Starting /dee2/code/volunteer_pipeline.sh SRR7170638 current disk space = 3090100695040 free memory = 1469240768 SRR7170638 SRAfilesize 8cce91c31ce8aab151c9e245736c617c SRR7170638.sra SRR7170638.sra file validated SRR7170638 is paired end SRR7170638 is conventional basespace SRR7170638 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170638_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.35875 25.0 18.0 32.0 18.0 33.0 2 27.62175 29.0 25.0 31.0 18.0 33.0 3 30.068 31.0 29.0 33.0 25.0 33.0 4 31.32175 33.0 31.0 33.0 29.0 33.0 5 31.86925 33.0 32.0 33.0 30.0 34.0 6 36.1485 38.0 36.0 38.0 33.0 38.0 7 36.70575 38.0 37.0 38.0 34.0 38.0 8 37.14675 38.0 38.0 38.0 36.0 38.0 9 37.305 38.0 38.0 38.0 37.0 38.0 10-14 37.27945 38.0 38.0 38.0 37.0 38.0 15-19 37.1671 38.0 38.0 38.0 36.4 38.0 20-24 37.1068 38.0 38.0 38.0 36.2 38.0 25-29 37.23225 38.0 38.0 38.0 36.6 38.0 30-34 37.26305 38.0 38.0 38.0 37.0 38.0 35-39 37.27525 38.0 38.0 38.0 36.8 38.0 40-44 37.202000000000005 38.0 38.0 38.0 36.6 38.0 45-49 37.09475 38.0 38.0 38.0 36.0 38.0 50-54 36.982299999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.84515 38.0 38.0 38.0 35.0 38.0 60-64 36.88665 38.0 38.0 38.0 35.2 38.0 65-69 36.77755 38.0 38.0 38.0 35.0 38.0 70-74 36.76145 38.0 38.0 38.0 34.8 38.0 75-79 36.5563 38.0 38.0 38.0 34.0 38.0 80-84 36.36475 38.0 37.6 38.0 33.8 38.0 85-89 36.318650000000005 38.0 37.4 38.0 33.6 38.0 90-94 36.08925 38.0 37.0 38.0 33.2 38.0 95-99 35.9399 38.0 37.0 38.0 32.2 38.0 100-104 35.694849999999995 38.0 37.0 38.0 30.6 38.0 105-109 35.697900000000004 38.0 36.8 38.0 30.6 38.0 110-114 35.53789999999999 38.0 36.0 38.0 30.6 38.0 115-119 35.370000000000005 38.0 36.0 38.0 29.2 38.0 120-124 35.07725000000001 38.0 35.6 38.0 28.0 38.0 125-129 34.61755 38.0 35.0 38.0 25.4 38.0 130-134 34.5048 38.0 34.6 38.0 26.2 38.0 135-139 33.62480000000001 38.0 33.0 38.0 22.2 38.0 140-144 33.0754 38.0 33.0 38.0 19.6 38.0 145-149 31.8157 38.0 31.6 38.0 10.8 38.0 150-151 25.291874999999997 32.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 2.0 17 0.0 18 0.0 19 6.0 20 2.0 21 4.0 22 11.0 23 9.0 24 12.0 25 17.0 26 15.0 27 17.0 28 40.0 29 46.0 30 73.0 31 96.0 32 131.0 33 185.0 34 249.0 35 437.0 36 994.0 37 1646.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.15932914046122 20.67610062893082 11.713836477987421 30.450733752620547 2 19.075 26.625 37.5 16.8 3 15.55 33.45 26.35 24.65 4 20.525 37.45 23.125 18.9 5 19.625 38.6 23.925 17.849999999999998 6 16.275000000000002 35.875 25.074999999999996 22.775000000000002 7 12.125 20.325 45.675 21.875 8 17.95 20.8 29.099999999999998 32.15 9 17.95 20.3 31.775 29.975 10-14 19.225 29.299999999999997 26.979999999999997 24.495 15-19 19.36 28.275 28.365000000000002 24.0 20-24 19.785 29.04 27.605 23.57 25-29 19.73 29.18 27.405 23.685000000000002 30-34 19.735 28.875 27.87 23.52 35-39 20.075000000000003 29.475 27.55 22.900000000000002 40-44 19.915 29.354999999999997 27.16 23.57 45-49 20.275000000000002 28.89 27.084999999999997 23.75 50-54 19.545 28.804999999999996 28.005000000000003 23.645 55-59 19.63 29.385 27.860000000000003 23.125 60-64 19.71 28.754999999999995 27.93 23.605 65-69 19.46 28.71 27.815 24.015 70-74 20.115 28.98 27.655 23.25 75-79 19.939999999999998 28.62 27.74 23.7 80-84 20.055 28.675 28.349999999999998 22.919999999999998 85-89 19.805 29.054999999999996 27.605 23.535 90-94 20.005 28.87 27.605 23.52 95-99 19.81 28.865000000000002 27.715 23.61 100-104 20.175 28.9 27.415 23.51 105-109 20.13 29.154999999999998 27.544999999999998 23.169999999999998 110-114 20.185 29.075 27.38 23.36 115-119 19.845 28.95 27.91 23.294999999999998 120-124 20.645 28.904999999999998 27.595 22.855 125-129 20.599999999999998 28.794999999999998 27.295 23.31 130-134 20.175 28.244999999999997 28.035 23.544999999999998 135-139 20.849999999999998 28.744999999999997 27.26 23.145 140-144 20.424999999999997 28.76 27.205000000000002 23.61 145-149 20.794999999999998 28.994999999999997 26.945000000000004 23.265 150-151 20.4125 28.6875 27.275 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 1.5 23 4.0 24 4.5 25 4.5 26 8.0 27 14.0 28 16.5 29 20.5 30 31.0 31 38.5 32 46.5 33 56.5 34 68.5 35 82.5 36 91.5 37 107.0 38 128.5 39 157.0 40 187.0 41 228.0 42 264.0 43 265.0 44 265.0 45 268.5 46 261.0 47 253.0 48 227.5 49 192.5 50 156.0 51 123.5 52 107.5 53 84.5 54 60.0 55 47.5 56 34.5 57 25.5 58 21.5 59 15.5 60 11.0 61 5.5 62 4.0 63 2.0 64 0.0 65 1.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.0374999999999996 0.0 0.0 0.0 0.0 120-121 2.275 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.7249999999999996 0.0 0.0 0.0 0.0 126-127 2.9875 0.0 0.0 0.0 0.0 128-129 3.2125 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.1 0.0 0.0 0.0 0.0 136-137 4.487500000000001 0.0 0.0 0.0 0.0 138-139 4.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAATTT 30 0.0014624198 76.289474 1 >>END_MODULE SRR7170638 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170638_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49525 33.0 33.0 34.0 32.0 34.0 2 32.59925 33.0 33.0 34.0 32.0 34.0 3 32.6565 33.0 33.0 34.0 32.0 34.0 4 32.57525 33.0 33.0 34.0 32.0 34.0 5 32.5815 33.0 33.0 34.0 32.0 34.0 6 36.78625 38.0 38.0 38.0 35.0 38.0 7 36.96525 38.0 38.0 38.0 36.0 38.0 8 36.80475 38.0 38.0 38.0 36.0 38.0 9 36.8905 38.0 38.0 38.0 36.0 38.0 10-14 36.769800000000004 38.0 38.0 38.0 35.0 38.0 15-19 36.6554 38.0 38.0 38.0 35.0 38.0 20-24 36.697799999999994 38.0 38.0 38.0 35.2 38.0 25-29 36.6674 38.0 38.0 38.0 35.0 38.0 30-34 36.6842 38.0 38.0 38.0 35.0 38.0 35-39 36.5167 38.0 38.0 38.0 34.2 38.0 40-44 36.50735 38.0 38.0 38.0 34.6 38.0 45-49 36.4458 38.0 38.0 38.0 33.8 38.0 50-54 36.381150000000005 38.0 38.0 38.0 34.0 38.0 55-59 36.3797 38.0 38.0 38.0 34.0 38.0 60-64 36.29174999999999 38.0 38.0 38.0 34.0 38.0 65-69 36.261 38.0 38.0 38.0 33.6 38.0 70-74 36.09715 38.0 38.0 38.0 33.0 38.0 75-79 36.049150000000004 38.0 37.2 38.0 33.0 38.0 80-84 35.9209 38.0 37.0 38.0 32.6 38.0 85-89 35.7633 38.0 37.0 38.0 31.2 38.0 90-94 35.6195 38.0 37.0 38.0 30.4 38.0 95-99 35.4975 38.0 37.0 38.0 30.2 38.0 100-104 35.2595 38.0 36.2 38.0 29.0 38.0 105-109 35.112550000000006 38.0 36.0 38.0 28.2 38.0 110-114 34.8284 38.0 35.8 38.0 26.8 38.0 115-119 34.561 38.0 35.0 38.0 25.4 38.0 120-124 34.264050000000005 38.0 34.4 38.0 23.4 38.0 125-129 33.76245 38.0 33.0 38.0 22.0 38.0 130-134 33.273 38.0 33.0 38.0 19.8 38.0 135-139 32.73525 38.0 33.0 38.0 14.6 38.0 140-144 31.74855 37.6 30.6 38.0 12.8 38.0 145-149 30.3084 36.0 28.6 38.0 5.8 38.0 150-151 24.6065 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 3.0 5 1.0 6 3.0 7 2.0 8 2.0 9 2.0 10 0.0 11 2.0 12 3.0 13 1.0 14 3.0 15 5.0 16 7.0 17 1.0 18 7.0 19 8.0 20 10.0 21 13.0 22 14.0 23 18.0 24 16.0 25 30.0 26 40.0 27 40.0 28 54.0 29 62.0 30 77.0 31 87.0 32 129.0 33 164.0 34 242.0 35 392.0 36 776.0 37 1773.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.425 14.825 15.325 30.425 2 23.474999999999998 24.349999999999998 34.275 17.9 3 19.975 26.474999999999998 32.15 21.4 4 23.474999999999998 36.175000000000004 20.549999999999997 19.8 5 22.925 37.175000000000004 22.175 17.724999999999998 6 16.55 39.1 23.95 20.4 7 15.65 14.549999999999999 48.8 21.0 8 21.125 21.325 26.775 30.775000000000002 9 21.9 23.599999999999998 29.225 25.275 10-14 22.12 28.825 27.800000000000004 21.255 15-19 21.965 28.63 28.349999999999998 21.055 20-24 22.195 28.9 27.875 21.029999999999998 25-29 22.545 28.62 28.21 20.625 30-34 22.25 29.110000000000003 28.52 20.119999999999997 35-39 22.6 28.08 28.144999999999996 21.175 40-44 22.5 28.315 28.134999999999998 21.05 45-49 22.939999999999998 28.23 28.560000000000002 20.27 50-54 22.795 27.925 28.249999999999996 21.029999999999998 55-59 22.465 28.794999999999998 27.63 21.11 60-64 22.645 27.589999999999996 28.59 21.175 65-69 22.605 28.384999999999998 28.18 20.830000000000002 70-74 22.585 28.055000000000003 28.565 20.794999999999998 75-79 22.95 27.245 28.895 20.91 80-84 23.14 28.005000000000003 28.025 20.830000000000002 85-89 22.85 27.905 28.515 20.73 90-94 23.285 28.24 28.335 20.14 95-99 22.945 28.33 28.62 20.105 100-104 22.91 28.225 28.24 20.625 105-109 23.549999999999997 27.950000000000003 28.205000000000002 20.294999999999998 110-114 23.445 28.235 27.689999999999998 20.630000000000003 115-119 23.635 27.650000000000002 28.42 20.294999999999998 120-124 23.775 28.07 28.139999999999997 20.015 125-129 23.369999999999997 28.144999999999996 28.000000000000004 20.485 130-134 24.37 27.815 27.450000000000003 20.365 135-139 23.794999999999998 27.815 27.925 20.465 140-144 24.14 27.195000000000004 28.415000000000003 20.25 145-149 23.62 27.805000000000003 28.189999999999998 20.385 150-151 24.4125 27.200000000000003 28.5625 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 5.0 24 5.5 25 5.5 26 6.0 27 10.5 28 12.0 29 14.5 30 22.0 31 27.5 32 34.5 33 46.5 34 65.5 35 75.0 36 90.5 37 118.0 38 149.0 39 182.5 40 201.5 41 215.5 42 245.5 43 263.5 44 272.5 45 286.0 46 265.0 47 227.5 48 205.5 49 188.0 50 161.0 51 129.5 52 104.5 53 86.5 54 73.0 55 57.0 56 39.0 57 34.0 58 28.5 59 15.0 60 8.0 61 5.5 62 5.0 63 3.5 64 1.0 65 0.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44598337950139 98.725 2 0.4281037522034752 0.8500000000000001 3 0.07554772097708386 0.22499999999999998 4 0.0503651473180559 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.4749999999999996 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 4.075 0.0 0.0 0.0 0.0 136-137 4.45 0.0 0.0 0.0 0.0 138-139 4.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCATTG 10 0.006830828 145.0 3 CACACCC 10 0.006830828 145.0 5 CAATATA 10 0.006830828 145.0 4 GCTGCAT 10 0.006830828 145.0 1 GATCCTC 10 0.006830828 145.0 5 ATCCTCT 35 0.0033124194 62.14286 6 >>END_MODULE Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra Read 1032524 spots for SRR7170638.sra Written 1032524 spots for SRR7170638.sra SRR ids: ['SRR7170638.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oir8mqyf SRR7170638.sra spots: 20650480 blocks: [[1, 1032524], [1032525, 2065048], [2065049, 3097572], [3097573, 4130096], [4130097, 5162620], [5162621, 6195144], [6195145, 7227668], [7227669, 8260192], [8260193, 9292716], [9292717, 10325240], [10325241, 11357764], [11357765, 12390288], [12390289, 13422812], [13422813, 14455336], [14455337, 15487860], [15487861, 16520384], [16520385, 17552908], [17552909, 18585432], [18585433, 19617956], [19617957, 20650480]] SRR7170638 file size 6976069 SRR7170638 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170638 SRR7170638_1.fastq SRR7170638_2.fastq Input file: SRR7170638_1.fastq Paired file: SRR7170638_2.fastq trimmed: SRR7170638-trimmed-pair1.fastq, SRR7170638-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:06:50 2025 >> started Thu Feb 13 14:07:13 2025 >> done (22.798s) 20650480 read pairs processed; of these: 24480 ( 0.12%) short read pairs filtered out after trimming by size control 26679 ( 0.13%) empty read pairs filtered out after trimming by size control 20599321 (99.75%) read pairs available; of these: 12876339 (62.51%) trimmed read pairs available after processing 7722982 (37.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 11 0.00% 21 10 0.00% 22 13 0.00% 23 4 0.00% 24 10 0.00% 25 11 0.00% 26 7 0.00% 27 8 0.00% 28 10 0.00% 29 15 0.00% 30 16 0.00% 31 14 0.00% 32 17 0.00% 33 17 0.00% 34 13 0.00% 35 25 0.00% 36 14 0.00% 37 22 0.00% 38 22 0.00% 39 26 0.00% 40 39 0.00% 41 31 0.00% 42 46 0.00% 43 55 0.00% 44 54 0.00% 45 58 0.00% 46 79 0.00% 47 92 0.00% 48 91 0.00% 49 94 0.00% 50 118 0.00% 51 158 0.00% 52 167 0.00% 53 178 0.00% 54 212 0.00% 55 205 0.00% 56 238 0.00% 57 259 0.00% 58 292 0.00% 59 367 0.00% 60 388 0.00% 61 458 0.00% 62 522 0.00% 63 568 0.00% 64 634 0.00% 65 665 0.00% 66 759 0.00% 67 824 0.00% 68 950 0.00% 69 1073 0.01% 70 1214 0.01% 71 1405 0.01% 72 1576 0.01% 73 1753 0.01% 74 2006 0.01% 75 2264 0.01% 76 2498 0.01% 77 2736 0.01% 78 2865 0.01% 79 3277 0.02% 80 3584 0.02% 81 4063 0.02% 82 4633 0.02% 83 5021 0.02% 84 6579 0.03% 85 7244 0.04% 86 7800 0.04% 87 8264 0.04% 88 8756 0.04% 89 8978 0.04% 90 9507 0.05% 91 10409 0.05% 92 11144 0.05% 93 11806 0.06% 94 12472 0.06% 95 13181 0.06% 96 13581 0.07% 97 14217 0.07% 98 14863 0.07% 99 15524 0.08% 100 16438 0.08% 101 17494 0.08% 102 18176 0.09% 103 19385 0.09% 104 20064 0.10% 105 20985 0.10% 106 22086 0.11% 107 22669 0.11% 108 23158 0.11% 109 24331 0.12% 110 25261 0.12% 111 26290 0.13% 112 27858 0.14% 113 29050 0.14% 114 29688 0.14% 115 31141 0.15% 116 32567 0.16% 117 33679 0.16% 118 35373 0.17% 119 36555 0.18% 120 38907 0.19% 121 40726 0.20% 122 42501 0.21% 123 45776 0.22% 124 47631 0.23% 125 50107 0.24% 126 52911 0.26% 127 56449 0.27% 128 59392 0.29% 129 63308 0.31% 130 67387 0.33% 131 72483 0.35% 132 78626 0.38% 133 85014 0.41% 134 91978 0.45% 135 101248 0.49% 136 112008 0.54% 137 122058 0.59% 138 135499 0.66% 139 150776 0.73% 140 168579 0.82% 141 190947 0.93% 142 215547 1.05% 143 250298 1.22% 144 292059 1.42% 145 348840 1.69% 146 443495 2.15% 147 584645 2.84% 148 881011 4.28% 149 1651431 8.02% 150 5599264 27.18% 151 7722982 37.49% 20599321 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=14 prefix-density=0.43 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=9.58 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=3.4 sequence=CCAGCAGTGTCCCA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=12 prefix-density=0.54 prefix-fanout=2.4 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=34.09 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=10.6 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170638 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:07:54 Started mapping on | Feb 13 14:07:54 Finished on | Feb 13 14:10:02 Mapping speed, Million of reads per hour | 579.36 Number of input reads | 20599321 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 19375188 Uniquely mapped reads % | 94.06% Average mapped length | 292.45 Number of splices: Total | 18741926 Number of splices: Annotated (sjdb) | 18299198 Number of splices: GT/AG | 18393338 Number of splices: GC/AG | 277239 Number of splices: AT/AC | 10927 Number of splices: Non-canonical | 60422 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 575809 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 43924 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 674530 674530 674530 N_multimapping 575809 575809 575809 N_noFeature 835549 19091427 956505 N_ambiguous 312903 1327 149269 UnstrandedReadsAssigned:18226736 PositiveStrandReadsAssigned:282434 NegativeStrandReadsAssigned:18269414 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170638 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170638-trimmed-pair1.fastq SRR7170638-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,599,321 reads, 18,201,577 reads pseudoaligned [quant] estimated average fragment length: 278.991 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR7170638.ke.tsv 34699 SRR7170638.se.tsv 87100 total ==> SRR7170638.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.01 1201 40.7126 Potri.005G024800.1.v4.1 1035 757.009 217 16.9081 Potri.004G059700.1.v4.1 961 683.147 14 1.20879 Potri.007G009000.2.v4.1 1416 1138.01 0 0 Potri.003G141000.2.v4.1 2943 2665.01 941.364 20.8351 Potri.016G087400.1.v4.1 270 75.5629 703 548.762 Potri.015G069301.1.v4.1 564 299.062 0 0 Potri.010G195200.1.v4.1 1773 1495.01 157 6.19431 Potri.012G127500.1.v4.1 977 699.065 262 22.1065 ==> SRR7170638.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1072 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 113 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 38 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR7170638 completed mapping pipeline successfully