Starting /dee2/code/volunteer_pipeline.sh SRR7170639 current disk space = 3090726944768 free memory = 1421689504 SRR7170639 SRAfilesize 68f71e3a67184d2805905c79a2ac7735 SRR7170639.sra SRR7170639.sra file validated SRR7170639 is paired end SRR7170639 is conventional basespace SRR7170639 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170639_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.14725 31.0 18.0 33.0 18.0 33.0 2 27.61025 29.0 25.0 31.0 18.0 33.0 3 30.7015 31.0 29.0 33.0 27.0 33.0 4 32.04875 33.0 31.0 33.0 30.0 33.0 5 32.57575 33.0 33.0 33.0 32.0 34.0 6 36.816 38.0 37.0 38.0 34.0 38.0 7 36.96925 38.0 38.0 38.0 35.0 38.0 8 37.32 38.0 38.0 38.0 36.0 38.0 9 37.42875 38.0 38.0 38.0 37.0 38.0 10-14 37.406400000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.457 38.0 38.0 38.0 37.0 38.0 20-24 37.522000000000006 38.0 38.0 38.0 37.6 38.0 25-29 37.52719999999999 38.0 38.0 38.0 37.8 38.0 30-34 37.49465 38.0 38.0 38.0 38.0 38.0 35-39 37.523 38.0 38.0 38.0 38.0 38.0 40-44 37.435599999999994 38.0 38.0 38.0 37.2 38.0 45-49 37.449400000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.298300000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.25305 38.0 38.0 38.0 37.0 38.0 60-64 37.18275 38.0 38.0 38.0 36.0 38.0 65-69 37.182750000000006 38.0 38.0 38.0 36.0 38.0 70-74 37.09445 38.0 38.0 38.0 36.0 38.0 75-79 36.9107 38.0 38.0 38.0 35.8 38.0 80-84 36.8934 38.0 38.0 38.0 36.0 38.0 85-89 36.810300000000005 38.0 38.0 38.0 34.8 38.0 90-94 36.6583 38.0 38.0 38.0 34.4 38.0 95-99 36.46855 38.0 37.8 38.0 34.0 38.0 100-104 36.381550000000004 38.0 37.8 38.0 34.0 38.0 105-109 36.31165 38.0 37.6 38.0 34.0 38.0 110-114 36.142399999999995 38.0 37.2 38.0 33.2 38.0 115-119 35.87865 38.0 37.0 38.0 31.8 38.0 120-124 35.5315 38.0 36.2 38.0 31.0 38.0 125-129 35.42885 38.0 36.0 38.0 30.2 38.0 130-134 35.1706 38.0 35.8 38.0 28.4 38.0 135-139 34.938750000000006 38.0 35.0 38.0 28.0 38.0 140-144 34.48165 38.0 34.6 38.0 26.6 38.0 145-149 33.66674999999999 38.0 33.0 38.0 22.6 38.0 150-151 29.167500000000004 35.0 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 3.0 17 3.0 18 1.0 19 3.0 20 3.0 21 8.0 22 4.0 23 4.0 24 8.0 25 11.0 26 15.0 27 10.0 28 14.0 29 35.0 30 35.0 31 55.0 32 71.0 33 107.0 34 163.0 35 344.0 36 863.0 37 2234.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.358643381422425 18.50164515312579 12.477853707922044 35.66185775752974 2 18.425 24.525 38.625 18.425 3 16.725 30.275000000000002 29.025000000000002 23.974999999999998 4 21.275 37.0 21.55 20.175 5 19.86937955287616 37.603617181612655 22.883697563426274 19.643305702084906 6 14.899999999999999 37.025000000000006 26.575 21.5 7 12.4 20.7 45.875 21.025 8 17.525 22.075 28.349999999999998 32.05 9 16.25 23.225 30.575000000000003 29.95 10-14 18.66 30.595 26.32 24.425 15-19 19.355 29.415000000000003 27.689999999999998 23.54 20-24 19.27 29.439999999999998 27.950000000000003 23.34 25-29 19.485 29.145 27.58 23.79 30-34 19.564999999999998 29.160000000000004 27.839999999999996 23.435 35-39 19.27 29.759999999999998 27.575 23.395 40-44 19.875 29.215000000000003 27.605 23.305 45-49 19.97 28.785 27.275 23.97 50-54 19.545 29.035 27.82 23.599999999999998 55-59 19.605 28.48 27.91 24.005000000000003 60-64 19.32 28.82 27.800000000000004 24.060000000000002 65-69 19.835 29.075 27.474999999999998 23.615 70-74 19.220000000000002 28.38 28.265 24.135 75-79 19.81 28.875 27.51 23.805 80-84 19.79 28.18 27.975 24.055 85-89 20.375 28.285 27.915 23.425 90-94 20.24 28.13 27.515 24.115000000000002 95-99 19.885 29.195 27.839999999999996 23.080000000000002 100-104 20.57 28.365000000000002 27.51 23.555 105-109 20.150000000000002 28.189999999999998 27.415 24.245 110-114 20.03 28.735 27.6 23.635 115-119 20.25 28.46 27.485 23.805 120-124 20.735 28.335 26.974999999999998 23.955000000000002 125-129 21.265 28.04 26.779999999999998 23.915 130-134 20.47 28.34 27.084999999999997 24.104999999999997 135-139 20.635 28.075 27.18 24.11 140-144 21.029999999999998 27.900000000000002 27.060000000000002 24.01 145-149 20.11 28.249999999999996 27.93 23.71 150-151 21.005880145126987 28.57500312773677 26.122857500312772 24.296259226823473 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 2.0 19 1.5 20 1.5 21 1.0 22 0.0 23 1.0 24 4.5 25 7.5 26 11.0 27 14.0 28 16.0 29 24.0 30 29.0 31 39.5 32 46.5 33 62.5 34 85.5 35 112.5 36 122.5 37 114.5 38 151.0 39 185.0 40 178.0 41 194.5 42 224.0 43 219.0 44 221.5 45 233.5 46 239.5 47 226.0 48 219.0 49 206.0 50 168.5 51 141.0 52 119.5 53 93.5 54 72.5 55 58.0 56 38.0 57 29.0 58 24.0 59 21.0 60 17.5 61 9.5 62 4.5 63 2.5 64 2.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.475 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.41715598672454 96.375 2 1.2764871074802144 2.5 3 0.2297676793464386 0.675 4 0.025529742149604292 0.1 5 0.0 0.0 6 0.025529742149604292 0.15 7 0.0 0.0 8 0.025529742149604292 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCA 8 0.2 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.9125000000000001 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.7625 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.425000000000001 0.0 0.0 0.0 0.0 136-137 4.9 0.0 0.0 0.0 0.0 138-139 5.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGAAC 10 0.0065874006 146.74684 2 >>END_MODULE SRR7170639 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170639_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86325 33.0 33.0 34.0 32.0 34.0 2 32.9075 33.0 33.0 34.0 32.0 34.0 3 32.90975 34.0 33.0 34.0 32.0 34.0 4 32.89025 34.0 33.0 34.0 32.0 34.0 5 32.93025 34.0 33.0 34.0 32.0 34.0 6 37.106 38.0 38.0 38.0 37.0 38.0 7 37.2445 38.0 38.0 38.0 37.0 38.0 8 37.18175 38.0 38.0 38.0 37.0 38.0 9 37.13425 38.0 38.0 38.0 37.0 38.0 10-14 37.20405 38.0 38.0 38.0 37.0 38.0 15-19 37.16675 38.0 38.0 38.0 37.0 38.0 20-24 37.118249999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.0831 38.0 38.0 38.0 37.0 38.0 30-34 37.04685 38.0 38.0 38.0 37.0 38.0 35-39 37.0693 38.0 38.0 38.0 37.0 38.0 40-44 37.0382 38.0 38.0 38.0 37.0 38.0 45-49 37.00835 38.0 38.0 38.0 36.6 38.0 50-54 36.9422 38.0 38.0 38.0 36.6 38.0 55-59 36.8914 38.0 38.0 38.0 36.0 38.0 60-64 36.922000000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.8767 38.0 38.0 38.0 36.2 38.0 70-74 36.78595 38.0 38.0 38.0 36.0 38.0 75-79 36.728300000000004 38.0 38.0 38.0 35.6 38.0 80-84 36.70105000000001 38.0 38.0 38.0 35.6 38.0 85-89 36.65560000000001 38.0 38.0 38.0 35.4 38.0 90-94 36.5289 38.0 38.0 38.0 35.0 38.0 95-99 36.4568 38.0 38.0 38.0 34.6 38.0 100-104 36.2936 38.0 38.0 38.0 34.0 38.0 105-109 36.15925 38.0 38.0 38.0 33.8 38.0 110-114 36.066399999999994 38.0 37.8 38.0 33.8 38.0 115-119 35.85809999999999 38.0 37.4 38.0 32.8 38.0 120-124 35.8284 38.0 37.0 38.0 33.0 38.0 125-129 35.52325 38.0 36.2 38.0 31.4 38.0 130-134 35.101749999999996 38.0 36.0 38.0 30.0 38.0 135-139 34.68865 38.0 35.4 38.0 28.6 38.0 140-144 34.29594999999999 38.0 34.2 38.0 26.4 38.0 145-149 33.528200000000005 38.0 33.0 38.0 21.0 38.0 150-151 28.415 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 1.0 5 2.0 6 0.0 7 5.0 8 1.0 9 0.0 10 1.0 11 3.0 12 3.0 13 4.0 14 0.0 15 3.0 16 2.0 17 3.0 18 2.0 19 4.0 20 6.0 21 7.0 22 5.0 23 8.0 24 9.0 25 12.0 26 15.0 27 17.0 28 26.0 29 36.0 30 39.0 31 46.0 32 60.0 33 85.0 34 142.0 35 227.0 36 597.0 37 2612.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.175 16.650000000000002 14.7 28.475 2 23.799999999999997 23.375 34.949999999999996 17.875 3 20.625 27.35 31.25 20.775 4 23.95 34.875 21.825 19.35 5 23.225 37.75 20.775 18.25 6 17.349999999999998 37.225 24.875 20.549999999999997 7 17.325 15.45 44.574999999999996 22.650000000000002 8 20.9 22.15 26.424999999999997 30.525000000000002 9 21.425 23.35 29.375 25.85 10-14 23.044999999999998 28.585 26.805 21.565 15-19 23.695 27.175 28.015 21.115000000000002 20-24 22.93 28.125 28.04 20.905 25-29 23.465 27.375 28.005000000000003 21.154999999999998 30-34 23.72 28.51 27.215 20.555 35-39 23.330000000000002 28.155 27.925 20.59 40-44 23.62 27.48 27.900000000000002 21.0 45-49 23.235 28.425 27.35 20.990000000000002 50-54 23.385 27.815 27.715 21.085 55-59 23.61 27.860000000000003 27.66 20.87 60-64 23.395 27.33 27.834999999999997 21.44 65-69 23.625 28.075 26.889999999999997 21.41 70-74 22.84 27.71 28.000000000000004 21.45 75-79 23.61 28.255000000000003 27.685 20.45 80-84 24.154999999999998 28.155 26.995 20.695 85-89 23.71 28.134999999999998 27.16 20.995 90-94 24.310000000000002 28.050000000000004 27.315 20.325 95-99 24.22 27.41 27.67 20.7 100-104 24.3 28.050000000000004 27.49 20.16 105-109 23.96 28.07 27.315 20.655 110-114 24.125 27.76 27.76 20.355 115-119 24.395 27.965 27.825 19.814999999999998 120-124 24.26 28.035 27.36 20.345 125-129 24.525 27.935 27.605 19.935 130-134 24.54 27.3 28.139999999999997 20.02 135-139 24.715 28.294999999999998 27.665 19.325 140-144 24.84 28.275 26.825 20.06 145-149 24.575 28.325 27.48 19.62 150-151 24.0780097512189 27.965995749468686 28.378547318414803 19.57744718089761 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 1.0 22 2.0 23 4.0 24 4.5 25 5.0 26 4.5 27 6.5 28 9.5 29 12.5 30 18.5 31 19.5 32 25.5 33 34.0 34 49.5 35 63.5 36 77.5 37 104.5 38 127.5 39 141.0 40 163.5 41 198.0 42 217.5 43 240.5 44 263.0 45 274.0 46 262.0 47 244.0 48 234.0 49 214.0 50 191.0 51 157.5 52 132.5 53 109.0 54 84.5 55 80.0 56 67.0 57 43.5 58 34.5 59 29.0 60 16.0 61 8.5 62 7.5 63 4.5 64 3.5 65 3.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.49604894213611 96.6 2 1.325516186591894 2.6 3 0.10196278358399186 0.3 4 0.0 0.0 5 0.0 0.0 6 0.025490695895997964 0.15 7 0.05098139179199593 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 7 0.17500000000000002 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 7 0.17500000000000002 No Hit TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8374999999999999 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.1625 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.6375 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.7125 0.0 0.0 0.0 0.0 132-133 4.0125 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.8375 0.0 0.0 0.0 0.0 138-139 5.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATACTCC 10 0.006830828 145.0 3 CATACTC 10 0.006830828 145.0 2 TCATACT 10 0.006830828 145.0 1 >>END_MODULE Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708836 spots for SRR7170639.sra Written 708836 spots for SRR7170639.sra Read 708839 spots for SRR7170639.sra Written 708839 spots for SRR7170639.sra SRR ids: ['SRR7170639.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pbztlqss SRR7170639.sra spots: 14176723 blocks: [[1, 708836], [708837, 1417672], [1417673, 2126508], [2126509, 2835344], [2835345, 3544180], [3544181, 4253016], [4253017, 4961852], [4961853, 5670688], [5670689, 6379524], [6379525, 7088360], [7088361, 7797196], [7797197, 8506032], [8506033, 9214868], [9214869, 9923704], [9923705, 10632540], [10632541, 11341376], [11341377, 12050212], [12050213, 12759048], [12759049, 13467884], [13467885, 14176723]] SRR7170639 file size 4782325 SRR7170639 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170639 SRR7170639_1.fastq SRR7170639_2.fastq Input file: SRR7170639_1.fastq Paired file: SRR7170639_2.fastq trimmed: SRR7170639-trimmed-pair1.fastq, SRR7170639-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:35:46 2025 >> started Thu Feb 13 13:36:10 2025 >> done (24.391s) 14176723 read pairs processed; of these: 11174 ( 0.08%) short read pairs filtered out after trimming by size control 27417 ( 0.19%) empty read pairs filtered out after trimming by size control 14138132 (99.73%) read pairs available; of these: 6938304 (49.08%) trimmed read pairs available after processing 7199828 (50.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 7 0.00% 21 6 0.00% 22 9 0.00% 23 5 0.00% 24 11 0.00% 25 7 0.00% 26 10 0.00% 27 9 0.00% 28 3 0.00% 29 4 0.00% 30 21 0.00% 31 11 0.00% 32 13 0.00% 33 12 0.00% 34 12 0.00% 35 19 0.00% 36 14 0.00% 37 22 0.00% 38 27 0.00% 39 25 0.00% 40 24 0.00% 41 28 0.00% 42 26 0.00% 43 36 0.00% 44 32 0.00% 45 45 0.00% 46 70 0.00% 47 52 0.00% 48 65 0.00% 49 94 0.00% 50 93 0.00% 51 89 0.00% 52 106 0.00% 53 127 0.00% 54 124 0.00% 55 144 0.00% 56 149 0.00% 57 159 0.00% 58 210 0.00% 59 231 0.00% 60 247 0.00% 61 243 0.00% 62 299 0.00% 63 317 0.00% 64 379 0.00% 65 447 0.00% 66 429 0.00% 67 462 0.00% 68 553 0.00% 69 576 0.00% 70 699 0.00% 71 811 0.01% 72 968 0.01% 73 1096 0.01% 74 1062 0.01% 75 1305 0.01% 76 1815 0.01% 77 1903 0.01% 78 1737 0.01% 79 1898 0.01% 80 2016 0.01% 81 2426 0.02% 82 2761 0.02% 83 3085 0.02% 84 3783 0.03% 85 4445 0.03% 86 4805 0.03% 87 5109 0.04% 88 5301 0.04% 89 5724 0.04% 90 6126 0.04% 91 6526 0.05% 92 7026 0.05% 93 7534 0.05% 94 8146 0.06% 95 8617 0.06% 96 9104 0.06% 97 9318 0.07% 98 9775 0.07% 99 10283 0.07% 100 10742 0.08% 101 11454 0.08% 102 12016 0.08% 103 12904 0.09% 104 13502 0.10% 105 14442 0.10% 106 14988 0.11% 107 15025 0.11% 108 15637 0.11% 109 16407 0.12% 110 17041 0.12% 111 17591 0.12% 112 18518 0.13% 113 19699 0.14% 114 20335 0.14% 115 20939 0.15% 116 21350 0.15% 117 21841 0.15% 118 22572 0.16% 119 23149 0.16% 120 23873 0.17% 121 24716 0.17% 122 25420 0.18% 123 26977 0.19% 124 28106 0.20% 125 28405 0.20% 126 29975 0.21% 127 30657 0.22% 128 31716 0.22% 129 32933 0.23% 130 34070 0.24% 131 35589 0.25% 132 37168 0.26% 133 38992 0.28% 134 41534 0.29% 135 44286 0.31% 136 46961 0.33% 137 50165 0.35% 138 53879 0.38% 139 58530 0.41% 140 63600 0.45% 141 71084 0.50% 142 78915 0.56% 143 92901 0.66% 144 108257 0.77% 145 131410 0.93% 146 167520 1.18% 147 232206 1.64% 148 366977 2.60% 149 752114 5.32% 150 3667901 25.94% 151 7199828 50.92% 14138132 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=18 prefix-density=0.87 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=36.88 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.2 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTG criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=14 prefix-density=0.82 prefix-fanout=2.2 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=53.46 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170639 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:37:11 Started mapping on | Feb 13 13:37:12 Finished on | Feb 13 13:39:36 Mapping speed, Million of reads per hour | 353.45 Number of input reads | 14138132 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13225347 Uniquely mapped reads % | 93.54% Average mapped length | 294.54 Number of splices: Total | 12391134 Number of splices: Annotated (sjdb) | 12105477 Number of splices: GT/AG | 12151910 Number of splices: GC/AG | 193360 Number of splices: AT/AC | 10176 Number of splices: Non-canonical | 35688 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390154 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 27299 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 535297 535297 535297 N_multimapping 390154 390154 390154 N_noFeature 461097 12889733 524322 N_ambiguous 380652 727 107948 UnstrandedReadsAssigned:12383598 PositiveStrandReadsAssigned:334887 NegativeStrandReadsAssigned:12593077 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170639 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170639-trimmed-pair1.fastq SRR7170639-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,138,132 reads, 12,485,245 reads pseudoaligned [quant] estimated average fragment length: 259.419 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR7170639.ke.tsv 34699 SRR7170639.se.tsv 87100 total ==> SRR7170639.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.58 351 10.8118 Potri.005G024800.1.v4.1 1035 776.581 199 13.8889 Potri.004G059700.1.v4.1 961 702.631 17 1.31136 Potri.007G009000.2.v4.1 1416 1157.58 0 0 Potri.003G141000.2.v4.1 2943 2684.58 481.311 9.71739 Potri.016G087400.1.v4.1 270 75.9192 900 642.528 Potri.015G069301.1.v4.1 564 311.46 0 0 Potri.010G195200.1.v4.1 1773 1514.58 9 0.32207 Potri.012G127500.1.v4.1 977 718.602 146 11.012 ==> SRR7170639.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 603 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 373 Potri.001G212900.v4.1 298 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170639 completed mapping pipeline successfully