Starting /dee2/code/volunteer_pipeline.sh SRR7170641 current disk space = 3090273710080 free memory = 1578123360 SRR7170641 SRAfilesize 43c2d84b1208df3e7a1df79875812bac SRR7170641.sra SRR7170641.sra file validated SRR7170641 is paired end SRR7170641 is conventional basespace SRR7170641 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170641_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.2925 30.0 18.0 33.0 18.0 33.0 2 25.77075 27.0 18.0 31.0 18.0 33.0 3 29.52925 31.0 28.0 33.0 25.0 33.0 4 31.7475 33.0 31.0 33.0 29.0 33.0 5 32.42375 33.0 33.0 33.0 32.0 34.0 6 36.5675 38.0 37.0 38.0 34.0 38.0 7 36.82225 38.0 37.0 38.0 34.0 38.0 8 37.22025 38.0 38.0 38.0 36.0 38.0 9 37.40875 38.0 38.0 38.0 37.0 38.0 10-14 37.3714 38.0 38.0 38.0 37.0 38.0 15-19 37.3852 38.0 38.0 38.0 37.0 38.0 20-24 37.482749999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.484500000000004 38.0 38.0 38.0 37.4 38.0 30-34 37.411 38.0 38.0 38.0 37.2 38.0 35-39 37.40755 38.0 38.0 38.0 37.0 38.0 40-44 37.32325 38.0 38.0 38.0 37.0 38.0 45-49 37.30515 38.0 38.0 38.0 37.0 38.0 50-54 37.231849999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.14855000000001 38.0 38.0 38.0 36.0 38.0 60-64 37.159 38.0 38.0 38.0 36.2 38.0 65-69 37.02635 38.0 38.0 38.0 36.0 38.0 70-74 36.92015 38.0 38.0 38.0 35.4 38.0 75-79 36.82785 38.0 38.0 38.0 35.2 38.0 80-84 36.84105 38.0 38.0 38.0 35.2 38.0 85-89 36.64059999999999 38.0 38.0 38.0 34.4 38.0 90-94 36.4788 38.0 38.0 38.0 34.0 38.0 95-99 36.36855 38.0 37.4 38.0 34.0 38.0 100-104 36.08985 38.0 37.0 38.0 33.2 38.0 105-109 36.052099999999996 38.0 37.0 38.0 33.0 38.0 110-114 35.939400000000006 38.0 37.0 38.0 32.4 38.0 115-119 35.763099999999994 38.0 36.4 38.0 31.8 38.0 120-124 35.60735 38.0 36.0 38.0 31.0 38.0 125-129 35.293000000000006 38.0 35.8 38.0 29.2 38.0 130-134 34.80465 38.0 35.0 38.0 27.6 38.0 135-139 34.06699999999999 38.0 33.8 38.0 23.4 38.0 140-144 33.3762 38.0 33.4 38.0 20.2 38.0 145-149 32.52499999999999 38.0 33.0 38.0 14.0 38.0 150-151 28.593375 35.5 23.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 3.0 19 3.0 20 2.0 21 2.0 22 5.0 23 7.0 24 7.0 25 13.0 26 16.0 27 22.0 28 27.0 29 39.0 30 35.0 31 73.0 32 92.0 33 140.0 34 214.0 35 381.0 36 980.0 37 1930.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.28424569519404 16.962220508866615 12.310460035980467 36.44307375995888 2 18.65 24.0 37.7 19.650000000000002 3 16.175 30.5 28.225 25.1 4 21.075 36.1 23.575 19.25 5 20.04008016032064 37.5 24.173346693386772 18.286573146292582 6 16.275000000000002 35.475 26.375 21.875 7 13.450000000000001 18.975 45.5 22.075 8 16.5 20.45 28.475 34.575 9 17.4 21.775 31.624999999999996 29.2 10-14 19.535 29.43 26.595000000000002 24.44 15-19 19.195 28.4 27.305 25.1 20-24 19.215 28.625 28.015 24.145 25-29 20.005 28.315 28.065 23.615 30-34 19.73 28.89 27.52 23.86 35-39 19.869999999999997 28.54 27.465 24.125 40-44 20.215 28.24 27.85 23.695 45-49 19.535 28.794999999999998 27.755000000000003 23.915 50-54 20.225 28.505000000000003 27.265 24.005000000000003 55-59 19.685 28.575 27.87 23.87 60-64 19.905 28.105000000000004 27.865000000000002 24.125 65-69 20.24 28.365000000000002 27.735 23.66 70-74 19.915 28.294999999999998 27.750000000000004 24.04 75-79 20.03 28.605000000000004 27.825 23.54 80-84 20.43 28.105000000000004 27.66 23.805 85-89 20.275000000000002 28.194999999999997 27.51 24.02 90-94 19.875 28.46 27.455000000000002 24.21 95-99 20.580000000000002 28.32 27.334999999999997 23.765 100-104 20.135 28.58 27.51 23.775 105-109 19.935 28.4 27.845 23.82 110-114 19.665 28.199999999999996 28.08 24.055 115-119 20.77 28.455000000000002 27.215 23.56 120-124 20.625 28.815 27.43 23.13 125-129 20.735 28.225 27.38 23.66 130-134 21.325 27.725 27.38 23.57 135-139 20.645 28.215 27.02 24.12 140-144 20.305 28.610000000000003 26.985 24.099999999999998 145-149 20.75 27.845 27.534999999999997 23.87 150-151 20.7125 27.9125 27.825 23.549999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 2.5 26 4.5 27 8.0 28 13.5 29 15.5 30 17.0 31 24.5 32 35.5 33 44.0 34 60.5 35 73.5 36 82.5 37 118.5 38 136.0 39 164.5 40 198.0 41 216.0 42 241.0 43 255.5 44 277.5 45 284.5 46 279.0 47 263.0 48 218.5 49 174.5 50 150.5 51 139.5 52 117.5 53 87.0 54 67.0 55 53.5 56 43.0 57 31.0 58 22.5 59 19.0 60 19.0 61 14.5 62 8.0 63 4.0 64 2.0 65 2.0 66 1.0 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.725 2 0.0 3 0.0 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01390644753477 97.89999999999999 2 0.8596713021491783 1.7000000000000002 3 0.1011378002528445 0.3 4 0.025284450063211124 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.2999999999999998 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.4375 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.275 0.0 0.0 0.0 0.0 136-137 3.4749999999999996 0.0 0.0 0.0 0.0 138-139 3.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTCCA 10 0.0068343505 144.975 145 CATCCTG 10 0.0068343505 144.975 9 >>END_MODULE SRR7170641 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170641_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77475 33.0 33.0 34.0 32.0 34.0 2 32.86 33.0 33.0 34.0 32.0 34.0 3 32.8995 34.0 33.0 34.0 32.0 34.0 4 32.86575 34.0 33.0 34.0 32.0 34.0 5 32.859 34.0 33.0 34.0 32.0 34.0 6 36.9645 38.0 38.0 38.0 36.0 38.0 7 37.04125 38.0 38.0 38.0 36.0 38.0 8 37.0175 38.0 38.0 38.0 36.0 38.0 9 36.961 38.0 38.0 38.0 36.0 38.0 10-14 37.00165 38.0 38.0 38.0 36.2 38.0 15-19 37.003699999999995 38.0 38.0 38.0 36.6 38.0 20-24 36.96495 38.0 38.0 38.0 36.0 38.0 25-29 36.930150000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.8583 38.0 38.0 38.0 35.8 38.0 35-39 36.89135 38.0 38.0 38.0 36.0 38.0 40-44 36.93325 38.0 38.0 38.0 36.0 38.0 45-49 36.80405 38.0 38.0 38.0 35.8 38.0 50-54 36.782 38.0 38.0 38.0 36.0 38.0 55-59 36.6915 38.0 38.0 38.0 35.0 38.0 60-64 36.6845 38.0 38.0 38.0 35.2 38.0 65-69 36.6649 38.0 38.0 38.0 35.2 38.0 70-74 36.6278 38.0 38.0 38.0 34.8 38.0 75-79 36.5083 38.0 38.0 38.0 34.4 38.0 80-84 36.35065 38.0 38.0 38.0 34.0 38.0 85-89 36.25775 38.0 38.0 38.0 34.0 38.0 90-94 36.16995 38.0 38.0 38.0 33.8 38.0 95-99 35.905550000000005 38.0 37.4 38.0 32.6 38.0 100-104 35.7921 38.0 37.0 38.0 32.0 38.0 105-109 35.6956 38.0 37.0 38.0 31.0 38.0 110-114 35.512800000000006 38.0 37.0 38.0 30.6 38.0 115-119 35.30545 38.0 36.4 38.0 29.6 38.0 120-124 35.008750000000006 38.0 35.8 38.0 27.6 38.0 125-129 34.498900000000006 38.0 35.2 38.0 25.2 38.0 130-134 34.2642 38.0 34.2 38.0 24.2 38.0 135-139 33.97865 38.0 33.2 38.0 24.2 38.0 140-144 33.2481 38.0 33.0 38.0 20.2 38.0 145-149 32.18679999999999 38.0 33.0 38.0 12.2 38.0 150-151 26.740000000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 7.0 4 0.0 5 2.0 6 1.0 7 0.0 8 1.0 9 2.0 10 0.0 11 2.0 12 4.0 13 2.0 14 2.0 15 4.0 16 3.0 17 5.0 18 1.0 19 6.0 20 12.0 21 10.0 22 10.0 23 11.0 24 8.0 25 25.0 26 22.0 27 34.0 28 32.0 29 58.0 30 56.0 31 55.0 32 82.0 33 115.0 34 195.0 35 292.0 36 695.0 37 2237.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.25 16.325 14.549999999999999 29.875 2 23.599999999999998 23.95 36.7 15.75 3 21.725 25.374999999999996 32.625 20.275000000000002 4 22.225 35.575 22.25 19.950000000000003 5 22.650000000000002 38.475 21.0 17.875 6 17.329332333083272 38.234558639659916 23.95598899724931 20.4801200300075 7 17.179294823705927 15.803950987746937 45.8114528632158 21.205301325331334 8 19.754938734683673 21.355338834708675 29.307326831707925 29.582395598899723 9 22.736368184092047 23.111555777888945 28.114057028514257 26.038019009504755 10-14 22.2666800040012 29.158747624287283 26.4629388816645 22.111633490047016 15-19 23.175793948487122 28.00200050012503 28.247061765441362 20.575143785946487 20-24 23.040760190047514 28.132033008252062 27.62690672668167 21.200300075018756 25-29 22.705676419104776 28.397099274818704 27.836959239809957 21.060265066266567 30-34 23.20080020005001 28.49212303075769 27.646911727931982 20.660165041260314 35-39 23.393187615665482 27.31956184664633 28.675036262691943 20.612214274996248 40-44 23.056528264132066 27.963981990995496 28.174087043521762 20.805402701350676 45-49 22.9057264316079 27.811952988247064 28.092023005751436 21.1902975743936 50-54 22.875718929732432 27.881970492623154 28.217054263565895 21.02525631407852 55-59 23.265816454113526 27.56689172293073 28.067016754188543 21.10027506876719 60-64 22.925731432858214 27.49687421855464 27.866966741685424 21.710427606901725 65-69 23.5747149429886 27.785557111422282 27.740548109621926 20.899179835967193 70-74 22.902290229022903 28.11781178117812 27.75777577757776 21.222122212221223 75-79 23.432343234323433 28.07780778077808 27.507750775077504 20.982098209820983 80-84 23.15231523152315 27.502750275027505 28.092809280928094 21.252125212521253 85-89 22.751137556877843 27.75638781939097 28.14140707035352 21.35106755337767 90-94 23.400000000000002 27.85 27.334999999999997 21.415 95-99 23.395 27.575 28.23 20.8 100-104 23.235 28.34 28.375 20.05 105-109 23.55971194238848 27.905581116223242 27.940588117623527 20.594118823764752 110-114 23.39584896224056 27.751937984496124 27.89197299324831 20.960240060015003 115-119 23.52588147036759 27.591897974493623 27.94698674668667 20.935233808452114 120-124 24.16862529379407 27.774166124918736 27.264089613442017 20.793118967845174 125-129 24.099999999999998 28.12 27.82 19.96 130-134 23.86357953693054 27.089063359503925 28.4142621393209 20.633094964244634 135-139 23.77094273568392 27.481870467616904 28.197049262315577 20.550137534383595 140-144 24.026006501625407 27.70692673168292 27.911977994498628 20.355088772193046 145-149 24.33621681084054 28.056402820141006 27.396369818490925 20.211010550527526 150-151 24.637500000000003 28.775000000000002 27.0625 19.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 1.5 19 0.5 20 0.5 21 0.5 22 0.0 23 1.5 24 3.0 25 3.0 26 5.0 27 6.5 28 9.0 29 11.0 30 15.0 31 20.5 32 29.0 33 36.5 34 48.0 35 71.5 36 84.0 37 106.5 38 140.5 39 176.0 40 195.5 41 208.0 42 233.0 43 246.5 44 259.5 45 274.0 46 274.0 47 249.0 48 228.5 49 207.5 50 164.5 51 143.0 52 126.5 53 95.5 54 76.5 55 62.5 56 48.5 57 33.5 58 24.0 59 23.5 60 20.5 61 11.5 62 7.5 63 7.5 64 3.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.05 10-14 0.03 15-19 0.025 20-24 0.025 25-29 0.025 30-34 0.025 35-39 0.034999999999999996 40-44 0.05 45-49 0.025 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.02 70-74 0.01 75-79 0.01 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.025 115-119 0.025 120-124 0.015 125-129 0.0 130-134 0.015 135-139 0.025 140-144 0.025 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96333754740834 97.85000000000001 2 0.9355246523388117 1.8499999999999999 3 0.1011378002528445 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.2625 0.0 0.0 0.0 0.0 112-113 1.3250000000000002 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.7 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.05 0.0 0.0 0.0 0.0 124-125 2.25 0.0 0.0 0.0 0.0 126-127 2.4875 0.0 0.0 0.0 0.0 128-129 2.6 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.4 0.0 0.0 0.0 0.0 136-137 3.575 0.0 0.0 0.0 0.0 138-139 3.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATAGT 10 0.006830828 145.0 7 AATAGTC 10 0.006830828 145.0 8 >>END_MODULE Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820986 spots for SRR7170641.sra Written 820986 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra Read 820970 spots for SRR7170641.sra Written 820970 spots for SRR7170641.sra SRR ids: ['SRR7170641.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m3uzwnve SRR7170641.sra spots: 16419416 blocks: [[1, 820970], [820971, 1641940], [1641941, 2462910], [2462911, 3283880], [3283881, 4104850], [4104851, 4925820], [4925821, 5746790], [5746791, 6567760], [6567761, 7388730], [7388731, 8209700], [8209701, 9030670], [9030671, 9851640], [9851641, 10672610], [10672611, 11493580], [11493581, 12314550], [12314551, 13135520], [13135521, 13956490], [13956491, 14777460], [14777461, 15598430], [15598431, 16419416]] SRR7170641 file size 5542300 SRR7170641 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170641 SRR7170641_1.fastq SRR7170641_2.fastq Input file: SRR7170641_1.fastq Paired file: SRR7170641_2.fastq trimmed: SRR7170641-trimmed-pair1.fastq, SRR7170641-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:58:33 2025 >> started Thu Feb 13 13:58:54 2025 >> done (20.641s) 16419416 read pairs processed; of these: 17868 ( 0.11%) short read pairs filtered out after trimming by size control 15632 ( 0.10%) empty read pairs filtered out after trimming by size control 16385916 (99.80%) read pairs available; of these: 8298748 (50.65%) trimmed read pairs available after processing 8087168 (49.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 2 0.00% 20 4 0.00% 21 5 0.00% 22 3 0.00% 23 5 0.00% 24 8 0.00% 25 8 0.00% 26 11 0.00% 27 12 0.00% 28 9 0.00% 29 9 0.00% 30 5 0.00% 31 7 0.00% 32 14 0.00% 33 8 0.00% 34 10 0.00% 35 12 0.00% 36 19 0.00% 37 21 0.00% 38 21 0.00% 39 15 0.00% 40 22 0.00% 41 19 0.00% 42 29 0.00% 43 22 0.00% 44 28 0.00% 45 32 0.00% 46 26 0.00% 47 48 0.00% 48 52 0.00% 49 77 0.00% 50 87 0.00% 51 72 0.00% 52 79 0.00% 53 98 0.00% 54 81 0.00% 55 86 0.00% 56 93 0.00% 57 99 0.00% 58 133 0.00% 59 163 0.00% 60 178 0.00% 61 179 0.00% 62 183 0.00% 63 276 0.00% 64 269 0.00% 65 298 0.00% 66 289 0.00% 67 370 0.00% 68 355 0.00% 69 445 0.00% 70 533 0.00% 71 605 0.00% 72 660 0.00% 73 737 0.00% 74 842 0.01% 75 940 0.01% 76 1171 0.01% 77 1168 0.01% 78 1267 0.01% 79 1395 0.01% 80 1553 0.01% 81 1801 0.01% 82 1936 0.01% 83 2401 0.01% 84 3095 0.02% 85 3760 0.02% 86 4024 0.02% 87 4899 0.03% 88 4658 0.03% 89 4936 0.03% 90 4945 0.03% 91 5299 0.03% 92 5509 0.03% 93 6129 0.04% 94 6499 0.04% 95 7000 0.04% 96 7246 0.04% 97 7603 0.05% 98 7838 0.05% 99 8589 0.05% 100 8959 0.05% 101 9414 0.06% 102 9874 0.06% 103 10361 0.06% 104 10994 0.07% 105 11669 0.07% 106 12168 0.07% 107 12912 0.08% 108 12947 0.08% 109 13727 0.08% 110 14392 0.09% 111 15134 0.09% 112 15397 0.09% 113 16744 0.10% 114 17332 0.11% 115 17891 0.11% 116 18591 0.11% 117 19394 0.12% 118 19910 0.12% 119 20482 0.12% 120 21446 0.13% 121 22480 0.14% 122 23313 0.14% 123 25467 0.16% 124 25863 0.16% 125 27185 0.17% 126 28495 0.17% 127 30360 0.19% 128 31858 0.19% 129 32415 0.20% 130 34471 0.21% 131 36109 0.22% 132 38476 0.23% 133 40939 0.25% 134 44381 0.27% 135 46673 0.28% 136 50811 0.31% 137 55800 0.34% 138 61254 0.37% 139 67907 0.41% 140 75968 0.46% 141 86266 0.53% 142 99044 0.60% 143 116266 0.71% 144 138900 0.85% 145 171325 1.05% 146 221557 1.35% 147 314656 1.92% 148 488300 2.98% 149 990893 6.05% 150 4448135 27.15% 151 8087168 49.35% 16385916 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.55 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=19 fanout-score=20.77 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=8.2 sequence=TCCTCCTTGTTGTACATGCCGGGAAGTTGCACATTTGTTGGGTTGTCAGCAATGTTCATGAGGGTAGCATTAACCATCTGGTTGTTGACGGTGTATTGGGTAGTTCCACCAAGTCTACCAGCTCCGGC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=12 prefix-density=0.76 prefix-fanout=2.5 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=27.41 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.1 sequence=AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACAACTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR7170641 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:59:42 Started mapping on | Feb 13 13:59:43 Finished on | Feb 13 14:01:33 Mapping speed, Million of reads per hour | 536.27 Number of input reads | 16385916 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15284966 Uniquely mapped reads % | 93.28% Average mapped length | 295.50 Number of splices: Total | 15497156 Number of splices: Annotated (sjdb) | 15177747 Number of splices: GT/AG | 15210692 Number of splices: GC/AG | 240333 Number of splices: AT/AC | 8312 Number of splices: Non-canonical | 37819 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431007 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 184226 % of reads mapped to too many loci | 1.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 684484 684484 684484 N_multimapping 431007 431007 431007 N_noFeature 680753 15031629 772479 N_ambiguous 258872 1491 96187 UnstrandedReadsAssigned:14345341 PositiveStrandReadsAssigned:251846 NegativeStrandReadsAssigned:14416300 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170641 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170641-trimmed-pair1.fastq SRR7170641-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,385,916 reads, 14,425,112 reads pseudoaligned [quant] estimated average fragment length: 287.775 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR7170641.ke.tsv 34699 SRR7170641.se.tsv 87100 total ==> SRR7170641.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.23 606 22.5307 Potri.005G024800.1.v4.1 1035 748.225 120 10.323 Potri.004G059700.1.v4.1 961 674.355 21 2.00441 Potri.007G009000.2.v4.1 1416 1129.23 0 0 Potri.003G141000.2.v4.1 2943 2656.23 916.123 22.1996 Potri.016G087400.1.v4.1 270 70.4129 617 564.012 Potri.015G069301.1.v4.1 564 288.622 0 0 Potri.010G195200.1.v4.1 1773 1486.23 26 1.12602 Potri.012G127500.1.v4.1 977 690.288 114 10.6299 ==> SRR7170641.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 937 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 7 SRR7170641 completed mapping pipeline successfully