Starting /dee2/code/volunteer_pipeline.sh SRR7170637 current disk space = 3090775564288 free memory = 1410561984 SRR7170637 SRAfilesize 46b7f064d94d48c39e2af5ab6eaa8c63 SRR7170637.sra SRR7170637.sra file validated SRR7170637 is paired end SRR7170637 is conventional basespace SRR7170637 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170637_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.031 30.0 18.0 33.0 18.0 33.0 2 27.7455 29.0 25.0 31.0 18.0 33.0 3 30.73025 31.0 29.0 33.0 27.0 33.0 4 32.13475 33.0 33.0 33.0 30.0 33.0 5 32.58925 33.0 33.0 33.0 32.0 34.0 6 36.82525 38.0 37.0 38.0 34.0 38.0 7 37.02525 38.0 38.0 38.0 35.0 38.0 8 37.2315 38.0 38.0 38.0 36.0 38.0 9 37.448 38.0 38.0 38.0 37.0 38.0 10-14 37.3799 38.0 38.0 38.0 36.8 38.0 15-19 37.433800000000005 38.0 38.0 38.0 37.2 38.0 20-24 37.54405 38.0 38.0 38.0 38.0 38.0 25-29 37.50155 38.0 38.0 38.0 37.8 38.0 30-34 37.48285 38.0 38.0 38.0 37.6 38.0 35-39 37.4995 38.0 38.0 38.0 37.2 38.0 40-44 37.4226 38.0 38.0 38.0 37.0 38.0 45-49 37.45945 38.0 38.0 38.0 37.0 38.0 50-54 37.351299999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.24555 38.0 38.0 38.0 36.8 38.0 60-64 37.25665 38.0 38.0 38.0 36.2 38.0 65-69 37.17524999999999 38.0 38.0 38.0 36.0 38.0 70-74 37.0595 38.0 38.0 38.0 36.0 38.0 75-79 36.92275 38.0 38.0 38.0 35.6 38.0 80-84 36.91825 38.0 38.0 38.0 35.4 38.0 85-89 36.786649999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.646 38.0 38.0 38.0 34.2 38.0 95-99 36.548350000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.369 38.0 37.6 38.0 33.8 38.0 105-109 36.2273 38.0 37.0 38.0 33.8 38.0 110-114 36.062250000000006 38.0 37.2 38.0 33.2 38.0 115-119 35.78705 38.0 37.0 38.0 31.4 38.0 120-124 35.599000000000004 38.0 36.2 38.0 31.0 38.0 125-129 35.41315 38.0 36.0 38.0 30.6 38.0 130-134 35.03875 38.0 35.4 38.0 28.2 38.0 135-139 34.7436 38.0 34.8 38.0 27.8 38.0 140-144 34.2457 38.0 34.4 38.0 25.0 38.0 145-149 33.444 38.0 33.0 38.0 21.2 38.0 150-151 29.189375000000002 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 0.0 18 2.0 19 5.0 20 4.0 21 9.0 22 3.0 23 8.0 24 9.0 25 7.0 26 9.0 27 16.0 28 23.0 29 21.0 30 41.0 31 48.0 32 74.0 33 114.0 34 189.0 35 363.0 36 933.0 37 2117.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.454314074828204 17.25629931280224 12.191397302112497 35.09798931025706 2 18.375 25.474999999999998 36.425000000000004 19.725 3 17.125 30.8 28.575 23.5 4 20.25 37.125 22.375 20.25 5 20.20582329317269 37.575301204819276 24.2218875502008 17.996987951807228 6 17.5 34.225 25.874999999999996 22.400000000000002 7 12.25 19.7 47.349999999999994 20.7 8 18.25 20.625 27.6 33.525 9 17.175 21.224999999999998 31.55 30.049999999999997 10-14 19.39 29.73 26.58 24.3 15-19 20.02 28.68 27.63 23.669999999999998 20-24 19.36 29.23 27.29 24.12 25-29 19.855 28.42 28.16 23.565 30-34 19.55 29.310000000000002 27.565 23.575 35-39 19.8 28.449999999999996 27.82 23.93 40-44 19.6 29.425 27.97 23.005 45-49 20.16 28.235 27.55 24.055 50-54 19.825 28.465 27.750000000000004 23.96 55-59 19.85 28.849999999999998 27.49 23.810000000000002 60-64 20.155 28.634999999999998 27.875 23.335 65-69 19.689999999999998 28.535 27.884999999999998 23.89 70-74 20.03 28.4 27.55 24.02 75-79 20.01 28.52 27.505000000000003 23.965 80-84 19.905 29.095 27.125 23.875 85-89 20.119999999999997 28.634999999999998 27.689999999999998 23.555 90-94 20.375 28.535 27.229999999999997 23.86 95-99 20.44 28.615000000000002 27.644999999999996 23.3 100-104 19.975 28.854999999999997 27.735 23.435 105-109 20.150000000000002 28.660000000000004 27.650000000000002 23.54 110-114 20.669999999999998 28.910000000000004 27.235 23.185 115-119 20.669999999999998 28.694999999999997 27.155 23.48 120-124 20.419999999999998 28.74 28.09 22.75 125-129 20.26 28.794999999999998 27.175 23.77 130-134 20.25 28.92 27.405 23.425 135-139 20.880000000000003 28.54 27.38 23.200000000000003 140-144 20.380000000000003 28.225 27.365000000000002 24.03 145-149 20.71 28.54 27.21 23.54 150-151 19.99249812453113 28.732183045761438 28.019504876219052 23.25581395348837 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 2.5 19 2.0 20 1.0 21 1.0 22 1.5 23 4.0 24 6.0 25 7.0 26 8.0 27 6.5 28 12.5 29 19.0 30 20.0 31 28.0 32 33.5 33 44.5 34 66.5 35 85.0 36 100.0 37 112.5 38 130.5 39 162.5 40 199.0 41 219.0 42 231.5 43 247.5 44 247.5 45 255.5 46 263.0 47 250.0 48 237.0 49 212.5 50 175.0 51 138.5 52 116.0 53 100.0 54 71.0 55 48.0 56 35.5 57 26.5 58 22.0 59 16.5 60 12.0 61 8.0 62 5.0 63 3.0 64 2.0 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.4 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.1124999999999998 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.2875 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 2.925 0.0 0.0 0.0 0.0 130-131 3.0999999999999996 0.0 0.0 0.0 0.0 132-133 3.3375 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTCTG 10 0.006585701 146.75949 5 ATTCTGT 10 0.006841402 144.925 6 >>END_MODULE SRR7170637 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170637_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77875 33.0 33.0 34.0 32.0 34.0 2 32.86 33.0 33.0 34.0 32.0 34.0 3 32.91725 34.0 33.0 34.0 32.0 34.0 4 32.8405 34.0 33.0 34.0 32.0 34.0 5 32.81875 34.0 33.0 34.0 32.0 34.0 6 36.986 38.0 38.0 38.0 36.0 38.0 7 37.0305 38.0 38.0 38.0 36.0 38.0 8 37.1235 38.0 38.0 38.0 37.0 38.0 9 37.162 38.0 38.0 38.0 37.0 38.0 10-14 37.058800000000005 38.0 38.0 38.0 36.8 38.0 15-19 37.07695 38.0 38.0 38.0 37.0 38.0 20-24 37.01565 38.0 38.0 38.0 36.4 38.0 25-29 36.9445 38.0 38.0 38.0 36.0 38.0 30-34 36.95954999999999 38.0 38.0 38.0 36.2 38.0 35-39 36.95700000000001 38.0 38.0 38.0 36.2 38.0 40-44 36.94984999999999 38.0 38.0 38.0 36.2 38.0 45-49 36.893499999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.8505 38.0 38.0 38.0 36.0 38.0 55-59 36.73675 38.0 38.0 38.0 35.8 38.0 60-64 36.74585 38.0 38.0 38.0 36.0 38.0 65-69 36.66935 38.0 38.0 38.0 35.4 38.0 70-74 36.6595 38.0 38.0 38.0 35.2 38.0 75-79 36.5863 38.0 38.0 38.0 35.0 38.0 80-84 36.431349999999995 38.0 38.0 38.0 34.2 38.0 85-89 36.4123 38.0 38.0 38.0 34.6 38.0 90-94 36.337450000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.2529 38.0 38.0 38.0 34.0 38.0 100-104 36.06095 38.0 38.0 38.0 33.6 38.0 105-109 35.978100000000005 38.0 37.4 38.0 33.0 38.0 110-114 35.703199999999995 38.0 37.0 38.0 32.0 38.0 115-119 35.51185 38.0 37.0 38.0 31.2 38.0 120-124 35.41785 38.0 36.8 38.0 31.0 38.0 125-129 35.03530000000001 38.0 36.0 38.0 28.8 38.0 130-134 34.65065 38.0 35.6 38.0 27.2 38.0 135-139 34.2827 38.0 34.0 38.0 26.0 38.0 140-144 33.85795 38.0 33.0 38.0 23.4 38.0 145-149 32.84495 38.0 33.0 38.0 15.0 38.0 150-151 27.520875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 4.0 5 2.0 6 0.0 7 0.0 8 3.0 9 2.0 10 4.0 11 4.0 12 3.0 13 0.0 14 4.0 15 4.0 16 5.0 17 7.0 18 6.0 19 8.0 20 5.0 21 5.0 22 9.0 23 13.0 24 11.0 25 13.0 26 21.0 27 23.0 28 24.0 29 35.0 30 40.0 31 49.0 32 70.0 33 113.0 34 140.0 35 285.0 36 667.0 37 2409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.125 15.625 14.2 30.049999999999997 2 24.425 23.25 34.525 17.8 3 19.425 26.075 33.2 21.3 4 22.45 35.425000000000004 23.125 19.0 5 23.775 36.675000000000004 21.75 17.8 6 17.0 36.475 25.55 20.974999999999998 7 16.575 15.8 45.45 22.175 8 19.950000000000003 21.675 27.224999999999998 31.15 9 19.625 25.525 29.525000000000002 25.324999999999996 10-14 21.68 28.01 27.72 22.59 15-19 22.814999999999998 26.86 29.509999999999998 20.815 20-24 22.535 27.965 28.225 21.275 25-29 22.82 27.855 28.465 20.86 30-34 22.66 27.939999999999998 28.415000000000003 20.985 35-39 22.98 27.500000000000004 28.365000000000002 21.154999999999998 40-44 23.22 27.77 27.779999999999998 21.23 45-49 22.58 28.155 28.535 20.73 50-54 22.52 27.35 28.83 21.3 55-59 23.18 27.805000000000003 28.265 20.75 60-64 22.57 28.205000000000002 28.23 20.995 65-69 23.05 27.755000000000003 28.02 21.175 70-74 23.13 28.235 27.985 20.65 75-79 23.7 27.889999999999997 28.075 20.335 80-84 23.51 27.634999999999998 27.715 21.14 85-89 23.1 28.110000000000003 27.79 21.0 90-94 22.925 27.935 28.335 20.805 95-99 23.095 27.845 27.810000000000002 21.25 100-104 23.1 27.87 28.535 20.495 105-109 23.47 28.24 27.834999999999997 20.455000000000002 110-114 23.11 27.74 28.375 20.775 115-119 23.575 27.685 28.21 20.53 120-124 23.294999999999998 28.09 27.794999999999998 20.82 125-129 23.165 27.82 28.375 20.64 130-134 23.72 27.994999999999997 27.939999999999998 20.345 135-139 23.755000000000003 28.28 27.544999999999998 20.419999999999998 140-144 24.169999999999998 28.144999999999996 27.575 20.11 145-149 23.810000000000002 28.685 27.075 20.43 150-151 24.278034754344294 27.015876984623077 28.366045755719465 20.340042505313164 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 2.0 20 3.5 21 2.0 22 1.5 23 1.5 24 2.0 25 5.0 26 5.5 27 6.5 28 7.0 29 13.0 30 19.5 31 19.5 32 31.5 33 43.5 34 51.5 35 61.5 36 80.5 37 110.5 38 133.5 39 156.5 40 196.0 41 218.0 42 232.0 43 265.0 44 283.0 45 285.0 46 260.0 47 242.0 48 239.5 49 221.5 50 170.0 51 128.5 52 107.0 53 89.5 54 77.0 55 54.5 56 47.5 57 38.0 58 26.5 59 22.5 60 18.0 61 9.0 62 5.5 63 3.0 64 0.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26767676767678 98.275 2 0.5303030303030304 1.05 3 0.12626262626262627 0.375 4 0.07575757575757576 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.3125 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 2.9625 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 4.025 0.0 0.0 0.0 0.0 138-139 4.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAAAA 10 0.006830828 145.0 8 TGAATTC 10 0.006830828 145.0 8 >>END_MODULE Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879682 spots for SRR7170637.sra Written 879682 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra Read 879679 spots for SRR7170637.sra Written 879679 spots for SRR7170637.sra SRR ids: ['SRR7170637.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eck4b23i SRR7170637.sra spots: 17593583 blocks: [[1, 879679], [879680, 1759358], [1759359, 2639037], [2639038, 3518716], [3518717, 4398395], [4398396, 5278074], [5278075, 6157753], [6157754, 7037432], [7037433, 7917111], [7917112, 8796790], [8796791, 9676469], [9676470, 10556148], [10556149, 11435827], [11435828, 12315506], [12315507, 13195185], [13195186, 14074864], [14074865, 14954543], [14954544, 15834222], [15834223, 16713901], [16713902, 17593583]] SRR7170637 file size 5940187 SRR7170637 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170637 SRR7170637_1.fastq SRR7170637_2.fastq Input file: SRR7170637_1.fastq Paired file: SRR7170637_2.fastq trimmed: SRR7170637-trimmed-pair1.fastq, SRR7170637-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:35:27 2025 >> started Thu Feb 13 13:35:46 2025 >> done (19.578s) 17593583 read pairs processed; of these: 14920 ( 0.08%) short read pairs filtered out after trimming by size control 29054 ( 0.17%) empty read pairs filtered out after trimming by size control 17549609 (99.75%) read pairs available; of these: 9087162 (51.78%) trimmed read pairs available after processing 8462447 (48.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 11 0.00% 21 9 0.00% 22 10 0.00% 23 9 0.00% 24 10 0.00% 25 17 0.00% 26 6 0.00% 27 19 0.00% 28 12 0.00% 29 11 0.00% 30 9 0.00% 31 20 0.00% 32 17 0.00% 33 12 0.00% 34 29 0.00% 35 27 0.00% 36 17 0.00% 37 18 0.00% 38 32 0.00% 39 38 0.00% 40 29 0.00% 41 45 0.00% 42 40 0.00% 43 64 0.00% 44 55 0.00% 45 67 0.00% 46 83 0.00% 47 94 0.00% 48 98 0.00% 49 126 0.00% 50 150 0.00% 51 181 0.00% 52 184 0.00% 53 165 0.00% 54 175 0.00% 55 191 0.00% 56 203 0.00% 57 226 0.00% 58 279 0.00% 59 325 0.00% 60 354 0.00% 61 430 0.00% 62 477 0.00% 63 494 0.00% 64 550 0.00% 65 594 0.00% 66 622 0.00% 67 671 0.00% 68 726 0.00% 69 828 0.00% 70 1045 0.01% 71 1105 0.01% 72 1295 0.01% 73 1517 0.01% 74 1575 0.01% 75 1754 0.01% 76 2242 0.01% 77 2335 0.01% 78 2230 0.01% 79 2377 0.01% 80 2527 0.01% 81 2915 0.02% 82 3443 0.02% 83 3899 0.02% 84 4744 0.03% 85 5518 0.03% 86 5528 0.03% 87 6058 0.03% 88 6247 0.04% 89 6653 0.04% 90 6981 0.04% 91 7529 0.04% 92 7955 0.05% 93 8707 0.05% 94 9232 0.05% 95 9660 0.06% 96 9997 0.06% 97 10156 0.06% 98 10700 0.06% 99 11046 0.06% 100 11547 0.07% 101 12261 0.07% 102 13004 0.07% 103 13585 0.08% 104 14179 0.08% 105 15122 0.09% 106 15426 0.09% 107 15592 0.09% 108 15904 0.09% 109 16515 0.09% 110 17208 0.10% 111 17891 0.10% 112 18991 0.11% 113 19873 0.11% 114 20736 0.12% 115 21547 0.12% 116 22232 0.13% 117 22886 0.13% 118 23198 0.13% 119 24058 0.14% 120 24592 0.14% 121 25924 0.15% 122 27128 0.15% 123 28837 0.16% 124 29884 0.17% 125 31144 0.18% 126 32418 0.18% 127 33582 0.19% 128 35207 0.20% 129 36505 0.21% 130 38364 0.22% 131 40115 0.23% 132 43433 0.25% 133 45611 0.26% 134 49517 0.28% 135 53308 0.30% 136 57980 0.33% 137 63439 0.36% 138 68815 0.39% 139 75793 0.43% 140 85397 0.49% 141 95578 0.54% 142 109884 0.63% 143 130829 0.75% 144 156346 0.89% 145 192101 1.09% 146 247613 1.41% 147 345046 1.97% 148 542477 3.09% 149 1086795 6.19% 150 4735899 26.99% 151 8462447 48.22% 17549609 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=23 prefix-density=0.57 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=90.76 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.6 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=10 prefix-density=0.85 prefix-fanout=2.6 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=37.19 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.1 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170637 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:36:31 Started mapping on | Feb 13 13:36:32 Finished on | Feb 13 13:38:31 Mapping speed, Million of reads per hour | 530.91 Number of input reads | 17549609 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16534542 Uniquely mapped reads % | 94.22% Average mapped length | 294.73 Number of splices: Total | 16866908 Number of splices: Annotated (sjdb) | 16505850 Number of splices: GT/AG | 16543080 Number of splices: GC/AG | 272262 Number of splices: AT/AC | 9162 Number of splices: Non-canonical | 42404 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 417164 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 38200 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 614558 614558 614558 N_multimapping 417164 417164 417164 N_noFeature 635080 16293825 734542 N_ambiguous 258427 1068 116511 UnstrandedReadsAssigned:15641035 PositiveStrandReadsAssigned:239649 NegativeStrandReadsAssigned:15683489 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170637 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170637-trimmed-pair1.fastq SRR7170637-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,549,609 reads, 15,598,254 reads pseudoaligned [quant] estimated average fragment length: 286.099 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,003 rounds 52401 SRR7170637.ke.tsv 34699 SRR7170637.se.tsv 87100 total ==> SRR7170637.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.9 665 24.5323 Potri.005G024800.1.v4.1 1035 749.901 198 16.8792 Potri.004G059700.1.v4.1 961 676.058 9 0.851036 Potri.007G009000.2.v4.1 1416 1130.9 0 0 Potri.003G141000.2.v4.1 2943 2657.9 999.495 24.0398 Potri.016G087400.1.v4.1 270 72.5906 558 491.41 Potri.015G069301.1.v4.1 564 292.45 0 0 Potri.010G195200.1.v4.1 1773 1487.9 37 1.58971 Potri.012G127500.1.v4.1 977 691.986 705 65.13 ==> SRR7170637.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 455 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 31 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR7170637 completed mapping pipeline successfully