 38.0 90-94 36.744350000000004 38.0 38.0 38.0 34.8 38.0 95-99 36.5519 38.0 38.0 38.0 34.2 38.0 100-104 36.47475 38.0 38.0 38.0 34.0 38.0 105-109 36.415949999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.2543 38.0 37.6 38.0 33.6 38.0 115-119 36.01195 38.0 37.0 38.0 32.6 38.0 120-124 35.8824 38.0 37.0 38.0 32.2 38.0 125-129 35.7583 38.0 36.2 38.0 31.8 38.0 130-134 35.48755 38.0 36.0 38.0 31.0 38.0 135-139 35.174400000000006 38.0 35.8 38.0 29.6 38.0 140-144 34.5616 38.0 34.4 38.0 26.8 38.0 145-149 33.9305 38.0 33.4 38.0 24.8 38.0 150-151 30.036375 35.5 27.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 2.0 16 1.0 17 1.0 18 4.0 19 2.0 20 1.0 21 1.0 22 2.0 23 5.0 24 10.0 25 7.0 26 13.0 27 23.0 28 24.0 29 23.0 30 37.0 31 51.0 32 88.0 33 117.0 34 146.0 35 334.0 36 1026.0 37 2077.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.718623481781375 21.73582995951417 13.486842105263158 34.058704453441294 2 19.650000000000002 25.025 38.2 17.125 3 18.224999999999998 29.799999999999997 28.299999999999997 23.674999999999997 4 20.549999999999997 36.35 23.150000000000002 19.950000000000003 5 20.30584106292304 36.72599649034846 23.464527450488845 19.503634996239658 6 16.3 36.75 26.174999999999997 20.775 7 12.275 19.400000000000002 46.925 21.4 8 16.325 21.525 28.925 33.225 9 18.25 22.900000000000002 31.15 27.700000000000003 10-14 18.855 30.035 26.619999999999997 24.490000000000002 15-19 19.305 29.165000000000003 28.044999999999998 23.485 20-24 18.86 29.494999999999997 27.944999999999997 23.7 25-29 19.49 28.999999999999996 28.335 23.175 30-34 19.685 29.549999999999997 27.400000000000002 23.365 35-39 19.61 29.225 27.884999999999998 23.28 40-44 19.39 29.45 27.345000000000002 23.815 45-49 20.13 28.435 27.755000000000003 23.68 50-54 19.900000000000002 29.29 27.83 22.98 55-59 19.950000000000003 29.395 26.924999999999997 23.73 60-64 19.275000000000002 29.085 27.425 24.215 65-69 19.35 28.935 27.83 23.885 70-74 19.865 28.74 27.48 23.915 75-79 20.044999999999998 29.709999999999997 26.745 23.5 80-84 19.61 29.270000000000003 26.88 24.240000000000002 85-89 19.939999999999998 28.585 27.55 23.925 90-94 20.265 28.475 27.785 23.474999999999998 95-99 20.45 28.555000000000003 27.584999999999997 23.41 100-104 20.419999999999998 28.405 27.800000000000004 23.375 105-109 20.28 28.325 27.555000000000003 23.84 110-114 20.125 28.03 27.589999999999996 24.255 115-119 20.175 28.595 27.185 24.044999999999998 120-124 20.415 28.285 27.185 24.115000000000002 125-129 20.39 28.645 27.3 23.665 130-134 20.125 28.415000000000003 27.435 24.025 135-139 20.21 28.884999999999998 27.045 23.86 140-144 20.349999999999998 27.605 27.245 24.8 145-149 20.46 27.715 27.445000000000004 24.38 150-151 21.065799349512133 27.77082812109082 27.78333750312735 23.380035026269702 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.5 20 2.0 21 2.5 22 5.0 23 5.5 24 5.5 25 9.0 26 10.0 27 11.0 28 15.0 29 23.5 30 29.5 31 38.0 32 56.5 33 71.5 34 83.5 35 98.5 36 107.5 37 116.5 38 137.5 39 164.0 40 170.0 41 190.0 42 218.0 43 243.0 44 262.0 45 241.5 46 229.0 47 213.0 48 207.5 49 203.0 50 170.5 51 135.5 52 117.0 53 101.0 54 77.0 55 57.5 56 47.5 57 37.5 58 25.0 59 16.5 60 10.0 61 11.5 62 7.5 63 3.5 64 1.5 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98528665651953 97.55 2 0.8117706747843734 1.6 3 0.10147133434804667 0.3 4 0.050735667174023336 0.2 5 0.025367833587011668 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025367833587011668 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 9 0.22499999999999998 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 5 0.125 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.9749999999999996 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.8499999999999996 0.0 0.0 0.0 0.0 132-133 4.025 0.0 0.0 0.0 0.0 134-135 4.2875 0.0 0.0 0.0 0.0 136-137 4.512499999999999 0.0 0.0 0.0 0.0 138-139 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATAA 10 0.006832588 144.9875 9 GTTCTGG 10 0.006832588 144.9875 6 TTTTCTG 10 0.006832588 144.9875 145 TCACATA 10 0.006832588 144.9875 8 >>END_MODULE SRR7170635 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170635_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55675 33.0 33.0 34.0 32.0 34.0 2 32.7655 33.0 33.0 34.0 32.0 34.0 3 32.7995 33.0 33.0 34.0 32.0 34.0 4 32.6305 33.0 33.0 34.0 32.0 34.0 5 32.6735 33.0 33.0 34.0 32.0 34.0 6 36.835 38.0 38.0 38.0 36.0 38.0 7 36.7505 38.0 38.0 38.0 35.0 38.0 8 36.91975 38.0 38.0 38.0 36.0 38.0 9 36.808 38.0 38.0 38.0 35.0 38.0 10-14 36.784800000000004 38.0 38.0 38.0 35.8 38.0 15-19 36.73625 38.0 38.0 38.0 35.6 38.0 20-24 36.73945 38.0 38.0 38.0 35.8 38.0 25-29 36.6586 38.0 38.0 38.0 35.2 38.0 30-34 36.67695 38.0 38.0 38.0 35.2 38.0 35-39 36.7548 38.0 38.0 38.0 35.8 38.0 40-44 36.76235 38.0 38.0 38.0 36.0 38.0 45-49 36.71285 38.0 38.0 38.0 35.6 38.0 50-54 36.61985 38.0 38.0 38.0 35.2 38.0 55-59 36.61709999999999 38.0 38.0 38.0 35.0 38.0 60-64 36.57875 38.0 38.0 38.0 35.0 38.0 65-69 36.53565000000001 38.0 38.0 38.0 35.0 38.0 70-74 36.52435 38.0 38.0 38.0 34.8 38.0 75-79 36.44315 38.0 38.0 38.0 34.2 38.0 80-84 36.33195 38.0 38.0 38.0 34.0 38.0 85-89 36.277249999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.22685 38.0 38.0 38.0 34.0 38.0 95-99 36.0653 38.0 38.0 38.0 33.6 38.0 100-104 35.8812 38.0 37.0 38.0 33.0 38.0 105-109 35.8143 38.0 37.2 38.0 32.6 38.0 110-114 35.497 38.0 37.0 38.0 30.6 38.0 115-119 35.33265 38.0 36.8 38.0 30.2 38.0 120-124 35.171549999999996 38.0 36.2 38.0 29.2 38.0 125-129 34.7612 38.0 35.8 38.0 27.6 38.0 130-134 34.33125 38.0 34.6 38.0 24.4 38.0 135-139 34.113350000000004 38.0 34.2 38.0 24.0 38.0 140-144 33.611200000000004 38.0 33.2 38.0 22.0 38.0 145-149 32.693099999999994 38.0 33.0 38.0 12.8 38.0 150-151 27.553375000000003 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 11.0 4 3.0 5 4.0 6 2.0 7 1.0 8 2.0 9 6.0 10 2.0 11 0.0 12 3.0 13 1.0 14 3.0 15 2.0 16 5.0 17 4.0 18 4.0 19 7.0 20 8.0 21 9.0 22 4.0 23 11.0 24 12.0 25 26.0 26 31.0 27 30.0 28 29.0 29 46.0 30 55.0 31 68.0 32 77.0 33 116.0 34 170.0 35 260.0 36 616.0 37 2366.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.6 16.900000000000002 15.174999999999999 30.325000000000003 2 23.400000000000002 24.325 35.699999999999996 16.575 3 21.275 27.1 30.775000000000002 20.849999999999998 4 24.675 35.65 20.925 18.75 5 22.3 38.574999999999996 21.3 17.825 6 17.375 38.074999999999996 24.625 19.925 7 16.55 16.375 45.1 21.975 8 20.549999999999997 21.925 27.3 30.225 9 21.725 24.474999999999998 28.775000000000002 25.025 10-14 22.88 28.860000000000003 27.005000000000003 21.255 15-19 23.135 27.985 28.22 20.66 20-24 23.35 27.99 27.495000000000005 21.165 25-29 23.115 28.575 27.229999999999997 21.08 30-34 23.26 28.405 28.02 20.315 35-39 22.875 27.725 28.33 21.07 40-44 23.125 28.025 28.175 20.674999999999997 45-49 22.945 28.29 27.705000000000002 21.060000000000002 50-54 22.73 27.584999999999997 28.52 21.165 55-59 22.855 27.77 28.155 21.22 60-64 23.09 28.134999999999998 27.96 20.815 65-69 22.900000000000002 27.445000000000004 27.955000000000002 21.7 70-74 23.175 27.855 27.725 21.245 75-79 23.265 28.345 27.639999999999997 20.75 80-84 23.25 27.43 28.244999999999997 21.075 85-89 23.21 27.985 28.115000000000002 20.69 90-94 23.39 28.535 27.595 20.48 95-99 23.71 27.939999999999998 27.884999999999998 20.465 100-104 23.41 28.24 28.175 20.175 105-109 23.65 27.83 27.639999999999997 20.880000000000003 110-114 23.880000000000003 28.860000000000003 26.919999999999998 20.34 115-119 23.755000000000003 28.28 27.85 20.115 120-124 24.42 27.395000000000003 27.825 20.36 125-129 24.395 27.534999999999997 27.534999999999997 20.535 130-134 24.46 27.165 27.944999999999997 20.43 135-139 24.255 27.474999999999998 28.08 20.19 140-144 24.645 27.675 27.93 19.75 145-149 24.740000000000002 28.26 27.029999999999998 19.97 150-151 24.121545579592347 27.522821057896714 28.898336876328624 19.45729648618232 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 0.5 8 1.0 9 1.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 1.5 17 2.0 18 0.5 19 1.0 20 3.0 21 3.0 22 1.0 23 3.0 24 5.0 25 4.0 26 7.0 27 11.5 28 8.0 29 10.5 30 25.5 31 27.0 32 27.5 33 42.0 34 56.0 35 72.0 36 93.0 37 109.0 38 137.0 39 175.0 40 190.5 41 198.0 42 214.0 43 238.0 44 260.5 45 266.5 46 257.5 47 224.0 48 206.5 49 191.5 50 157.5 51 134.5 52 121.5 53 115.0 54 102.5 55 79.5 56 62.0 57 47.5 58 31.0 59 25.0 60 17.5 61 9.5 62 6.0 63 5.0 64 2.0 65 1.0 66 1.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67380770211682 96.72500000000001 2 1.02014792144861 2.0 3 0.07651109410864575 0.22499999999999998 4 0.1530221882172915 0.6 5 0.0510073960724305 0.25 6 0.0 0.0 7 0.0 0.0 8 0.02550369803621525 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 8 0.2 No Hit TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 5 0.125 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.9749999999999996 0.0 0.0 0.0 0.0 126-127 3.2750000000000004 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.0 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.4625 0.0 0.0 0.0 0.0 138-139 4.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894737 spots for SRR7170635.sra Written 894737 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra Read 894719 spots for SRR7170635.sra Written 894719 spots for SRR7170635.sra SRR ids: ['SRR7170635.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qugfm49r SRR7170635.sra spots: 17894398 blocks: [[1, 894719], [894720, 1789438], [1789439, 2684157], [2684158, 3578876], [3578877, 4473595], [4473596, 5368314], [5368315, 6263033], [6263034, 7157752], [7157753, 8052471], [8052472, 8947190], [8947191, 9841909], [9841910, 10736628], [10736629, 11631347], [11631348, 12526066], [12526067, 13420785], [13420786, 14315504], [14315505, 15210223], [15210224, 16104942], [16104943, 16999661], [16999662, 17894398]] SRR7170635 file size 6042123 SRR7170635 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170635 SRR7170635_1.fastq SRR7170635_2.fastq Input file: SRR7170635_1.fastq Paired file: SRR7170635_2.fastq trimmed: SRR7170635-trimmed-pair1.fastq, SRR7170635-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:11:38 2025 >> started Thu Feb 13 13:11:59 2025 >> done (21.153s) 17894398 read pairs processed; of these: 15967 ( 0.09%) short read pairs filtered out after trimming by size control 42351 ( 0.24%) empty read pairs filtered out after trimming by size control 17836080 (99.67%) read pairs available; of these: 8760039 (49.11%) trimmed read pairs available after processing 9076041 (50.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 11 0.00% 21 11 0.00% 22 6 0.00% 23 12 0.00% 24 15 0.00% 25 6 0.00% 26 5 0.00% 27 13 0.00% 28 7 0.00% 29 12 0.00% 30 12 0.00% 31 16 0.00% 32 9 0.00% 33 18 0.00% 34 12 0.00% 35 17 0.00% 36 15 0.00% 37 24 0.00% 38 27 0.00% 39 26 0.00% 40 40 0.00% 41 27 0.00% 42 40 0.00% 43 41 0.00% 44 46 0.00% 45 51 0.00% 46 71 0.00% 47 69 0.00% 48 83 0.00% 49 99 0.00% 50 104 0.00% 51 132 0.00% 52 120 0.00% 53 151 0.00% 54 141 0.00% 55 146 0.00% 56 152 0.00% 57 184 0.00% 58 217 0.00% 59 244 0.00% 60 286 0.00% 61 290 0.00% 62 394 0.00% 63 416 0.00% 64 394 0.00% 65 485 0.00% 66 519 0.00% 67 565 0.00% 68 613 0.00% 69 719 0.00% 70 774 0.00% 71 907 0.01% 72 1095 0.01% 73 1226 0.01% 74 1430 0.01% 75 1887 0.01% 76 3006 0.02% 77 2743 0.02% 78 2082 0.01% 79 2209 0.01% 80 2455 0.01% 81 2707 0.02% 82 3104 0.02% 83 3561 0.02% 84 4673 0.03% 85 5585 0.03% 86 5718 0.03% 87 6051 0.03% 88 6465 0.04% 89 6673 0.04% 90 7067 0.04% 91 7711 0.04% 92 8340 0.05% 93 8949 0.05% 94 9345 0.05% 95 10096 0.06% 96 10713 0.06% 97 10793 0.06% 98 11221 0.06% 99 11894 0.07% 100 12452 0.07% 101 13037 0.07% 102 13807 0.08% 103 14918 0.08% 104 15799 0.09% 105 16349 0.09% 106 16990 0.10% 107 17659 0.10% 108 18027 0.10% 109 18778 0.11% 110 19426 0.11% 111 20072 0.11% 112 21451 0.12% 113 22827 0.13% 114 23516 0.13% 115 24241 0.14% 116 24914 0.14% 117 25585 0.14% 118 26429 0.15% 119 26832 0.15% 120 28240 0.16% 121 28689 0.16% 122 29949 0.17% 123 32189 0.18% 124 32979 0.18% 125 34042 0.19% 126 35996 0.20% 127 37255 0.21% 128 38264 0.21% 129 40009 0.22% 130 41697 0.23% 131 43192 0.24% 132 45822 0.26% 133 49222 0.28% 134 52513 0.29% 135 55205 0.31% 136 58726 0.33% 137 63328 0.36% 138 68101 0.38% 139 74543 0.42% 140 82127 0.46% 141 92595 0.52% 142 105271 0.59% 143 120794 0.68% 144 141609 0.79% 145 173002 0.97% 146 221946 1.24% 147 309281 1.73% 148 481353 2.70% 149 942129 5.28% 150 4639264 26.01% 151 9076041 50.89% 17836080 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=13 prefix-density=0.74 prefix-fanout=2.3 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=62.25 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=13 prefix-density=0.72 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=11.09 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.9 sequence=CAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7170635 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:12:48 Started mapping on | Feb 13 13:12:49 Finished on | Feb 13 13:16:22 Mapping speed, Million of reads per hour | 301.45 Number of input reads | 17836080 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16063361 Uniquely mapped reads % | 90.06% Average mapped length | 294.86 Number of splices: Total | 15538210 Number of splices: Annotated (sjdb) | 15196345 Number of splices: GT/AG | 15235624 Number of splices: GC/AG | 249656 Number of splices: AT/AC | 10739 Number of splices: Non-canonical | 42191 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 449090 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 23801 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.22% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1341227 1341227 1341227 N_multimapping 449090 449090 449090 N_noFeature 586695 15707389 664748 N_ambiguous 388811 1175 110332 UnstrandedReadsAssigned:15087855 PositiveStrandReadsAssigned:354797 NegativeStrandReadsAssigned:15288281 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170635 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170635-trimmed-pair1.fastq SRR7170635-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,836,080 reads, 15,187,425 reads pseudoaligned [quant] estimated average fragment length: 272.884 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7170635.ke.tsv 34699 SRR7170635.se.tsv 87100 total ==> SRR7170635.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.12 472 12.893 Potri.005G024800.1.v4.1 1035 763.116 234 14.6255 Potri.004G059700.1.v4.1 961 689.21 18 1.24568 Potri.007G009000.2.v4.1 1416 1144.12 0 0 Potri.003G141000.2.v4.1 2943 2671.12 668 11.928 Potri.016G087400.1.v4.1 270 73.9724 981.066 632.575 Potri.015G069301.1.v4.1 564 301.489 0 0 Potri.010G195200.1.v4.1 1773 1501.12 48 1.52514 Potri.012G127500.1.v4.1 977 705.163 170 11.4986 ==> SRR7170635.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1050 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 462 Potri.001G212900.v4.1 82 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR7170635 completed mapping pipeline successfully