Starting /dee2/code/volunteer_pipeline.sh SRR7170636 current disk space = 3090583842816 free memory = 1455124556 SRR7170636 SRAfilesize d3815930c5e529f29f8ff9804baf6b84 SRR7170636.sra SRR7170636.sra file validated SRR7170636 is paired end SRR7170636 is conventional basespace SRR7170636 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170636_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.97525 18.0 18.0 28.0 18.0 32.0 2 29.23175 30.0 27.0 31.0 27.0 33.0 3 30.7895 31.0 30.0 33.0 27.0 33.0 4 31.85225 33.0 31.0 33.0 29.0 33.0 5 32.54975 33.0 33.0 33.0 32.0 34.0 6 37.02025 38.0 37.0 38.0 36.0 38.0 7 37.296 38.0 38.0 38.0 36.0 38.0 8 37.35425 38.0 38.0 38.0 37.0 38.0 9 37.4925 38.0 38.0 38.0 37.0 38.0 10-14 37.4231 38.0 38.0 38.0 37.0 38.0 15-19 37.440099999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.49785 38.0 38.0 38.0 37.0 38.0 25-29 37.471799999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.4482 38.0 38.0 38.0 37.0 38.0 35-39 37.41605 38.0 38.0 38.0 37.0 38.0 40-44 37.374900000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.3444 38.0 38.0 38.0 37.0 38.0 50-54 37.2633 38.0 38.0 38.0 36.6 38.0 55-59 37.19315 38.0 38.0 38.0 36.0 38.0 60-64 37.1577 38.0 38.0 38.0 36.0 38.0 65-69 37.0724 38.0 38.0 38.0 36.0 38.0 70-74 36.97325 38.0 38.0 38.0 36.0 38.0 75-79 36.76205 38.0 38.0 38.0 34.8 38.0 80-84 36.79665 38.0 38.0 38.0 35.0 38.0 85-89 36.5925 38.0 38.0 38.0 34.2 38.0 90-94 36.489250000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.2522 38.0 37.6 38.0 33.6 38.0 100-104 36.17405 38.0 37.0 38.0 33.6 38.0 105-109 36.014250000000004 38.0 37.0 38.0 33.2 38.0 110-114 35.801700000000004 38.0 37.0 38.0 31.8 38.0 115-119 35.448499999999996 38.0 36.0 38.0 29.8 38.0 120-124 35.24355 38.0 36.0 38.0 29.2 38.0 125-129 35.1508 38.0 35.8 38.0 28.4 38.0 130-134 34.9182 38.0 35.0 38.0 27.8 38.0 135-139 34.68000000000001 38.0 34.8 38.0 27.6 38.0 140-144 34.16985 38.0 34.4 38.0 24.2 38.0 145-149 33.059999999999995 38.0 33.0 38.0 19.0 38.0 150-151 28.466124999999998 34.5 24.0 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 3.0 16 0.0 17 2.0 18 4.0 19 5.0 20 1.0 21 11.0 22 2.0 23 5.0 24 9.0 25 7.0 26 14.0 27 14.0 28 19.0 29 32.0 30 51.0 31 66.0 32 93.0 33 125.0 34 213.0 35 402.0 36 985.0 37 1935.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.14154317833419 20.59274399591211 13.515585079202861 26.750127746550845 2 20.075000000000003 25.900000000000002 35.35 18.675 3 16.425 32.0 30.075000000000003 21.5 4 20.175 35.825 24.95 19.05 5 19.573934837092732 36.51629072681704 24.461152882205514 19.448621553884713 6 16.55 35.5 24.675 23.275000000000002 7 13.725000000000001 19.825 46.050000000000004 20.4 8 18.099999999999998 21.175 28.025 32.7 9 17.625 22.0 29.925 30.45 10-14 19.794999999999998 29.595 26.724999999999998 23.885 15-19 19.175 28.53 28.15 24.145 20-24 19.845 29.28 27.655 23.22 25-29 19.830000000000002 28.62 27.905 23.645 30-34 19.825 29.054999999999996 28.235 22.884999999999998 35-39 19.975 29.04 27.560000000000002 23.425 40-44 20.0 29.375 27.46 23.165 45-49 20.27 28.000000000000004 27.584999999999997 24.145 50-54 20.135 29.03 27.544999999999998 23.29 55-59 19.535 29.04 27.85 23.575 60-64 19.835 29.465000000000003 27.089999999999996 23.61 65-69 19.45 29.304999999999996 27.779999999999998 23.465 70-74 20.215 28.810000000000002 27.625 23.35 75-79 20.025000000000002 28.895 27.605 23.474999999999998 80-84 19.759999999999998 28.12 28.18 23.94 85-89 20.405 28.365000000000002 27.605 23.625 90-94 20.005 28.794999999999998 27.825 23.375 95-99 19.7 28.7 27.295 24.305 100-104 19.8 29.125 27.345000000000002 23.73 105-109 20.585 28.515 27.595 23.305 110-114 20.580000000000002 28.305000000000003 27.715 23.400000000000002 115-119 20.515 29.21 27.229999999999997 23.044999999999998 120-124 19.744999999999997 29.32 27.605 23.330000000000002 125-129 20.09 28.189999999999998 27.775 23.945 130-134 20.43 29.14 27.105 23.325000000000003 135-139 20.73 28.265 27.175 23.830000000000002 140-144 20.66 28.565 27.155 23.62 145-149 19.939999999999998 28.76 27.405 23.895 150-151 21.745654620482682 27.935475803426286 27.022633487557833 23.296236088533202 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.0 21 1.5 22 3.0 23 3.0 24 4.5 25 4.5 26 4.5 27 8.0 28 12.5 29 16.0 30 25.0 31 30.0 32 34.0 33 50.0 34 67.0 35 81.0 36 97.0 37 119.5 38 146.0 39 179.0 40 201.5 41 230.5 42 241.5 43 250.0 44 282.5 45 274.5 46 239.0 47 237.0 48 244.0 49 207.5 50 156.5 51 123.5 52 98.5 53 78.5 54 67.5 55 51.0 56 35.5 57 25.5 58 18.0 59 15.0 60 12.0 61 5.5 62 2.5 63 4.0 64 3.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24242424242425 98.25 2 0.6060606060606061 1.2 3 0.07575757575757576 0.22499999999999998 4 0.050505050505050504 0.2 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 5 0.125 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.8 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.4375 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.6875 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACCA 10 0.006832588 144.9875 7 CCAAATT 10 0.006832588 144.9875 8 AAAAAAA 20 0.0059376103 28.9975 140-144 >>END_MODULE SRR7170636 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170636_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79925 33.0 33.0 34.0 32.0 34.0 2 32.89625 33.0 33.0 34.0 32.0 34.0 3 32.8825 34.0 33.0 34.0 32.0 34.0 4 32.8085 34.0 33.0 34.0 32.0 34.0 5 32.86075 34.0 33.0 34.0 32.0 34.0 6 36.96275 38.0 38.0 38.0 36.0 38.0 7 37.0665 38.0 38.0 38.0 37.0 38.0 8 37.121 38.0 38.0 38.0 37.0 38.0 9 37.0945 38.0 38.0 38.0 37.0 38.0 10-14 37.052949999999996 38.0 38.0 38.0 36.6 38.0 15-19 37.069849999999995 38.0 38.0 38.0 36.8 38.0 20-24 37.07425 38.0 38.0 38.0 36.4 38.0 25-29 37.0634 38.0 38.0 38.0 36.8 38.0 30-34 37.02605 38.0 38.0 38.0 36.4 38.0 35-39 37.0852 38.0 38.0 38.0 36.8 38.0 40-44 36.99025 38.0 38.0 38.0 36.2 38.0 45-49 36.98865 38.0 38.0 38.0 36.0 38.0 50-54 36.861000000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.794799999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.8124 38.0 38.0 38.0 36.0 38.0 65-69 36.77055 38.0 38.0 38.0 36.0 38.0 70-74 36.6783 38.0 38.0 38.0 35.4 38.0 75-79 36.7284 38.0 38.0 38.0 35.0 38.0 80-84 36.5914 38.0 38.0 38.0 35.0 38.0 85-89 36.5184 38.0 38.0 38.0 34.6 38.0 90-94 36.43755 38.0 38.0 38.0 34.2 38.0 95-99 36.36055 38.0 38.0 38.0 34.2 38.0 100-104 36.194849999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.06375 38.0 38.0 38.0 33.6 38.0 110-114 35.85385000000001 38.0 37.4 38.0 32.6 38.0 115-119 35.68855 38.0 37.0 38.0 32.0 38.0 120-124 35.6505 38.0 37.0 38.0 31.6 38.0 125-129 35.26795 38.0 36.2 38.0 30.2 38.0 130-134 34.89215 38.0 36.0 38.0 28.8 38.0 135-139 34.387899999999995 38.0 34.2 38.0 26.0 38.0 140-144 34.030499999999996 38.0 33.2 38.0 24.4 38.0 145-149 33.1957 38.0 33.0 38.0 19.4 38.0 150-151 27.905 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 0.0 5 1.0 6 0.0 7 2.0 8 3.0 9 3.0 10 1.0 11 2.0 12 3.0 13 1.0 14 1.0 15 5.0 16 5.0 17 5.0 18 5.0 19 7.0 20 8.0 21 10.0 22 5.0 23 10.0 24 16.0 25 12.0 26 19.0 27 23.0 28 26.0 29 30.0 30 40.0 31 51.0 32 74.0 33 95.0 34 157.0 35 274.0 36 616.0 37 2480.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.65 16.6 12.65 26.1 2 23.775 22.525000000000002 34.699999999999996 19.0 3 20.3 25.825 32.875 21.0 4 22.3 34.625 23.375 19.7 5 20.8 37.974999999999994 22.8 18.425 6 18.975 35.575 24.65 20.8 7 17.075000000000003 16.3 45.050000000000004 21.575 8 19.650000000000002 21.7 28.599999999999998 30.049999999999997 9 21.075 25.4 27.175 26.35 10-14 22.285 28.705000000000002 27.815 21.195 15-19 22.38 27.705000000000002 28.549999999999997 21.365000000000002 20-24 22.52 28.115000000000002 28.035 21.33 25-29 22.91 28.310000000000002 28.21 20.57 30-34 22.45 27.845 28.71 20.995 35-39 22.66 28.199999999999996 28.38 20.76 40-44 22.62 28.470000000000002 28.084999999999997 20.825 45-49 22.785 28.235 27.810000000000002 21.17 50-54 22.825 27.915 28.494999999999997 20.765 55-59 23.244999999999997 27.365000000000002 27.779999999999998 21.61 60-64 22.435 28.09 28.345 21.13 65-69 23.36 27.595 27.82 21.224999999999998 70-74 22.75 28.155 28.565 20.53 75-79 22.925 28.199999999999996 27.83 21.044999999999998 80-84 22.795 28.355000000000004 27.87 20.979999999999997 85-89 22.645 27.705000000000002 28.555000000000003 21.095 90-94 23.185 27.694999999999997 28.415000000000003 20.705000000000002 95-99 23.845 28.33 27.785 20.04 100-104 23.169999999999998 28.21 28.22 20.4 105-109 23.82 28.075 27.855 20.25 110-114 23.355 27.91 28.275 20.46 115-119 23.825 27.705000000000002 28.21 20.26 120-124 23.200000000000003 28.485 28.21 20.105 125-129 23.765 27.685 28.4 20.150000000000002 130-134 23.44 28.59 27.334999999999997 20.635 135-139 23.45 28.155 28.455000000000002 19.939999999999998 140-144 23.665 28.21 27.615000000000002 20.51 145-149 24.404999999999998 27.935 27.365000000000002 20.294999999999998 150-151 23.7375 27.9125 28.1625 20.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 2.0 22 2.0 23 2.0 24 2.5 25 3.5 26 9.0 27 11.0 28 11.0 29 13.5 30 19.0 31 24.0 32 36.0 33 44.0 34 60.0 35 77.0 36 75.5 37 90.0 38 139.0 39 169.0 40 175.5 41 210.5 42 257.0 43 282.0 44 284.0 45 278.5 46 272.5 47 252.0 48 213.0 49 185.5 50 165.5 51 141.0 52 110.0 53 85.0 54 66.5 55 56.0 56 49.5 57 35.0 58 23.0 59 19.0 60 15.5 61 7.5 62 5.0 63 6.0 64 5.0 65 2.5 66 0.5 67 0.0 68 0.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0632911392405 97.82499999999999 2 0.7848101265822786 1.55 3 0.05063291139240507 0.15 4 0.025316455696202535 0.1 5 0.0759493670886076 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACC 5 0.125 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (97% over 34bp) GTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0125 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.037500000000000006 0.0 0.0 0.025 0.0 72-73 0.0625 0.0 0.0 0.025 0.0 74-75 0.075 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.1125 0.0 0.0 0.025 0.0 80-81 0.1375 0.0 0.0 0.025 0.0 82-83 0.1875 0.0 0.0 0.025 0.0 84-85 0.21250000000000002 0.0 0.0 0.025 0.0 86-87 0.225 0.0 0.0 0.025 0.0 88-89 0.2375 0.0 0.0 0.025 0.0 90-91 0.325 0.0 0.0 0.025 0.0 92-93 0.35 0.0 0.0 0.025 0.0 94-95 0.35 0.0 0.0 0.025 0.0 96-97 0.3875 0.0 0.0 0.025 0.0 98-99 0.425 0.0 0.0 0.025 0.0 100-101 0.44999999999999996 0.0 0.0 0.025 0.0 102-103 0.4875 0.0 0.0 0.025 0.0 104-105 0.6125 0.0 0.0 0.025 0.0 106-107 0.75 0.0 0.0 0.025 0.0 108-109 0.9125 0.0 0.0 0.025 0.0 110-111 0.9624999999999999 0.0 0.0 0.025 0.0 112-113 1.0875 0.0 0.0 0.025 0.0 114-115 1.2125 0.0 0.0 0.025 0.0 116-117 1.4625 0.0 0.0 0.025 0.0 118-119 1.6 0.0 0.0 0.025 0.0 120-121 1.775 0.0 0.0 0.025 0.0 122-123 2.0375 0.0 0.0 0.025 0.0 124-125 2.15 0.0 0.0 0.025 0.0 126-127 2.3875 0.0 0.0 0.025 0.0 128-129 2.5 0.0 0.0 0.025 0.0 130-131 2.6125 0.0 0.0 0.025 0.0 132-133 2.8 0.0 0.0 0.025 0.0 134-135 3.025 0.0 0.0 0.025 0.0 136-137 3.3375 0.0 0.0 0.025 0.0 138-139 3.4875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACCTC 10 0.006830828 145.0 1 TTTTTTT 110 1.3008325E-4 11.863637 75-79 >>END_MODULE Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra Read 920100 spots for SRR7170636.sra Written 920100 spots for SRR7170636.sra Read 920084 spots for SRR7170636.sra Written 920084 spots for SRR7170636.sra SRR ids: ['SRR7170636.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zgmyr6uk SRR7170636.sra spots: 18401696 blocks: [[1, 920084], [920085, 1840168], [1840169, 2760252], [2760253, 3680336], [3680337, 4600420], [4600421, 5520504], [5520505, 6440588], [6440589, 7360672], [7360673, 8280756], [8280757, 9200840], [9200841, 10120924], [10120925, 11041008], [11041009, 11961092], [11961093, 12881176], [12881177, 13801260], [13801261, 14721344], [14721345, 15641428], [15641429, 16561512], [16561513, 17481596], [17481597, 18401696]] SRR7170636 file size 6214030 SRR7170636 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170636 SRR7170636_1.fastq SRR7170636_2.fastq Input file: SRR7170636_1.fastq Paired file: SRR7170636_2.fastq trimmed: SRR7170636-trimmed-pair1.fastq, SRR7170636-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:45:16 2025 >> started Thu Feb 13 13:45:36 2025 >> done (19.824s) 18401696 read pairs processed; of these: 15192 ( 0.08%) short read pairs filtered out after trimming by size control 19062 ( 0.10%) empty read pairs filtered out after trimming by size control 18367442 (99.81%) read pairs available; of these: 9227038 (50.24%) trimmed read pairs available after processing 9140404 (49.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 8 0.00% 20 7 0.00% 21 10 0.00% 22 9 0.00% 23 19 0.00% 24 13 0.00% 25 13 0.00% 26 14 0.00% 27 17 0.00% 28 15 0.00% 29 18 0.00% 30 13 0.00% 31 17 0.00% 32 15 0.00% 33 13 0.00% 34 12 0.00% 35 13 0.00% 36 8 0.00% 37 13 0.00% 38 25 0.00% 39 19 0.00% 40 28 0.00% 41 17 0.00% 42 33 0.00% 43 39 0.00% 44 40 0.00% 45 51 0.00% 46 49 0.00% 47 59 0.00% 48 68 0.00% 49 66 0.00% 50 75 0.00% 51 76 0.00% 52 94 0.00% 53 100 0.00% 54 126 0.00% 55 110 0.00% 56 122 0.00% 57 135 0.00% 58 177 0.00% 59 211 0.00% 60 269 0.00% 61 239 0.00% 62 305 0.00% 63 350 0.00% 64 373 0.00% 65 428 0.00% 66 410 0.00% 67 483 0.00% 68 542 0.00% 69 598 0.00% 70 692 0.00% 71 808 0.00% 72 905 0.00% 73 1045 0.01% 74 1171 0.01% 75 1293 0.01% 76 1492 0.01% 77 1634 0.01% 78 1632 0.01% 79 1878 0.01% 80 2253 0.01% 81 2403 0.01% 82 2823 0.02% 83 3106 0.02% 84 4122 0.02% 85 4699 0.03% 86 5097 0.03% 87 5390 0.03% 88 5629 0.03% 89 5994 0.03% 90 6322 0.03% 91 6798 0.04% 92 7191 0.04% 93 7782 0.04% 94 8276 0.05% 95 8608 0.05% 96 9232 0.05% 97 9378 0.05% 98 10022 0.05% 99 10674 0.06% 100 11159 0.06% 101 11632 0.06% 102 12371 0.07% 103 12945 0.07% 104 13801 0.08% 105 14477 0.08% 106 14788 0.08% 107 15499 0.08% 108 16284 0.09% 109 16320 0.09% 110 17406 0.09% 111 18074 0.10% 112 19113 0.10% 113 19815 0.11% 114 20595 0.11% 115 21464 0.12% 116 22177 0.12% 117 22880 0.12% 118 23600 0.13% 119 24476 0.13% 120 25337 0.14% 121 26142 0.14% 122 27727 0.15% 123 29630 0.16% 124 30681 0.17% 125 32347 0.18% 126 33399 0.18% 127 34352 0.19% 128 35903 0.20% 129 37590 0.20% 130 39100 0.21% 131 40905 0.22% 132 44408 0.24% 133 46421 0.25% 134 50363 0.27% 135 54315 0.30% 136 58468 0.32% 137 63479 0.35% 138 68923 0.38% 139 75659 0.41% 140 84264 0.46% 141 95323 0.52% 142 109575 0.60% 143 128982 0.70% 144 154318 0.84% 145 189813 1.03% 146 243956 1.33% 147 339171 1.85% 148 533852 2.91% 149 1081938 5.89% 150 4917497 26.77% 151 9140404 49.76% 18367442 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=22 prefix-density=0.51 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=23.44 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=8.7 sequence=TCCTCCTTGTTGTACATGCCGGGAAGTTGCACATTTGTTGGGTTGTCAGCAATGTTCATGAGGGTAGCATTAACCATCTGGTTGTTGAC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=9 prefix-density=0.70 prefix-fanout=2.4 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=27.94 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.4 sequence=TTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7170636 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:46:20 Started mapping on | Feb 13 13:46:21 Finished on | Feb 13 13:48:21 Mapping speed, Million of reads per hour | 551.02 Number of input reads | 18367442 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17199305 Uniquely mapped reads % | 93.64% Average mapped length | 295.04 Number of splices: Total | 17395755 Number of splices: Annotated (sjdb) | 16991166 Number of splices: GT/AG | 17069413 Number of splices: GC/AG | 266733 Number of splices: AT/AC | 9768 Number of splices: Non-canonical | 49841 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465368 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 36127 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 719875 719875 719875 N_multimapping 465368 465368 465368 N_noFeature 705382 16897467 807971 N_ambiguous 331607 1172 131591 UnstrandedReadsAssigned:16162316 PositiveStrandReadsAssigned:300666 NegativeStrandReadsAssigned:16259743 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170636 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170636-trimmed-pair1.fastq SRR7170636-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,367,442 reads, 16,155,020 reads pseudoaligned [quant] estimated average fragment length: 282.924 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR7170636.ke.tsv 34699 SRR7170636.se.tsv 87100 total ==> SRR7170636.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.08 1284 43.343 Potri.005G024800.1.v4.1 1035 753.076 194 15.0968 Potri.004G059700.1.v4.1 961 679.213 5 0.431406 Potri.007G009000.2.v4.1 1416 1134.08 0 0 Potri.003G141000.2.v4.1 2943 2661.08 863 19.0054 Potri.016G087400.1.v4.1 270 72.2959 545 441.78 Potri.015G069301.1.v4.1 564 294.529 0 0 Potri.010G195200.1.v4.1 1773 1491.08 48 1.88653 Potri.012G127500.1.v4.1 977 695.154 103 8.68318 ==> SRR7170636.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 649 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 39 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR7170636 completed mapping pipeline successfully